Austropuccinia psidii (sin Puccinia psidii) é um fungo biotrófico que infecta diversos gêneros de mirtáceas. É uma ferrugem (Puccinialles) nativa da América do Sul que apresenta ampla distribuição e rápida dispersão geográfica, alcançando atualmente a Austrália, centro de diversidade das mirtáceas. Este patógeno tem alarmado a comunidade científica devido à vasta capacidade de dispersão e por causar perdas econômicas consideráveis em culturas de interesse comercial, com destaque na eucaliptocultura. Apesar de sua importância, estudos relacionados ao patossistema A. psidii - Eucalyptus ainda são incipientes, sendo que o entendimento das bases moleculares envolvidas na interação planta-patógeno é essencial para adoção de medidas de controle eficazes e duradouras. Atualmente, a busca por candidatos a efetores tem crescido consideravelmente, pois são moléculas capazes de alterar a fisiologia do hospedeiro, suprimindo ou ativando os mecanismos de defesa. Dessa forma, o objetivo do presente estudo foi identificar in silico genes candidatos a efetores e validá-los por meio de análise de expressão por RT-qPCR. Para predição dos genes candidatos a efetores foi utilizado o genoma parcial de A. psidii e uma pipeline específica, baseada em diversos parâmetros, tais como: presença do peptídeo sinal, ausência de domínio transmembrana e superfície de ancoragem e pequeno tamanho. Foram identificados 2.886 candidatos, dos quais 13% apresentaram similaridade com Puccinialles. As categorias mais importantes de localização subcelular preditas foram apoplasto (87,3%), cloroplasto (7%) e núcleo (4,1%). Oito candidatos foram selecionados para análise de expressão após mineração em dados de RNA-seq. Os ensaios foram realizados in vitro com uredósporos de duas populações distintas de A. psidii, uma proveniente de eucalipto (MF-1) e outra de S. jambos (GM-J1) e as amostras foram coletadas em 6, 12 e 24 horas após inoculação (h.a.i). O perfil de expressão dos candidatos variou entre os tempos investigados, sendo que dois candidatos mostraram altos valores de expressão em todos os tempos, ao passo que quatro foram mais expressos nos tempos iniciais (6 e 12 h.a.i). Os tempos iniciais correspondem às fases de germinação e pré-penetração, fortalecendo a predição desses quatro candidatos como apoplásticos. Foi observado um perfil diferencial de expressão entre as duas populações do patógeno, o que sugere uma provável modulação pelo hospedeiro de origem na expressão dos candidatos a efetores, fato ainda pouco abordado na literatura e que deve ser melhor investigado. Embora o trabalho tenha sido realizado in vitro, foi possível selecionar potenciais candidatos para continuidade dos estudos, incluindo a validação in planta e caracterização funcional. Os dados são relevantes em vista a escassez de informações biológicas desse patossistema e fornecem uma visão inicial de como esses efetores atuam na interação planta-patógeno. / Austropuccinia psidii (sin Puccinia psidii) is a biotrophic fungus that infects several genera of Myrtaceae. It is a rust (Puccinialles) native from South America that displays a broad distribution after have shown a quick geographic dispersion, being currently present even in Australia, which is Myrtaceae\'s diversity center. This pathogen has alarmed the scientific community due to its wide dispersion ability and because of considerable economic losses occurring in crops of commercial interest, especially eucalyptus cultures. Despite its importance, studies related to A. psidii-Eucalyptus pathosystem are still incipient and the understanding of the molecular basis involved in the plant-pathogen interaction is essential to develop effective and durable control mechanisms. Currently, the search for effector candidates has increased considerably since they are molecules that alter the host physiology, suppressing or activating the defense mechanisms. In this study, we aimed to identify in silico effectors candidate genes and also to validate them by expression analysis (RT-qPCR). To predict the effector candidate genes, we used the partial genome of A. psidii and a specific pipeline based on several parameters, such as small size, presence of signal peptide, absence of transmembrane domain and anchorage surface. A total of 2,886 candidates were identified, from which 13% are similar to Puccinialles. The most important categories of predicted subcellular localization were apoplast (87,3%), chloroplast (7%) e nucleus (4,1%). Eight candidates were selected for expression analysis after mining in RNA-seq data. The in vitro assays were carried out with uredospores from two distinct populations of A. psidii: one from eucalyptus (MF-1) and other from S. jambos (GM-J1); the samples were collected 6, 12 and 24 hours after inoculation (h.a.i). The expression profile of the candidates was distinct among the times investigated. The results showed that two candidates had high expression values in all times evaluated, while four were more expressed at 6 and 12 h.a.i. These times correspond to the germination and pre-penetration phases, corroborating with the prediction of these four candidates as apoplastics. A differential expression profile was found between the two pathogen populations, suggesting a probable modulation by the origin host in the expression of effectors candidates, what has not been extensively investigated and discussed in the literature on the topic. Although this study has been performed in vitro, it was possible to select potential candidates for further investigations, including in plant validation and functional characterization. The data presented here are relevant considering the scarcity of biological information about this pathosystem, besides providing an initial insight on how these effectors act in the plant-pathogen interaction.

