No description available.

No description available.

The goal of this research was to design, prepare and study a new class of supermolecules coupling ruthenium and platinum, which would display covalent binding to DNA. Drawing upon the well-established efficacy of cis-diamminedichloroplatinum(II) (cisplatin) and the DNA-binding properties of select ruthenium polyazine complexes, the approach was to bind the cis-PtIICl2 active site of cisplatin to ruthenium light absorbers using the dpq and dpb bridging ligands (where dpq = 2,3-bis(2-pyridyl)quinoxaline, dpb = 2,3-bis(2-pyridyl) benzoquinoxaline). These complexes are potentially bifunctional, capable of DNA intercalation through the bridging ligand and covalent binding to DNA through the cis-PtCl2 site. Synthetic methods were developed to prepare the mixed-metal, bimetallic complexes [(bpy)2Ru(BL)PtCl2](CF3SO3)2 and [(phen)2Ru(BL)PtCl2](CF3SO3)2 (where bpy = 2,2¢-bipyridine, phen = 1,10-phenanthroline) in high purity and good overall yields. The DNA-binding ability of these complexes was probed by reaction with linearized plasmid DNA and subsequent analysis by native and denaturing gel electrophoresis. The known DNA binders, cisplatin and trans-{[PtCl(NH3)2]2(m-H2N(CH2)6NH2)}(NO3)2 (1,1/t,t), were examined under equivalent conditions and used as positive controls. Native gel electrophoresis was used to show that these complexes strongly bind DNA, retarding the migration of DNA through the gel in a fashion inversely proportional to the ratio of DNA base pairs (bp) to metal complex (mc). Analysis by denaturing gel electrophoresis determined that the Ru-Pt complexes bind to DNA in a fashion similar to cisplatin, forming primarily intrastrand adducts. However, these systems also appear to form interstrand adducts at a 10-fold lower metal concentration than cisplatin. In addition to affecting the migration rate, the bimetallic complexes also significantly reduced the fluorescence of DNA-intercalated ethidium bromide for the Ru-Pt reacted samples at low-DNA bp: mc ratios. This was not observed for the cisplatin and 1,1/t,t treated samples. This observation was quantitated by gel densitometry. Precipitation of the DNA by cisplatin, 1,1/t,t and all four Ru-Pt complexes was determined not to be the cause of reduced ethidium bromide fluorescence intensity. Homogenous solution fluorescence quenching studies have revealed that the Ru-Pt complexes quench the emission of ethidium bromide even in the absence of DNA, whereas cisplatin and 1,1/t,t do not. In order to compare the effects on DNA migration produced by cisplatin, 1,1/t,t and the Ru-Pt complexes, Rf values were calculated. This analysis has revealed that all four Ru-Pt complexes retard DNA migration to approximately the same degree. Calculation of theoretical DNA migration distances, based upon the molecular weight change of DNA caused by metal-complex binding, have revealed that the observed affect on DNA migration cannot be accounted for by an increase in molecular weight alone. This indicates that changes in charge and three-dimensional shape of the DNA upon binding of the Ru-Pt complexes may also contribute. / Ph. D.

Juvenile hormone (JH) is one of the principal hormones that regulate insect development and reproduction. Accumulating evidence suggests that Methoprene-tolerant (Met) protein is a nuclear receptor of JH. Work by others has shown that Met is capable of binding JH at physiological concentration. An RNAi knockdown of Met causes down-regulated expression of JH-responsive genes and a phenotype similar to that observed in JH-deficient insects, suggesting that Met is required for mediating physiological and molecular responses to JH. The work in this report aims to understand the mechanisms underlying gene regulation by JH via Met. Met is a bHLH-PAS (basic-helix-loop-helix Per-ARNT-Sim) family protein. Many proteins in this family function as heterodimers formed with other proteins of this family. In a yeast two-hybrid screening, we discovered that another bHLH-PAS family protein, FISC, interacts with Met in the presence of JH. FISC is also required for JH functions as an RNAi knockdown of FISC down-regulated JH-responsive genes. To elucidate how Met and FISC mediate JH functions in gene regulation, we employed molecular biology techniques and characterized the formation of a JH-Met-FISC complex and its actions in activating gene expression using mosquito Aedes aegypti as a model. My results demonstrated that Met and FISC forms a complex when JH is present via their conserved N-terminal domains. The complex then binds to E box-like sequences presented in the promoter of JH-responsive genes to activate gene expression. This mechanism also applies to the fruit fly Drosophila melanogaster, suggesting that it is a conserved action of JH in insects. Further studies showed that DNA-binding by Met and FISC requires the basic regions of the bHLH domains of both proteins. Lastly we identified a consensus binding-site of Met and FISC. / Ph. D.

