DNA mismatch repair ensures faithful transmission of genetic material from parents to progeny, which is required for the survival of the organism. The studies on E. coli MMR proteins have formed the basis for the study of the MMR system in eukaryotic organisms, because the functions of MMR proteins believed to be been conserved. In organisms that harbor MutH protein, it is known that MutH acts as a monomer which nicks the unmethylated daughter strand and is activated in a MutS-MutL- dependent manner. The cleavage specificity of MutH is very stringent. Till recently, it was not clear as to how MutH distinguishes hemimethylated DNA from fully or unmethylated DNA. The co-crystal structures of MutH-DNA complexes revealed that Y212, R184 and P185 were in close proximity to the methyl-adenine. Clustal-W sequence alignment of MutH with Sau3AI showed that Sau3AI has PCT residues instead of L183, R184, and P185. A triple mutant MutH-L183P-R184C-P185T was found to cleave both unmethylated and methylated DNA. The nicking endonuclease activity of the LRP→ PCT triple mutant was enhanced in the presence of Haemophilus influenzae MutL. The mutL gene of Neisseria gonorrhoeae was cloned and the gene product purified. It was shown that the homodimeric Neisseria gonorrhoeae MutL (NgoL) protein displays an endonuclease activity that incises covalently closed circular DNA in the presence of manganese or magnesium or calcium ions unlike human MutLα which shows endonuclease activity only in the presence of manganese. Further more the C-terminal domain of Neisseria gonorrhoeae MutL (NgoL-CTD) consisting of amino acids 460 to 658 also exhibits Mn2+ dependent endonuclease activity. Sedimentation velocity, sedimentation equilibrium and dynamic light scattering experiments show NgoL-CTD to be a dimer. By in vitro comparison of wild-type and a mutant NgoL-CTD protein, it was shown that the latter protein exhibits highly reduced endonuclease activity. Surface plasmon resonance spectroscopy was used to determine the kinetics of DNA binding by NgoL. The DNA binding was carried out in absence of metal ions. Interaction studies with NgoL with ssDNA in SPR spectroscopy revealed a KD value of 4.7 × 10–8 M. While the human MutLα endonuclease activity was shown to be stimulated by ATP, ATP inhibits NgoL endonuclease activity. By in vitro comparison of wild-type and a mutant NgoL-CTD protein, it was shown that the latter protein exhibits highly reduced endonuclease activity. NgoL ATPase activity was enhanced in the presence of DNA. The fact that NgoL ATPase activity is stimulated ~ 2.5-fold by dsDNA and ~ 2-fold by ssDNA is a further evidence for the interaction between NgoL and DNA. The results presented above show that NgoL harbors a nicking endonuclease activity which is present in the C-terminal domain. NgoL and NgoL-CTD are dimers in solution and DMHA(X)2E(X)4E motif present in the CTD is required for the nicking endonuclease activity. These results suggest that DNA mismatch repair mechanism in N. gonorrhoeae is different from that in E. coli. In the absence of MutH homolog, N. gonorrhoeae is able to repair the DNA by virtue of MutL nicking endonuclease activity.