O Brasil é o maior produtor de laranja do mundo, liderando também a produção e exportação de suco concentrado congelado. Um dos fatores que ameaçam o setor é o grande número de doenças, principalmente, as bacterianas como o Huanglongbing (HLB). O HLB é considerado uma das mais graves doenças dos citros, que compromete seu desenvolvimento e produção, podendo levar à morte das plantas afetadas. Os agentes associados a esta doença são bactérias endógenas restritas ao floema (Candidatus Liberibacter spp.). No gênero Citrus, ainda não foram encontradas espécies resistentes ao HLB, o que tem estimulado a utilização de ferramentas biotecnológicas, como a transformação genética, para auxiliar os programas de melhoramento genético, nos quais genes de interesse agronômico são introduzidos visando resistência a doenças. Na busca por uma planta transgênica resistente ao HLB, é desejável obter construções gênicas nas quais o gene de interesse se expresse, preferencialmente, na região em que a bactéria coloniza a planta, ou seja, no caso do HLB, no floema. Este trabalho objetivou avaliar plantas transgênicas de citrange \'Carrizo\' [Poncirus trifoliata (L.) Raf. x Citrus sinensis (L.) Osbeck] com gene uidA (β-glucuronidase), dirigido pelos promotores dos genes CsPP2.1 (Phloem protein 2) e CsVTE2 (homogentisato fitiltransferase) obtidos de Citrus sinensis. Foram analisadas as especificidades de cada promotor, e estes foram comparados com a ação do promotor constitutivo CaMV35S. Análises moleculares, como Southern blot e qPCR, foram realizadas a fim de verificar o número de cópias do transgene em cada planta avaliada, e quantificar a expressão relativa do gene uidA dirigido pelos diferentes promotores, respectivamente. Análises histológicas foram feitas para verificar a localização da expressão do gene repórter GUS (uidA). A expressão relativa do gene uidA dirigido pelos promotores específicos foi mais baixa quando comparada com o promotor constitutivo CaMV35S, uma vez que estes promotores direcionam a expressão apenas para tecidos específicos. O promotor CsPP2.1 direcionou a expressão do gene uidA para o tecido floemático, mais especificamente junto às células companheiras e elementos de tubo crivado. O promotor CsVTE2 direcionou a expressão do gene repórter preferencialmente para a periferia do parênquima cortical e para as células guarda, o que corresponde às áreas com presença de cloroplastos, além de também direcionar a expressão para o tecido floemático. Apesar de não ser específico de floema, o promotor CsVTE2 constitui-se em uma boa alternativa para construções visando o combate a doenças vasculares por estar envolvido em importantes processos fisiológicos da planta, como o combate a estresses oxidativos e o carregamento de fotoassimilados no floema. Os resultados sugerem que CsPP2.1 e CsVTE2 são promotores potenciais para serem utilizados em construções gênicas visando o controle de doenças vasculares tais como o HLB. / Brazil is the world\'s largest sweet orange producer, leading also the export of frozen concentrated orange juice. However, the citrus industry is constantly threatened by diseases, particularly those caused by bacteria, such as Huanglongbing (HLB). HLB is considered one of the most harmful citrus diseases, leading the plants to their death. The associated agents of this disease are endogenous bacteria restricted to the phloem of the plants (Candidatus Liberibacter spp.). No resistance has been found in Citrus spp. that could be used in breeding programs. Therefore, biotechnological strategies, such as genetic transformation, could help such programs to introduce genes for disease resistance. It is desirable the use of gene constructs that are preferentially expressed where the bacterium colonizes the plant, i.e., the phloem in plants affected by HLB. This study aimed to evaluate transgenic plants of \'Carrizo\' citrange [Poncirus trifoliata (L.) Raf. x Citrus sinensis (L.) Osbeck] with uidA gene (β-glucuronidase), driven by