Yes / Herein, we report 31 new β-diketonate titanium compounds of the type [Ti(O,O)2X2], whereby O,O = asymmetric or symmetric β-diketonate ligand and X = Cl, Br, OEt or OiPr. Thirteen new crystal structures are discussed and show that these octahedral species all adopt cis geometries in the solid state. These compounds have been tested for their cytotoxicity using SRB and MTT assays, showing several of the compounds are as potent as cisplatin against a range of tumour cell lines. Results also show the [Ti(O,O)2Br2] complexes are more potent than [Ti(O,O)2Cl2], [Ti(O,O)2(OEt)2] and [Ti(O,O)2(OiPr)2]. Using a simple symmetrical heptane-3,5-dione (O,O) ligand bound to titanium, we observed more than a 50-fold increase in potency with the [Ti(O,O)2Br2] (28) when compared to [Ti(O,O)2Cl2] (27). One of the more potent compounds (6) has been added to three different sixmers of DNA, in order to analyse the potential DNA binding of the compound. NMR studies have been carried out on the compounds, in order to understand the structural properties and the species formed in solution during the in vitro cell assays.

Wong, Ka Chun. / Thesis (M.Phil.)--Chinese University of Hong Kong, 2010. / Includes bibliographical references (leaves 109-121). / Abstracts in English and Chinese. / Abstract --- p.ii / Acknowledgements --- p.iv / List of Figures --- p.ix / List of Tables --- p.xi / Chapter 1 --- Introduction --- p.1 / Chapter 1.1 --- Motivation --- p.1 / Chapter 1.2 --- Objective --- p.2 / Chapter 1.3 --- Methodology --- p.2 / Chapter 1.4 --- Bioinforrnatics --- p.2 / Chapter 1.5 --- Computational Methods --- p.3 / Chapter 1.5.1 --- Evolutionary Algorithms --- p.3 / Chapter 1.5.2 --- Data Mining for TF-TFBS bindings --- p.4 / Chapter 2 --- Background --- p.5 / Chapter 2.1 --- Gene Transcription --- p.5 / Chapter 2.1.1 --- Protein-DNA Binding --- p.6 / Chapter 2.1.2 --- Existing Methods --- p.6 / Chapter 2.1.3 --- Related Databases --- p.8 / Chapter 2.1.3.1 --- TRANSFAC - Experimentally Determined Database --- p.8 / Chapter 2.1.3.2 --- cisRED - Computational Determined Database --- p.9 / Chapter 2.1.3.3 --- ORegAnno - Community Driven Database --- p.10 / Chapter 2.2 --- Evolutionary Algorithms --- p.13 / Chapter 2.2.1 --- Representation --- p.15 / Chapter 2.2.2 --- Parent Selection --- p.16 / Chapter 2.2.3 --- Crossover Operators --- p.17 / Chapter 2.2.4 --- Mutation Operators --- p.18 / Chapter 2.2.5 --- Survival Selection --- p.19 / Chapter 2.2.6 --- Termination Condition --- p.19 / Chapter 2.2.7 --- Discussion --- p.19 / Chapter 2.2.8 --- Examples --- p.19 / Chapter 2.2.8.1 --- Genetic Algorithm --- p.20 / Chapter 2.2.8.2 --- Genetic Programming --- p.21 / Chapter 2.2.8.3 --- Differential Evolution --- p.21 / Chapter 2.2.8.4 --- Evolution Strategy --- p.22 / Chapter 2.2.8.5 --- Swarm Intelligence --- p.23 / Chapter 2.3 --- Association Rule Mining --- p.24 / Chapter 2.3.1 --- Objective --- p.24 / Chapter 2.3.2 --- Apriori Algorithm --- p.24 / Chapter 2.3.3 --- Partition Algorithm --- p.25 / Chapter 2.3.4 --- DHP --- p.25 / Chapter 2.3.5 --- Sampling --- p.25 / Chapter 2.3.6 --- Frequent Pattern Tree --- p.26 / Chapter 3 --- Discovering Protein-DNA Binding Sequence Patterns Using Associa- tion Rule Mining --- p.27 / Chapter 3.1 --- Materials and Methods --- p.28 / Chapter 3.1.1 --- Association Rule Mining and Apriori Algorithm --- p.29 / Chapter 3.1.2 --- Discovering associated TF-TFBS sequence patterns --- p.29 / Chapter 3.1.3 --- "Data, Preparation" --- p.31 / Chapter 3.2 --- Results and Analysis --- p.34 / Chapter 3.2.1 --- Rules Discovered --- p.34 / Chapter 3.2.2 --- Quantitative Analysis --- p.36 / Chapter 3.2.3 --- Annotation Analysis --- p.37 / Chapter 3.2.4 --- Empirical Analysis --- p.37 / Chapter 3.2.5 --- Experimental Analysis --- p.38 / Chapter 3.3 --- Verifications --- p.41 / Chapter 3.3.1 --- Verification by PDB --- p.41 / Chapter 3.3.2 --- Verification by Homology Modeling --- p.45 / Chapter 3.3.3 --- Verification by Random Analysis --- p.45 / Chapter 3.4 --- Discussion --- p.49 / Chapter 4 --- Designing Evolutionary Algorithms for Multimodal Optimization --- p.50 / Chapter 4.1 --- Introduction --- p.50 / Chapter 4.2 --- Problem Definition --- p.51 / Chapter 4.2.1 --- Minimization --- p.51 / Chapter 4.2.2 --- Maximization --- p.51 / Chapter 4.3 --- An Evolutionary Algorithm with Species-specific Explosion for Multi- modal Optimization --- p.52 / Chapter 4.3.1 --- Background --- p.52 / Chapter 4.3.1.1 --- Species Conserving Genetic Algorithm --- p.52 / Chapter 4.3.2 --- Evolutionary Algorithm with Species-specific Explosion --- p.53 / Chapter 4.3.2.1 --- Species Identification --- p.53 / Chapter 4.3.2.2 --- Species Seed Delta Evaluation --- p.55 / Chapter 4.3.2.3 --- Stage Switching Condition --- p.56 / Chapter 4.3.2.4 --- Species-specific Explosion --- p.57 / Chapter 4.3.2.5 --- Calculate Explosion Weights --- p.59 / Chapter 4.3.3 --- Experiments --- p.59 / Chapter 4.3.3.1 --- Performance measurement --- p.60 / Chapter 4.3.3.2 --- Parameter settings --- p.61 / Chapter 4.3.3.3 --- Results --- p.61 / Chapter 4.3.4 --- Conclusion --- p.62 / Chapter 4.4 --- A. Crowding Genetic. Algorithm with Spatial Locality for Multimodal Op- timization --- p.64 / Chapter 4.4.1 --- Background --- p.64 / Chapter 4.4.1.1 --- Crowding Genetic Algorithm --- p.64 / Chapter 4.4.1.2 --- Locality of Reference --- p.64 / Chapter 4.4.2 --- Crowding Genetic Algorithm with Spatial Locality --- p.65 / Chapter 4.4.2.1 --- Motivation --- p.65 / Chapter 4.4.2.2 --- Offspring generation with spatial locality --- p.65 / Chapter 4.4.3 --- Experiments --- p.67 / Chapter 4.4.3.1 --- Performance measurements --- p.67 / Chapter 4.4.3.2 --- Parameter setting --- p.68 / Chapter 4.4.3.3 --- Results --- p.68 / Chapter 4.4.4 --- Conclusion --- p.68 / Chapter 5 --- Generalizing Protein-DNA Binding Sequence Representations and Learn- ing using an Evolutionary Algorithm for Multimodal Optimization --- p.70 / Chapter 5.1 --- Introduction and Background --- p.70 / Chapter 5.2 --- Problem Definition --- p.72 / Chapter 5.3 --- Crowding Genetic Algorithm with Spatial Locality --- p.72 / Chapter 5.3.1 --- Representation --- p.72 / Chapter 5.3.2 --- Crossover Operators --- p.73 / Chapter 5.3.3 --- Mutation Operators --- p.73 / Chapter 5.3.4 --- Fitness Function --- p.74 / Chapter 5.3.5 --- Distance Metric --- p.76 / Chapter 5.4 --- Experiments --- p.77 / Chapter 5.4.1 --- Parameter Setting --- p.77 / Chapter 5.4.2 --- Search Space Estimation --- p.78 / Chapter 5.4.3 --- Experimental Procedure --- p.78 / Chapter 5.4.4 --- Results and Analysis --- p.79 / Chapter 5.4.4.1 --- Generalization Analysis --- p.79 / Chapter 5.4.4.2 --- Verification By PDB --- p.86 / Chapter 5.5 --- Conclusion --- p.87 / Chapter 6 --- Predicting Protein Structures on a Lattice Model using an Evolution- ary Algorithm for Multimodal Optimization --- p.88 / Chapter 6.1 --- Introduction --- p.88 / Chapter 6.2 --- Problem Definition --- p.89 / Chapter 6.3 --- Representation --- p.90 / Chapter 6.4 --- Related Works --- p.91 / Chapter 6.5 --- Crowding Genetic Algorithm with Spatial Locality --- p.92 / Chapter 6.5.1 --- Motivation --- p.92 / Chapter 6.5.2 --- Customization --- p.92 / Chapter 6.5.2.1 --- Distance metrics --- p.92 / Chapter 6.5.2.2 --- Handling infeasible conformations --- p.93 / Chapter 6.6 --- Experiments --- p.94 / Chapter 6.6.1 --- Performance Metrics --- p.94 / Chapter 6.6.2 --- Parameter Settings --- p.94 / Chapter 6.6.3 --- Results --- p.94 / Chapter 6.7 --- Conclusion --- p.95 / Chapter 7 --- Conclusion and Future Work --- p.97 / Chapter 7.1 --- Thesis Contribution --- p.97 / Chapter 7.2 --- Fixture Work --- p.98 / Chapter A --- Appendix --- p.99 / Chapter A.1 --- Problem Definition in Chapter 3 --- p.107 / Bibliography --- p.109 / Author's Publications --- p.122