The methylotrophic yeast Pichia pastoris is widely used for recombinant protein production due to its ability to grow to high cell densities as well as possession of an inducible methanol utilization pathway (MUT). The expression of genes encoding enzymes of the MUT pathway is very tightly regulated. These genes are turned on when methanol but not glucose is used as the sole carbon source. Thus, P. pastoris cells can be grown to high densities in glucose containing medium and expression of genes of MUT pathway can be turned on by changing the carbon source to methanol. This strategy is widely used for recombinant protein production wherein the gene of interest is cloned downstream of the methanol-inducible promoter of the gene encoding the first enzyme of the MUT pathway, alcohol oxidase I (AOXI). Despite production of a large number of recombinant proteins using the AOXI promoter, the mechanism of transcriptional activation of AOXI is not very well understood. It is only recently that a zinc finger protein known as Mxr1p (methanol expression regulator 1) was shown to play a key role in the regulation of AOXI as well as other genes of methanol utilization pathway (1) P. pastoris strains that do not express Mxr1p (mxr1) are unable to grow on peroxisomal substrates such as methanol and oleic acid. Methanol-inducible expression of genes involved in MUT pathway as well as those involved in peroxisome biogenesis (peroxins,) is severely impaired in mxr1 strains. While Mxr1p is constitutively expressed in cells cultured on glucose as well as methanol, it is cytosolic in glucose-grown cells, but nuclear in methanol-grown cells (1). The exact nucleotide sequence to which Mxr1p binds and regulates the expression of genes of MUT pathway is not known. The aim of this thesis is to map the Mxr1p binding sites in the promoters of methanol-inducible genes of P. pastoris. As a first step towards understanding the mechanism of transcriptional regulation of AOXI and other methanol inducible genes of P. pastoris by Mxr1p, the N-terminal region comprising of 150 amino acids, including the zinc finger DNA binding domain of Mxr1p was cloned into an E. coli expression vector and the recombinant protein was purified from E. coli cells. This recombinant protein (referred to as Mxr1p in this study) was used in an electrophoretic mobility shift assay (EMSA) to identify Mxr1p binding sites in the AOXI promoter. EMSA was carried out with sixteen different oligonucleotides spanning AOXI promoter region between -940 and -114 bp. Such studies led to the identification of six Mxr1p binding sites in AOXI promoter. Using a combination of DNase I footprinting as well as EMSA with chimeric double stranded oligonucleotides, the minimal Mxr1p binding site was identified as a 20 bp DNA sequence containing a core 5’CYCC 3’ sequence. Using methylation interference as well as extensive mutagenesis studies, nucleotides critical for Mxr1p binding were identified. Comparative analysis of Mxr1p binding sites identified in our study with the AOXI promoter deletion studies of Hartner et al (2) suggested that the Mxr1p binding sites identified in our study are likely to function as methanol-inducible enhancers in vivo, since deletion of AOXI promoter regions comprising Mxr1p binding sites results in a significant loss of methanol-inducible promoter activity. Thus, Mxr1p binding sites are likely to function as Mxr1p response elements (MXREs) in vivo. Mxr1p is considered to be the P. pastoris homologue of S. cerevisiae Adr1p (alcohol dehydrogenase II [ADH2] synthesis regulator). Adr1p is a key regulator of S. cerevisiae genes involved in the metabolism of glycerol, ethanol and oleic acid. The DNA binding domains of Adr1p and Mxr1p share 82% similarity and 70% identity. We therefore examined whether Mxr1p can bind to the Adr1p binding site of ADH2 promoter(ADH2-UAS1). Our studies indicate that Mxr1p does not bind to ADH2-UAS1. Interestingly, a single point mutation restores Mxr1p binding to ADH2-UAS1. Since Mxr1p is involved in the regulation of a number of genes including AOXI, we examined whether promoters of other Mxr1p-regulated genes also harbour MXREs similar to those identified in AOXI promoter. The promoters of genes encoding dihydroxyacetone synthase (DHAS) and peroxin 8 (PEX8) were chosen for this purpose. A detailed analysis of Mxr1p binding to these promoter sequences led to the conclusion that DHAS and PEX8 promoters also harbour Mxr1p binding sites similar to those of AOXI promoter. Based on these studies, we have derived a consensus sequence for Mxr1p binding. This study is the first report on detailed characterization of Mxr1p binding sites in three methanol-inducible promoters of P. pastoris and thus provides the molecular framework by which this transcription factor functions as a master regulator of genes involved in methanol utilization pathway of P. pastoris. Our study provides the blue print for mapping Mxr1p binding sites in the promoters of other Mxr1p-regulated genes.