the promoters of CsPP2.1 (Phloem protein 2) and CsVTE2 (homogentisato fitiltransferase) genes obtained from Citrus sinensis plants. Each promoter specificity was analyzed and gene expression was compared with that induced by the constitutive promoter CaMV35S. Molecular analyses such as Southern blot and qPCR were performed in order to verify the number of transgenic copies in plants and to quantify relative expression of the uidA gene driven by different promoters, respectively. Histological analyses were done in order to identify the exact location of the GUS (uidA) reporter gene expression. Relative expressions of the uidA gene driven by specific promotors were lower than that driven by the CaMV35S constitutive promoter, since the expression was limited to specific tissues. The CsPP2.1 promoter drove the uidA gene expression to the phloem tissue, specifically to the companion cells and sieve elements. On the other hand, CsVTE2 promoter drove the reporter gene expression mainly to the periphery of the cortical parenchyma and to the guard cells, where high number of chloroplasts were present, and also drove the expression to the phloem. Although the CsVTE2 promoter is not phloem-specific, it might be used in gene constructs aiming vascular disease control, since it is involved in physiological processes such as mitigating oxidative stress and photoassimilate phloem loading. The results suggest that CsPP2.1 e CsVTE2 are promising promoters to be used in gene constructs in order to control vascular diseases, such as HLB.

Introdução: A água tem sido considerada um importante veículo para a disseminação de surtos de toxoplasmose em vários países. Os oocistos de Toxoplasma gondii podem persistir no ambiente durante longos períodos, sendo altamente resistentes aos vários processos químicos de inativação, inclusive aos processos comuns de desinfecção utilizados pelos sistemas produtores de água. Pouco se tem registrado no país sobre a real extensão da contaminação dos recursos hídricos por Toxoplasma gondii, sendo que a sua detecção em amostras de águas é muito importante na implantação de ações preventivas. As metodologias existentes no momento para identificação e quantificação deste parasita nestes tipos de amostras não estão universalmente padronizadas e apresentam limitações. Objetivo: O presente estudo teve como objetivo verificar a possível presença do protozoário em águas superficiais de abastecimento público no Estado de São Paulo mediante a implantação de uma metodologia específica para a quantificação de oocistos de Toxoplasma gondii por reação quantitativa de PCR em tempo real nessas amostras. Método: Um total de 39 amostras de águas superficiais provenientes de 10 mananciais do Estado de São Paulo foram analisadas durante o período de maio a dezembro de 2015. Volumes de 20L da amostra foram concentrados por meio de filtração em cápsulas Envirocheck® HV (Pall Gelman Laboratory), sendo a cápsula filtrante tratada com uma solução dispersante, eluída e o eluato concentrado por centrifugação. O sedimento obtido após a centrifugação da amostra foi submetido à extração de DNA, sendo utilizado o kit de extração PowerSoil DNA isolation® (MO BIO Laboratories). A sequência alvo selecionada para detecção e quantificação de oocistos de Toxoplasma gondii através da reação quantitativa de PCR em tempo real foi um fragmento de 62 pares de bases do gene B1, sendo utilizado o seguinte conjunto de iniciadores: 5 CTAGTATCGTGCGGCAATGTG 3 (531-551) e 5GGCAGCGTCTCTTCCTCTTTT 3 (571-592). A sonda utilizada foi: 5 (6-FAM) CCACCTCGCCTCTTGG-(NFQ-MGB) 3. Resultados: Do total das amostras analisadas, 7,7 por cento (3/39) foram positivas para oocistos de Toxoplasma gondii e dentre os 10 mananciais estudados, detectou-se a ocorrência do protozoário em 30 por cento (3/10) dos mesmos. Conclusão: Os dados obtidos no presente estudo demonstram que o protozoário Toxoplasma gondii está circulando em águas superficiais de abastecimento público no Estado de São