The DNA binding proteins under starvation (Dps) from M. smegmatis are cage-like structures which internalize iron and bind DNA. They provide resistance to the cells from free radical damage, and physically protect the DNA from the harmful effects of reactive oxygen species by DNA compaction. The work compiled in this thesis has been an effort to study oligomerization and dynamics of iron metabolism by these nano-protein compartments. Chapter 1 gives a general introduction on stress, especially oxidative stress, and the ways bacteria fight back the host resistance systems. This has been elaborated from the point of view of the Dps proteins which is the focus of our work. Also, the competition for iron among the host and pathogens, and the modes of iron trafficking of the pathogens from host organisms has been summarized. Finally, the structural aspects of ferritin family proteins to which Dps belongs, has been discussed. Chapter 2 elaborates on the oligomerization pathways of the first M. smegmatis Dps MsDps1, which exists in vitro as two oligomeric forms. The GFP-tagging has been used to locate the Dps1 proteins by live cell imaging and the over-expression of these proteins during nutrient limiting conditions has been studied. The crystal structure of a point mutant F47E in the background of MsDps1, which shows no dodecamerization in vitro, has been solved. The possible ways of dodecamerization of MsDps1 has been concluded by analyzing the intermediates via glutaraldehyde cross-linking and native electrospray mass spectrometry. Chapter 3 documents the gating machinery of iron in MsDps2 protein, the second M. smegmatis Dps protein. Through graph theoretical approaches, a tight histidine-aspartate cluster was identified at the ferritin-like trimeric pore which harbors the channel for the entry and exit of iron. Sitespecific variants of MsDps2 were generated to disrupt this ionic knot, and the mutants were further assayed for ferroxidation, iron uptake and iron release properties. Our studies in MsDps2 show the importance of counter-acting positive and negatively charged residues for efficient assimilation and dispersion of iron. Chapter 4 describes crystallization studies of MsDps2 pore variants, done in an attempt to connect the changes in functional properties described in chapter 3, with structural alterations of the point mutants. We show here that the gating mechanism happens by alterations in side chain configuration at the pore and does not alter the over-all stability of the proteins. Chapter 5 is the final section where we have employed site specific mutations and cocrystallization studies to elucidate the behaviour of MsDps2 proteins upon the addition of iron. By studying the effect of substitutions at conserved sites near ferroxidation center, we attempt to arrive at a pathway which iron atoms take to reach the ferroxidation site. Also, by crystallization of proteins loaded with varying amounts of iron we tried to map the changes in the protein structure in the presence of its ligand. Chapter 6 concludes briefly the work that has been documented in this thesis. Appendix I relates the role of N-terminal tail for DNA binding in MsDp2. Appendix II gives the technical details of a modified protein preparation and oligomerization process for his-tagged MsDps1 protein. Appendix III gives the maps of the plasmids used in this study.