Os herbicidas ametrina e clomazone são amplamente utilizados na cultura de cana-deaçúcar, apresentam degradação essencialmente microbiana e são considerados contaminantes de solos e águas. A exposição dos microrganismos a estes xenobióticos pode resultar em dano oxidativo devido ao aumento na produção de espécies reativas de oxigênio (EROs). Este trabalho teve como objetivo analisar respostas bioquímicas e fisiológicas de dois isolados bacterianos tolerantes aos herbicidas ametrina e clomazone. As bactérias foram isoladas de solos agrícolas e a partir de estudos fisiológicos, crescimento e formação de halo, foram selecionadas duas que apresentaram maior tolerância aos herbicidas. Esses microrganismos foram cultivados em meio de cultura ágar nutriente, a 30°C, por 14 horas na presença dos herbicidas ametrina (25 mM), clomazone (9 mM), e em meio composto pelos dois herbicidas: ametrina (20 mM) + clomazone (20 mM). Essas concentrações representam as dosagens utilizadas para o cultivo de cana-deaçúcar para a aplicação pré e pós-emergência. Por meio da análise filogenética baseada no gene 16S ribossômico, o isolado bacteriano CC07 mostrou-se próximo a Pseudomonas aeruginosa, enquanto que o isolado 4C07 ficou próximo à Pseudomonas fulva. A peroxidação lipídica foi observada somente para o isolado CC07 na presença dos herbicidas em mistura. O perfil protéico foi avaliado em SDS-PAGE, o qual revelou a indução de uma nova proteína de aproximadamente 60 KDa para o isolado 4C07 na presença dos herbicidas, porém, não foram observadas diferenças significativas para o isolado CC07. A enzima superóxido dismutase (SOD) apresentou aumento significativo da atividade para ambos isolados quando expostos aos herbicidas, entretanto, diferenças na atividade da enzima catalase (CAT) não foram observadas. Para o isolado 4C07 na presença dos herbicidas foi observado aumento significativo no conteúdo de glutationa reduzida (GSH), o qual foi acompanhado pela indução de uma nova isoforma de GR (I), que respondeu especificamente ao clomazone e os herbicidas em mistura. A glutationa-S-transferase (GST) também apresentou acréscimos de atividade quando o isolado 4C07 foi exposto aos herbicidas. Porém, para o isolado CC07 as enzimas GR, GST, assim, como a GSH não apresentaram respostas significativas a presença dos herbicidas. Assim, foi possível observar que o isolado 4C07 possui um sistema antioxidante mais eficaz, quando comparado com o isolado CC07. Além disso, os resultados sugerem que as enzimas SOD, GR, GST e o composto GSH podem estar relacionados com o mecanismo de tolerância do isolado 4C07 aos herbicidas ametrina e clomazone, o que pode demonstrar uma provável adaptação aos ambientes estressantes. / The herbicides ametrina and clomazone are widely used in the sugar cane cultivation, showing essential microbial degradation, besides being considered contaminants of soil and water. The exposure of microorganisms to xenobiotics can result in oxidative damage due to increased production of reactive oxygen species (ROS). This study aimed to analyze biochemical and physiological responses of two bacterial strains tolerant to the herbicides ametrina and clomazone. The bacteria strains were isolated from agricultural soils and according to physiological studies, growth and halo formation, two of them with the most herbicide tolerance were selected. These microorganisms were grown in nutrient agar plates at 30 ° C for 14 hours in the presence of herbicides ametrina (25 mM), clomazone (9 mM), and in a medium composed by two herbicides: ametrina (20 mM) + clomazone (20 mM). These concentrations represent the concentrations used for growing sugar cane for pre and post-emergence. Through the phylogenetic analysis based on 16S ribosomal gene, the CC07 strain was close to Pseudomonas aeruginosa, while the 4C07 strain was close to Pseudomonas fulva. According to the results obtained, lipid peroxidation was only observed for CC07 strain in a medium composed by two herbicides. The protein profile was evaluated by SDS-PAGE, which revealed the induction of a new protein of approximately 60 kDa for 4C07 strain in the presence of the two herbicides, differently to that observed for CC07 strain. The activity of the enzyme superoxide dismutase (SOD) increased significantly for both strains when exposed to the herbicides, however, no differences were observed for catalase (CAT) activity. The 4C07 strain showed increase in content of reduced glutathione (GSH) in the presence of the herbicides, which was accompanied by the induction of a new isoform of GR (I). Similarly, the 4C07 strain exhibited an increase in Glutathione-S-transferase (GST) activity to herbicides exposure. However, for the CC07 strain, the GR and GST enzymes, as well as the GSH content did not exhibit differences. Thus, we observed that the 4C07 strain may have an antioxidant system more effective when compared to the CC07 strain. Moreover, the results suggest that the enzymes SOD, GR, GST and GSH content may be related to the mechanism of tolerance of 4C07 strain to ametrina and clomazone herbicides, showing the tendency to deal better and adapt to stressful environments.