Paulo. / Introduction: Water is an important vehicle for the spread of toxoplasmosis outbreaks in several countries. Toxoplasma gondii oocysts may remain for a long period in the environment and are highly resistant to chemical inactivation, including the routine classical disinfection procedures in water treatment facilities. Few reports have been published in Brazil about the real extent of the contamination of water resources by Toxoplasma gondii, which is of major importance to implement preventive actions. Methods for the identification and quantification of the parasite in water bodies are not standardized and have limitations. Objective: This study aimed to verify the presence of these protozoa in surface waters used as source for drinking water production in the State of São Paulo by implementing a specific methodology to quantify Toxoplasma gondii oocysts with quantitative real-time PCR. Method: Thirty nine samples of surface waters from 10 different sites in the State of São Paulo were analized from May to December 2015. Volumes of 20L of each sample were concentrated by filtration with capsule Envirocheck® HV (Pall Gelman Laboratory).The filter capsule was treated with a dispersant solution, eluted, and the eluate concentrated by centrifugation. DNA was extracted from the resulting pellet with PowerSoil DNA isolation® (MO BIO Laboratories) extraction kit. A fragment of 62 base pairs of the B1 gene was selected as target sequence for detection and quantitation the Toxoplasma gondii oocysts by the quantitative real-time PCR reaction, and the following primers: 5\' TAGTATCGTGCGGCAATGTG 3\' (531-551) and 5\'GGCAGCGTCTCTTCCTCTTTT 3\' (571-592) were used. The probe employed was 5 \'(6-FAM) CCACCTCGCCTCTTGG- (NFQ-MGB) 3\'. Results: Toxoplasma gondii oocysts were detected in 30 per cent (3/10) of the sites evaluated and 7.7 per cent (3/39) of all samples analyzed were positive. Conclusion: The results of the present study show that the protozoan Toxoplasma gondii is circulating in surface waters used as drinking water supply in the State of São Paulo.

Atualmente, o Brasil é o maior produtor de cana-de-açúcar (Saccharum ssp.), no qual o estado de São Paulo é responsável por mais de 50% da produção. Esta cultura é hospedeira de diversos patógenos que podem limitar sua produção, dentre os quais se destaca a bactéria Leifsonia xyli subsp. xyli (Lxx), agente causal do raquitismo da soqueira (ratoon stunting disease - RSD). Pouco se sabe sobre a fisiologia deste organismo e quais as estratégias utilizadas por este para colonizar seu hospedeiro. No entanto, sabemos que para infectar e colonizar seus hospedeiros, é necessário que bactérias parasíticas superem estresses de diversas naturezas impostas durante estes processos, como os estresses oxidativo e o osmótico. Neste contexto, os objetivos deste trabalho foram identificar in silico e analisar a expressão in vitro, por qPCR, de genes relacionados a estes dois estresses. Uma análise da sequência do genoma de Lxx identificou 35 genes, sendo 8 relacionados ao estresse oxidativo, 9 relacionados ao estresse osmótico e 11 relacionados a estresse gerais, incluindo um cluster de 6 genes envolvidos na síntese de carotenoides. A expressão destes foi avaliada 60 minutos após exposição a 30mM de H2O2 ou 7% (p/v) de polietilenoglicol 6000 (PEG 6000). Sete genes foram avaliados como normalizadores das reações de qPCR. A quantificação do grau de peroxidação lipídica indicou que ambos os tratamentos resultaram em sensível peroxidação, muito embora o efeito do tratamento com PEG 6000 tenha sido maior do que o tratamento com H2O2. A exposição ao H2O2 aumentou a expressão dos genes katA (catalase), sodA (superóxido dismutase), msrA (Sulfóxido de metionina redutase) e msrB (Sulfóxido de metionina redutase) bem como de todos os genes responsáveis pela síntese de carotenoides. Por outro lado, todos os genes relacionados ao estresse osmótico foram menos expressos na presença deste composto. Já quando a bactéria foi