Le laboratoire a récemment identifié la protéine Damaged-DNA-Binding 2 (DDB2), connue à l’origine pour son rôle dans la réparation de l’ADN comme une protéine impliquée dans la tumorigenèse mammaire. En effet, nous avons montré son rôle dans la croissance et la progression des tumeurs mammaires via la régulation transcriptionnelle de gènes cibles. Dans ce travail, nous avons montré que la surexpression de DDB2 augmente la sensibilité des cellules tumorales MDA-MB231 et SKBr3 traitées à la doxorubicine et au 5-fluorouracile (5-FU). Inversement, l’inhibition de l’expression de DDB2 dans les cellules T47D qui l’expriment naturellement s’accompagne d’une baisse de la sensibilité à ces agents anticancéreux. Nos résultats montrent que la sensibilité des cellules au 5-FU mais pas à la doxorubicine, lorsque DDB2 est surexprimée, dépend en partie du contrôle négatif qu’exerce cette dernière sur l’activité de NF-κB, en régulant positivement l’expression d’IκBα. Enfin, la recherche d’autres gènes cibles de DDB2, impliqués dans l’apoptose, nous a conduits à celui codant le facteur anti-apoptotique Bcl-2. DDB2 agit négativement sur l’expression de Bcl-2 en interagissant avec une région de l’ADN localisée dans le promoteur P2 du gène correspondant. De part, son rôle anti-apoptotique, la régulation de son expression pourrait bien être à l’origine de la sensibilité aux agents anticancéreux induite par DDB2. L’ensemble de ces résultats met donc en évidence l’intérêt clinique de DDB2 comme marqueur prédictif de la réponse aux agents anticancéreux, et devrait contribuer à une meilleure compréhension des mécanismes impliqués dans l’échappement des cellules tumorales aux thérapies / The laboratory has recently identified the Damaged-DNA Binding 2 protein (DDB2), a protein involved in DNA repair, as an important actor in breast tumorigenesis. Our laboratory has shown that DDB2 is involved in breast tumor growth and progression through the transcriptional regulation of target genes. Thus, the first aim of this work was to study the role of DDB2 and its target genes in the response of breast cancer cells to anticancer drugs. We showed that DDB2 overexpressed in breast cancer cell lines, such as MDA-MB231 and SKBr3, increased the cells sensitivity to apoptosis induced by doxorubicin and 5-Fluorouracil (5-FU). Conversely, the inhibition of DDB2 expression in T47D cells, which express endogenously this protein, decreased cell sensitivity to anticancer agents. Our results showed that cell sensitivity induced by DDB2 expression to 5-FU but not doxorubicin depended on its ability to repress NF-κB activity via the regulation of IκBα expression. At last, the search of potential DDB2 target genes implicated in apoptosis has led us to identify the anti-apoptotic factor Bcl-2. We showed the ability of DDB2 to downregulate Bcl-2 expression via its interaction with DNA region located in P2 promoter of the corresponding gene. Results suggest that Bcl-2 dowregulation by DDB2 could be a major event that explains the enhanced sensitivity of cancer cells to therapeutic agents. Altogether, these data highlight the clinical interest of DDB2, as a predictive marker of the response to anticancer agents. A better understanding of its mode of action will contribute to improve therapeutic treatments and avoid their failure in resistant patients

The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)

Oxidative stress is a universal phenomenon experienced by both aerobic and anaerobic organisms. Reactive oxygen species (ROS) are generated during the stress, which can damage most cellular components including proteins, lipids and DNA. Naturally, organisms have evolved defence mechanisms to prevent oxidative damage. In prokaryotic systems, Dps (DNA binding protein from stationary phase cells) forms an important component of the mechanisms. Dps is known to be produced maximally during the stationary phase of bacterial growth. They exhibit ferroxidase activity as well. Dps homologs have been identified in a variety of distantly related bacteria, thus implying that this protein has a crucial function. The crystal structures of these proteins from a few bacteria are available. The work reported here is concerned with structural studies on Dps molecules from Mycobacterium smegmatis. Well-established X-ray crystallographic techniques were used to study the structures reported here. Hanging drop vapour diffusion and microbatch methods were used for crystallization. X-ray intensity data were collected on MAR Research imaging plates mounted on Rigaku X-ray generators. The data were processed using the HKL program suite. All the structures were solved by the molecular replacement method using the programs AMoRe and PHASER. Structure refinements were carried out using the programs CNS and REFMAC. Model building was carried out using FRODO and COOT. PROCHECK, ALIGN, INSIGHT, NACCESS, HBPLUS, CONTACT and ESCET were used for validation and analysis of the refined structures. Figures were prepared using MOLSCRIPT, BOBSCRIPT, RASTER3D and PYMOL. The structure of the first Dps identified in M. smegmatis has been determined in three crystal forms and has been compared with those of similar proteins from other sources. The