No description available.

No description available.

Recombination Activating Genes (RAGs) orchestrate the process called V (D) J recombination, which enables the vertebrate adaptive immune system to specifically recognize millions of antigens. During this recombination process, V (variable), D (diversity) and J (joining) gene segments of antibody (B cell receptor) and TCR (T cell receptor) join by different possible combinations to generate antigen receptor diversity. This unique site specific recombination process is actuated by lymphoid specific proteins called RAG1 and RAG2 (RAGs or RAG complex). RAGs recognize a conserved sequence motif flanking the above subexons called Recombination Signal Sequence (RSS). There are two types of RSS known as 12-RSS and 23-RSS, where a conserved heptamer sequence and nonameric sequence is separated by 12 or 23 bp, respectively. RAGs specifically bind to RSS by RAG1 Nonamer Binding Domain (NBD) and generate nicks which are converted to DSBs via a hairpin intermediate and finally repaired by Non-Homologous DNA End Joining (NHEJ), a major DSB repair pathway in eukaryotes. Thus, RAGs act as a sequence specific endonuclease, and is unique to higher eukaryotes. Therefore, reduced or loss of RAG activity could result in immune deficiency syndromes like Omenn Syndrome (OS) and Severe Combined Immunodeficiency (SCID). Apart from acting as a sequence specific nuclease, RAGs have been shown to cleave on altered DNA structures like mismatches (bubbles), hairpins, flaps, gaps, triplexes and 3’ overhangs. This structure specific nuclease activity is implicated in causing genomic instability in B and T cells, particularly leading to generation of chromosomal translocations in certain lymphoid cancers. However, unlike the sequence- specific cleavage activity, this novel property of RAGs is poorly understood. Structure-specific nuclease activity of RAGs was characterized by using heteroduplex DNA substrate containing bubble region. RAG proteins were overexpressed and purified from human cell line and used for the assay. Results showed that RAGs cleave different bubble substrates with different efficiency. The role of DNA sequence at single-stranded region of heteroduplex DNA on RAG cleavage was investigated by synthesizing the substrate DNA having either adenineguanine/ thymine/ cytosine in the bubble sequence. Interestingly, efficient RAG cleavage was observed only when cytosines were present at single-stranded region, while thymine bubbles were cleaved with much lower efficiency. Adenine and guanine containing bubbles were not cleaved by RAGs. This was the first observation showing sequence specificity during structure-specific nuclease activity of RAGs. Besides, it was observed that RAG cleavage on bubbles with cytosines resulted in DSB formation, which is essential for generation of chromosomal translocations. Further, such specificity and cytosine preference was observed, even when RAGs acted on other altered DNA substrates like hairpin loops, 3’ overhangs and gaps. When the role of flanking duplex region on RAG cleavage was tested, only the 5’ duplex nucleotide was critical for RAG cleavage reaction and cytosine was the most preferred nucleotide. By systematic mutation of bubble region, it was observed that the two cytosines present at the double strand-single strand junction are critical for RAG cleavage. A single nucleotide bubble (mismatch) with cytosines was cleaved by RAGs with low but detectable efficiency. A bubble with at least 2 nt length possessing cytosine was cleaved with higher efficiency resulting in both single-stranded nicks and DSBs. Based on these studies, “C(d)C(s)C(s)” was proposed as a novel recognition motif for RAG cleavage, on altered DNA structures, where“d” and “s” represent double- and single-strand region, respectively. To be targeted by RAGs in vivo, the altered DNA substrates have to compete with RSS, the physiological substrate. It is not known whether such structures will be cleaved by RAGs, when present along with RSS. Besides, the regulation of the both structure and sequence specific nuclease activities are not studied. To address the above questions, RAG cleavage on bubble substrates was performed in presence of RSS either in cis or trans