exposta a PEG 6000, o oposto ocorreu, ou seja, os genes relacionados ao estresse osmótico, que são otsA (Trealose-6-fosfato sintase), otsB (Trealose fosfatase), treY (Malto-oligosil trealose sintase), treZ (Malto-oligosil trealose trealoidrolase), treS (Trealose sintase), proX (Proteína de ligamento em substrato, tipo ABC glicina betaína transportadora), proW (Proteína permease, tipo ABC glicina betaína transportadora), proZ (Proteína permease, tipo ABC glicina betaína transportadora) e Naggn (Amidotransferase), além dos genes do cluster carotenoide, foram mais expressos, ao passo que alguns dos genes ligados à resposta ao estresse oxidativo foram menos expressos. Verificou-se também, através de PCR convencional utilizando primers para amplificar as regiões entre os genes carotenoides, que estes são expressos como um RNA policistrônico, constituindo assim um operon. Estes resultados validam predições anteriores baseadas na análise in silico da sequência do genoma de Lxx, confirmando que Lxx possui mecanismos responsivos aos estresses osmótico e oxidativo aos quais é submetida durante o processo de infecção de seu hospedeiro. / Currently, Brazil is the largest producer of sugarcane (Saccharum spp.) and the state of São Paulo accounts for over 50% of the national production. This crop is host to many pathogens that may limit its production, among which the bacterium Leifsonia xyli subsp. xyli (Lxx), causal agent of ratoon stunting disease (RSD), is one of the most important. Little is known about the physiology of this organism and the strategies it uses to colonize its host. However, it is known that to infect and colonize their hosts, parasitic bacteria have to overcome stresses of various natures imposed during these processes, such as oxidative and osmotic stresses. In such context, the objectives of this study were to identify in silico and to analyze in vitro, by qPCR, the expression of Lxx genes related to these two stresses. The analysis of the genome sequence of Lxx identified 35 genes, of which 8 were related to oxidative stress, 9 to osmotic stress and 11 to general stress, including a cluster of 6 genes involved in the synthesis of carotenoids. The expression of these genes was assessed 60 minutes after exposure to either 30 mM of hydrogen peroxide (H2O2) or 7% (w/v) of polyethylene glycol 6000 (PEG6000). Seven genes were tested as normalizers of the qPCR reactions. The quantification of the level of lipid peroxidation in cells of Lxx indicated that both treatments induced substantial peroxidation, even though the effect of PEG6000 was greater than that of H2O2. The exposure to H2O2 resulted in higher expression of the genes katA (catalase), sodA (superoxide dismutase), msrA (sulfoxide methionine reductase) and msrB (sulfoxide methionine reductase), as well as all genes involved in the synthesis of carotenoids. On the other hand, the expression of all genes related to osmotic stress was reduced in the presence of this compound. When Lxx was exposed to PEG6000, the opposite was detected: the expression of the genes related to osmotic stress, otsA (Trehalose-6- phosphate synthase), otsB (trehalose phosphatase), treY (Malto-oligosil trehalose synthase) treZ (Malto-oligosil trehalose trehaloidrolase), treS (trehalose synthase), proX (ligament protein substrate, type ABC glycine betaine carrier), proW (permease protein, ABC type glycine betaine carrier), proZ (protein permease, type ABC glycine betaine carrier) and naggn (amidotransferase), along with the carotenoid genes was increased, while some of the genes linked to oxidative stress response were less expressed. It was also concluded through conventional PCR that the genes of the carotenoid cluster are expressed as a polycistronic RNA and, therefore, this arrangement constitutes an operon. These results validate previous in silico predictions that Lxx has mechanisms responsive to osmotic and oxidative stresses to which it is subjected during the process of infection of its host.

