Spelling suggestions: "subject:"buclear cagnetic resonance spectroscopy"" "subject:"buclear cagnetic esonance spectroscopy""
241 |
The application of magnetic resonance and computed tomography imaging in the diagnosis and management of maxillofacial tumours.Janse van Rensburg, Leon January 2004 (has links)
<p>The Application of Magnetic Resonance (MRI) and Computed Tomography Imaging (CT) in the Diagnosis and Management of Maxillofacial Tumours. For decades maxillofacial surgeons over the world have been frustrated by the high and often fatal recurrence of certain advanced jaw tumours. This study conclusively proves that Computed Tomography and especially Magnetic Resonance Imaging significantly decreases recurrence of Odontogenic Keratocyst and Ameloblastoma and allows surgical planning to avoid these recurrences.</p>
|
242 |
Expression and purification of the novel protein domain DWNN.Lutya, Portia Thandokazi January 2002 (has links)
Proteins play an important role in cells, as the morphology, function and activities of the cell depend on the proteins they express. The key to understanding how different proteins function lies in an understanding of the molecular structure. The overall aim of this thesis was the determination of the structure of DWNN domains. This thesis described the preparation of samples of human DWNN suitable for structural analysis by nuclear magnetic resonance spectroscopy (NMR), as well as NMR analysis.
|
243 |
Molecular modelling and NMR studies of multinuclear platinum anticancer complexesThomas, Donald S January 2006 (has links)
[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,¹5N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.
|
244 |
Characterization and ¹H-NMR Applications of hexaaza macrocyclic complexes of lanthanides /DiSano, Mary. January 1989 (has links)
Thesis (M.S.)--Rochester Institute of Technology, 1989. / Includes bibliographical references (leaves 62-64).
|
245 |
The molecular dynamics and reactivity of transition metal and main group [íta]1-indenyl complexes /Stradiotto, Mark J. January 1999 (has links)
Thesis (Ph.D.) -- McMaster University, 1999. / [Íta] in title is a Greek letter. Includes bibliographical references (leaves 180-191). Also available via World Wide Web.
|
246 |
Syntheses and investigations of bi- and trimetallic organotransition metal clusters.D'Agostino, Michael Francis. McGlinchey, M. J. Unknown Date (has links)
Thesis (Ph. D.)--McMaster University (Canada), 1990. / Source: Dissertation Abstracts International, Volume: 52-10, Section: B, page: 5229. Supervisor: M.J. McGlinchey.
|
247 |
Magnetic resonance studies of organometallic cations and clusters.Li, Lijuan. McGlinchey, M.J. Eaton, D.R. Unknown Date (has links)
Thesis (Ph.D.)--McMaster University (Canada), 1992. / Source: Dissertation Abstracts International, Volume: 54-02, Section: B, page: 0826.
|
248 |
Determination of the structural features of A-band lipopolysaccharide from a rough mutant of Pseudomonas aeruginosa.Arsenault, Todd L. MacLean, D.B> Unknown Date (has links)
Thesis (Ph.D.)--McMaster University (Canada), 1992. / Source: Dissertation Abstracts International, Volume: 54-08, Section: B, page: 4124. Adviser: D. B. MacLean.
|
249 |
The synthesis, NMR, and conformational studies of purinophanes and approaches towards the synthesis of pyrimidinophanes.Capretta, Alfredo. Bell, Russell A. Unknown Date (has links)
Thesis (Ph.D.)--McMaster University (Canada), 1993. / Source: Dissertation Abstracts International, Volume: 54-12, Section: B, page: 6203. Adviser: Russell A. Bell.
|
250 |
Synthetic, structural and high-field NMR spectroscopic studies of arene-chromium complexes.Mailvaganam, Bavani. McGlinchey, M. J. Unknown Date (has links)
Thesis (Ph. D.)--McMaster University (Canada), 1990. / Source: Dissertation Abstracts International, Volume: 62-13, Section: A, page: 0000.
|
Page generated in 0.0808 seconds