configuration. Results showed that both bubble substrates and RSS were cleaved with similar efficiency by RAGs. In fact, they can compete out each other in a concentration dependent manner. When kinetics of RSS and bubble cleavage were performed, RSS cleavage reaction was faster and saturated within 10-15 min, while bubbles cleavage started slow and went on increasing with time. This difference in kinetics persisted when both substrates were present together. This could be a regulatory mechanism for targeting RAGs to RSS sites and limiting bubble cleavage which can be deleterious to cells. HMGB1, a DNA binding protein which is shown to enhance RSS binding and synapsis, does not affect RAG action on bubble substrates. RAG postcleavage complex is formed during V(D)J recombination process where RAGs remain bound to cleaved RSS after cleavage, which limits further RAG action on other sites. Such cleavage complex was not detected on bubble substrates, which suggests that after cleavage RAGs were not associated to DSBs of bubble cleavage. Finally, the nonamer binding domain of RAG1 involved in RSS binding in V(D)J recombination, was found to be dispensable for the structure-specific nuclease activity and it appears that RAGs bind to bubble substrates using a different domain. In summary, in this study, the structure-specific nuclease activity of RAGs was characterized. A novel sequence motif that can regulate this activity of RAGs was identified. Though altered structures can be equally favored substrates as RSS, differences in reaction kinetics, cleavage complex formation and separate DNA binding domains regulate RAG cleavage, when it acts as a structure-specific nuclease. Thus, this study may help in the better understanding of RAG induced genomic instabilities in lymphoid tissues.

Indiana University-Purdue University Indianapolis (IUPUI) / DNA double strand breaks (DSB) are among the most lethal forms of DNA damage and can occur as a result of ionizing radiation (IR), radiomimetic agents, endogenous DNA-damaging agents, etc. If left unrepaired DSB’s can cause cell death, chromosome translocation and carcinogenesis. In humans, DSB are repaired predominantly by the non-homologous end joining (NHEJ) pathway. Ku, a heterodimer consisting of Ku70 and Ku80, functions in the recognition step of this pathway through binding DNA termini. Ku recruits the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to create the full DNA-PK heterotrimer. Formation of DNA-PK results in autophosphorylation as well as phosphorylation of downstream proteins of the NHEJ pathway. Previous work shows that the extreme C-terminus of Ku80 stimulates the kinase activity of DNA-PKcs, and Ku DNA binding is regulated as a function of redox via stimulation of a conformational change when oxidized resulting in a decrease in DNA binding activity. To further understand these methods of regulation of Ku and DNA-PK, a pair of mutants has been constructed; one consisting of full length Ku70 and truncated Ku80 (Ku70/80ΔC) lacking 182 C-terminal amino acids. The removal of these amino acids was shown to have little to no effect on the proteins expression, stability or DNA binding, as determined by SDS-PAGE, western blot analysis and electrophoretic mobility shift assay (EMSA). When oxidized Ku70/80ΔC showed a decrease in DNA binding similar to that seen in wild type, however when re-reduced the mutant did not recover to the same extent as wild type. A second mutant was constructed, containing amino acids 590-732 of Ku80 (Ku80CTR), to further understand the mechanism by which Ku80 C-terminus interacts with the rest of the Ku heterodimer. Possible protein-protein interactions were evaluated by Ni-NTA affinity, gel filtration chromatography, fluorescence polarization and two forms of protein-protein cross-linking. Ni-NTA agarose affinity, and gel filtration chromatography failed to reveal an interaction in the presence or absence of DNA. However, photo-induced cross-linking of unmodified proteins (PICUP) as well as EDC cross-linking demonstrated an interaction which was not affected by DNA. The work presented here demonstrates that the interaction between Ku80CTR and Ku is rather weak, but it does exist and plays a relatively large role in the NHEJ pathway.