As plantas apresentam diversas adaptações fisiológicas à baixa disponibilidade de fósforo (Pi) do solo. Este trabalho discute os custos fisiológicos e energéticos associados com essas estratégias, focado nas respostas da cana-de-açúcar (Saccharum spp.) à disponibilidade de Pi durante a simbiose com micorrizas arbusculares (Glomus clarum). Esses custos são importantes componentes para a adaptação a solos com baixo Pi, afetando a aquisição e conteúdo de fósforo; o crescimento e concentração de açúcares em tecidos vegetais. Plantas de cana-de-açúcar foram cultivadas em vasos com ou sem micorrizas (Glomus clarum), e sob a disponibilidade de baixo (20 mg kg-1) ou alto (202 mg kg-1) fósforo. Raízes e parte-aérea foram coletadas para as análises após 14, 30, 44 e 58 dias pós-inoculação (dpi) com Glomus clarum . A condição de BP causou a deficiência de Pi nas plantas, micorrízicas ou não. As plantas sob AP continham um teor foliar de Pi adequado, e partir dos 44 dpi acumularam pelo menos 6 vezes mais Pi parte-aérea, do que as cultivadas sob BP, efeito mais evidente nas micorrízicas. A eficiência de absorção, indicada pelo acúmulo de Pi na parte-aérea a uma dada biomassa da raiz, foi igual para todos os tratamentos, sugerindo que as eficiências radicular e micorrízica da absorção de Pi foram similares, independentemente da doses de Pi. A disponibilidade de fósforo não afetou a biomassa total das plantas, sendo as cultivadas sob BP mais eficientes na utilização deste nutriente. Por outro lado, as plantas micorrízicas suplementadas com BP apresentaram maior crescimento da raiz e redução na parte-aérea, resultando no aumento da proporção raiz:parte-aérea. Aos 58 dpi, a glicose, frutose e sacarose presente nas folhas de plantas micorrízicas foi 3,8, 2,3 e 2,4 vezes respectivamente mais concentrada do que nas não micorrízicas. Esses resultados sugerem que, nestas condições experimentais, o estabelecimento da simbiose não foi uma associação mutualística típica, afetando o perfil de crescimento e a alometria da cana cultivada com BP. As concentrações de fotoassimilados na folhas de planta micorrízicas indicam que houve aumentos nas taxas fotossintéticas, mas isso não resultou no maior crescimento do macrosimbionte. A tecnologia de amplificação quantitativa de transcritos reversos (RT-PCR) se tornou uma opção para a validação funcional de genes, com alta sensibilidade, acurada quantificação e eficácia. A quantificação relativa da expressão gênica é conseqüentemente fácil e determina a expressão de um gene em relação a outro expresso e relativamente constante. Neste trabalho foi analisada a variabilidade de expressão dos genes de cana-de-açúcar codificando a actina (Actina), gliceraldeido fosfato desidrogenase (GAPDH), tubulina (Tubulina), e ubiquitinas (UbiQ1 e UbiQ2) em diversos tecidos, e comparou-se a variabilidade obtida utilizando os programas Genorm e NormFinder. Em seguida, foram realizadas análises de expressão gênica utilizando o programa REST para a validação estatística da expressão de genes de cana-de-açúcar. O gene UbiQ1 foi mais estável nos tecidos ou órgãos testados: meristema, inflorescência, folha, colmo e raízes tratadas com alto e baixo fósforo. Tendo o gene UbiQ1 como referência, a expressão relativa dos genes transportadores de fosfato de alta afinidade de cana-de-açúcar PT7 e PT8 foi avaliada em amostras de raiz fertilizadas com alto ou baixo Pi, inoculadas ou não com fungo micorrízico e coletadas aos 58 dpi. Esses dois genes pertencem à família Pht1 de transportadores de fosfato e são similares aos ortólogos de arroz ORYsa;tPht1;7 e ORYsa;Pht1;8. Sob a deficiência de Pi, o transportador de fosfato PT7 foi induzido em raízes não colonizadas; já nas micorrízicas foi pouco expresso, sendo que altas taxas de colonização radicular suprimiram a expressão do PT7. O gene PT8 pouco variou sua expressão, sendo sutilmente mais expresso em plantas micorrízicas do que nas não micorrízicas sob o suprimento de BP. Estes resultados indicam que o PT7 é induzido em raízes sob estresse por fósforo e provavelmente associado à absorção radicular de Pi. Enquanto o gene PT8 possui uma modulação pouco variável provavelmente envolvido na manutenção do fluxo ou homeostase de Pi, possivelmente associado com a absorção radicular e micorrízica de fosfato. O PT7 e o PT8 foram expressos em tratamentos de médio/longo prazo, apresentando expressão ou indução em resposta a privação por Pi, o que é consistente com a função proposta de aquisição e mobilização de Pi para esta família de transportadores. A cana-de-açúcar micorrízica mostrou alta plasticidade de resposta ao BP / Plants display a wide array of physiological adaptations to low soil phosphorus (Pi) availability. This work discussed physiological and energetic costs associated