dodecameric molecule can be described as a distorted icosahedron. The interfaces among subunits are such that the dodecameric molecule appears to have been made up of stable trimers. The situation is similar in the proteins from Escherichia coli and Agrobacterium tumefaciens, which are closer to the M. smegmatis protein in sequence and structure than those from other sources, which appear to form a dimer first. Trimerisation is aided in the three proteins by the additional N-terminal stretches they possess. The M. smegmatis protein has an additional C-terminal stretch compared to other related proteins. The stretch, known to be involved in DNA binding, is situated on the surface of the molecule. A comparison of the available structures permits a delineation of the rigid and flexible regions in the molecule. The subunit interfaces around the molecular dyads, where the ferroxidation centres are located, are relatively rigid. Regions in the vicinity of the acidic holes centred around molecular threefold axes, are relatively flexible. So are the DNA binding regions. The crystal structures of the protein from M. smegmatis confirm that DNA molecules can occupy spaces within the crystal without disturbing the arrangement of the protein molecules. However, contrary to earlier suggestions, the spaces need not to be between layers of the protein molecules. The cubic form provides an arrangement in which grooves, which could hold DNA molecules, criss-cross the crystal. M. smegmatis Dps is characterised by a 26 residue C-terminal tail which has been shown to be involved in DNA binding. The protein spontaneously degrades into a species in which 16 C-terminal residues are cleaved away. This species does not bind DNA, but forms dodecamers. A second species in which all the 26 residues constituting the tail were deleted not only does not bind to DNA, but also fails to assemble into dodecamers, indicating a role in assembly also for the C terminal tail. Therefore, the crystal structure of the species without the entire C-terminal tail was carried out. The molecule of the C-terminal mutant has an unusual open decameric structure, resulting from the removal of two adjacent subunits from the original dodecameric structure of the native form. It has been earlier shown that a Dps dodecamer could assemble with a dimer or one of two trimers (Trimer-A and Trimer-B) as intermediate and that Trimer-A is the intermediate species in the M. smegmatis protein. Estimation of surface area buried on trimerisation indicates that association within Trimer-B is weak. It further weakens when the C-terminal tail is removed, leading to the disruption of the dodecameric structure. Thus, the C-terminal tail has a dual role, one in DNA binding and the other in the assembly of the dodecamer. M. smegmatis Dps also has a short N-terminal tail of 9 residues. A species with this tail deleted, forms trimers in solution, but not dodecamers unlike wild type M. smegmatis Dps, under the same conditions. The crystal structure of this N-terminal mutant was also determined. Unlike in solution, the N-terminal mutant forms dodecamers in the crystal. In native Dps, the N-terminal stretch of one subunit and the C-terminal stretch of a neighbouring subunit lock each other into ordered positions. The deletion of one stretch results in the disorder of the other. This disorder appears to result in the formation of a trimeric species of the N-terminal deletion mutant contrary to the indication provided by the native structure. The ferroxidation site is intact in the mutants. A second DNA binding protein from stationary phase cells of M. smegmatis (MsDps2) has been identified from the bacterial genome and its crystal structure determined. The core dodecameric structure of MsDps2 is the same as that of the Dps from the organism described earlier (MsDps1). However, MsDps2 possesses a long N-terminal tail instead of the C-terminal tail in MsDps1. This tail appears to be involved in DNA binding. It is also intimately involved in stabilizing the dodecamer. Partly on account of this factor, MsDps2 assembles straightway into the dodecamer while MsDps1 does so on incubation after going through an intermediate trimeric stage. The ferroxidation centre is similar in the two proteins while the pores leading to it exhibit some difference. The mode of sequestration of DNA in the crystalline array of molecules, as evidenced by the crystal structures, appears to be different in MsDps1 and MsDps2, highlighting the variability in the mode of Dps-DNA complexation. A sequence search led to the identification of 300 Dps molecules in bacteria with known genome sequences. 50 bacteria contain 2 or more types of Dps molecules each, while 195 contain only one type. Some bacteria, notably some pathogenic ones, do not contain Dps. A sequence signature for Dps could also be derived from the analysis In addition to the work on Dps molecules, the author was also involved in studies on the crystal structures of the adipic acid complexes of L- and DL-arginine and supramolecular association in arginine-dicarboxylic acid complexes. This investigation, carried out primarily to obtain a good grounding in crystallography, is presented in an appendix.