RNA polymerase II (Pol II) is the enzyme responsible for the synthesis of all mRNAs in eukaryotic cells. As the central component of the eukaryotic transcription machinery, Pol II is the final target of regulatory pathways. While the role for different Pol II associated proteins, co-activators and general transcription factors (GTFs) in regulation of transcription in response to different stimuli is well studied, a similar role for some subunits of the core Pol II is only now being recognized. The studies reported in this thesis address the role of the fourth largest subunit of Pol II, Rpb4, in transcription and stress response using Saccharomyces cerevisiae as the model system. Rpb4 is closely associated with another smaller subunit, Rpb7 and forms a dissociable complex (Edwards et al., 1991). The rpb4 null mutant is viable but is unable to survive at extreme temperatures (>34ºC and <12ºC) (Woychik and Young, 1989). This mutant has also been shown to be defective in activated transcription and unable to respond properly in several stress conditions (Pillai et al., 2001; Sampath and Sadhale, 2005). In spite of wealth of available information, the exact role of Rpb4 remains poorly understood. In the present work, we have used genetic, molecular and biochemical approaches to understand the role of Rpb4 as described in four different parts below: i) Studies on Genetic and Functional Interactions of Rpb4 with SAGA/TFIID Complex to Confer Promoter- Specific Transcriptional Control To carry out transcription, Pol II has to depend on several general transcription factors, mediators, activators, and co-activators and chromatin remodeling complexes. In the present study, we tried to understand the genetic and functional relationship of Rpb4 with some of the components of transcription machinery, which will provide some insight into the role of Rpb4 during transcription. Our microarray analysis of rpb4∆ strain suggests that down regulated genes show significant overlap with genes regulated by the SAGA complex, a complex functionally related to TFIID and involved in regulation of the stress dependent genes. The analysis of combination of double deletion mutants of either the SAGA complex subunits or the TFIID complex with rpb4∆ showed that both these double mutants are extremely slow growing and show synthetic growth phenotype. Further studies, including microarray analysis of these double mutants and ChIP (chromatin immunoprecipitation) of Rpb4 and SAGA complex, suggested that Rpb4 functions together with SAGA complex to regulate the expression of stress dependent genes. ii) Study of Genome Wide Recruitment of Rpb4 and Evidence for its Role in Transcription Elongation Biochemical studies have shown that Rpb4 associates sub-stoichiometrically with the core RNA polymerase during log phase but whether recruitment of Rpb4 is promoter context dependent or occurs only at specific stage of transcription remains largely unknown. Having discovered that Rpb4 can recruit on both TFIID and SAGA dominated promoters, it was important to study the genome wide role of Rpb4. Using ChIP on chip experiments, we have carried out a systematic assessment of genome wide binding of Rpb4 as compared to the core Pol II subunit, Rpb3. Our analysis showed that Rpb4 is recruited on coding regions of most transcriptionally active genes similar to the core Pol II subunit Rpb3 albeit to a lesser extent. This extent of Rpb4 recruitment increased on the coding regions of long genes pointing towards a role of Rpb4 in transcription elongation of long genes. Further studies showing transcription defect of long and GC rich genes, 6-azauracil sensitivity and defective PUR5 gene expression in rpb4∆ mutant supported the in vivo evidence of the role of Rpb4 in transcription elongation. iii) Genome Wide Expression Profiling and RNA Polymerase II Recruitment in rpb4∆ Mutant in Non-Stress and Stress Conditions Structural studies have suggested a role of Rpb4/Rpb7 sub-complex in recruitment of different factors involved in transcription (Armache et al., 2003; Bushnell and Kornberg, 2003). Though only few studies have supported this aspect of Rpb4/Rpb7 sub-complex, more research needs to be directed to explore this role of Rpb4/Rpb7 sub-complex. To study if Rpb4 has any role in recruitment of Pol II under different growth conditions, we have studied genome wide recruitment of Pol II in the presence and absence of Rpb4 during growth in normal rich medium as well as under stress conditions like heat shock and stationary phase where Rpb4 is shown to be indispensable for survival. Our analysis showed that absence of Rpb4 results in overall reduced recruitment of Pol II in moderate condition but this reduction was more pronounced during heat shock condition. During stationary phase where overall recruitment of Pol II also goes down in wild type cells, absence of Rpb4 did not lead to further decrease in overall recruitment. Interestingly, increased expression levels of many genes in the absence of Rpb4 did not show concomitant increase in the recruitment of Pol II, suggesting that Rpb4 might regulate these genes at a post-transcriptional step. iv) Role of Rpb4 in Pseudohyphal Growth The budding yeast S. cerevisiae can initiate distinct developmental programs depending on the presence of various nutrients. In response to nitrogen starvation, diploid yeast undergoes a dimorphic transition to filamentous pseudohyphal growth, which is regulated through cAMP-PKA and MAP kinase pathways. Previous work from our group has shown that rpb4∆ strain shows predisposed pseudohyphal morphology (Pillai et al., 2003), but how Rpb4 regulates this differentiation program is yet to be established. In the present study, we found that disruption of Rpb4 leads to enhanced pseudohyphal growth, which is independent of nutritional status. We observed that the rpb4∆/ rpb4∆ cells exhibit pseudohyphae even in the absence of a functional MAP kinase and cAMP-PKA pathways. Genome wide expression profile showed that several downstream genes of RAM signaling pathway were down regulated in rpb4∆ cells. Our detailed genetic analysis further supported the hypothesis that down regulation of RAM pathway might be leading to the pseudohyphal morphogenesis in rpb4∆ cells.

Saccharomyces cerevisiae HOP1, which encodes a component of the synaptonemal complex, plays an important role in both gene conversion and crossing over between homologs, as well as enforces the meiotic recombination checkpoint control over the progression of recombination intermediates. The zinc-finger motif (Znf) 348CX2CX19CX2C374) of Hop1 is crucial for its function in meiosis, since mutation of conserved Cys371 to Ser in this motif results in a temperature-sensitive phenotype, which is defective in sporulation and meiosis. The direct role for Hop1 or its ZnF in the formation of joint molecules and checkpoint control over the progression of meiotic recombination intermediates is unknown. To understand the underlying biochemical mechanism, we constructed a series of recombination intermediates. Hop1 or its ZnF were able to bind different recombination intermediates. Interestingly, the binding affinity of Hop1 and its ZnF was much higher for the Holliday junction as compared to other recombination intermediates. The complexes of Hop1 or its ZnF with the Holliday junction were stable and specific as shown by NaCl titration and competition experiment. Hop1 and its ZnF blocked BLM helicase-induced unwinding of the Holliday junction, indicating that the interaction between Hop1 and its ZnF with the Holliday junction is specific. DNase I footprinting experiment showed that Hop1 or its ZnF bind to the center of the Holliday junction. 2-aminopurine fluorescence and KMnO4 experiments showed that Hop1 or its ZnF can distort the Holliday junction in a 2-fold symmetrical manner. The molecular modeling study showed that Hop1 ZnF folded into unique helix-loop-helix motif and bound to center of the Holliday junction. In summary, this study shows that Hop1 protein or its ZnF interact specifically with the Holliday junction and distort its structure. Taken together, these results implicate that Hop1 protein might coordinate the physical monitoring of meiotic recombination intermediates during the process of branch migration and that Hop1 ZnF acts as a structural determinant of Hop1 protein functions.

The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)