with these strategies, focusing on sugarcane responses to Pi availability during the development of arbuscular mycorrhizal (AM) symbiosis. Such costs are important components of adaptation to low phosphorus soils affecting phosphorus acquisition and leve, growth and soluble sugars concentration in plant tissues. Sugarcane plants were grown in pots, with or without AM (Glomus clarum), and with low (20 mg kg-1) or high (200 mg kg-1) phosphorus supply. Roots and shoots were harvest for analysis after 14, 30, 44 and 58 days post-inoculation (dpi) with the fungus Glomus clarum,. The low Pi supply caused Pi deficiency in mycorrhizedl or non-mycorrhizedl plants. The efficiency of Pi absorption, indicated by shoot Pi accumulation in correlation to root biomass, suggested that root and mycorrhizal Pi absorption were similar, regardless of the Pi doses. Phosphorus availability did not affect the whole-plant biomass, and plants under low Pi supply, used more efficiently this nutrient. On the other hand, mycorrhized plants supplemented with low Pi presented the highest root growth and shoot reduction, resulting in high root:shoot ratio. At 58 dpi, glucose, fructose and sucrose concentrations in leaves of mycorrhized plants were 3.8, 2.3 and 2.4-fold higher respectively, than in non-mycorrhizedl plants. These results suggested that, under these experimental conditions, mycorrhizal symbiosis establishment was not a typical mutualistic association affecting sugarcane growth profile and allometry, when cultivated under low Pi. The photosynthate levels of leaves from mycorrhizd plants indicated an increase in photossynthetic rate but withut resulting in higher macrobiont growth. The quantitative amplification of reversed transcripts (RT-PCR) technology has become a method of choice for functional gene validation, with sensitiveness, accurate quantification and high-throughput. The relative quantification is easier determined by relative expression in comparison to a constitutively expressed refernce gene. Here, the expression variability of a sugarcane actin gene (Actin) glyceraldehydo phosphate dehydrogenase (GAPDH), tubulin (Tubulina), and ubiquitins (UbiQ1 and UbiQ2) from various tissues were analysed and compared based on the ranking list from the Genorm and NormFinder softwares. Expression analysis based on the REST software gave the proper statistic validation. UbiQ1 was the most stable gene among the candidate gen-references along the various tissues or organs tested: meristem, inflorescence, leaf, stem and roots treated with high and low phosphorus. Considering UbiQ1 as the reference gene, the relative expression of the sugarcane high-affinity phosphate transporters genes PT7 and PT8 were assessed from roots fertilized with low Pi or high Pi , inoculated or not with the mycorrhizal fungus, harvest 58 dpi. Both genes belong to the Pht1 Pi transporter and share similarity with the rice orthologs ORYsat;Pht1;7 and ORYsat;Pht1;8. Under Pi deficiency, the phosphate transporter PT7 was induced in non-colonized roots, but less expressed in mycorrhizedl ones, with high root colonization rate suppressing PT7 expression. PT8 showed low variability in expression, slightly more expressed in mycorrhized plants than in non-mycorhized plants under low Pi supply. These results indicated that PT7 was induced in Pi stressed roots, and possibly associated with the root Pi uptake, while PT8 had limited modulation in expression and probably involved on Pi fluxes or homeostasis, likely associated with both root and mycorrhizal phosphate uptake pathways. PT7 and PT8 were induced during medium/long-term treatments, showing induction or constant expression in both acquisition and mobilization of Pi in response to Pi deprivation, which is consistent with the proposed role of this tranporter family. Mycorrhizedl sugarcane showed a highly plastic response to low Pi

Pesquisas atuais demonstram respostas positivas em plantios de Eucalipto consorciados com Acacia mangium. O objetivo principal desse trabalho foi avaliar a influência dos sistemas puros e mistos de Eucalyptus grandis e A. mangium na estrutura das comunidades de bactérias e fungos do solo. Avaliou-se a estrutura dessas comunidades num gradiente de profundidade do solo. Foram abertas trincheiras profundas em plantios puros de Acácia (100A), Eucalipto (100E) e em sistemas mistos entre as duas espécies (A+E). No plantio misto fizeram-se coletas de solo e raízes na base da Acácia A(A+E) e na base do Eucalipto E(E+A). Cerca de 10 camadas do solo foram avaliadas ao longo do perfil das trincheiras, sendo coletados pontos de 0 a 800 cm, com 4 repetições cada. As comunidades microbianas foram monitoradas por PCR-DGGE, onde foi observado um forte efeito da profundidade do solo nas comunidades microbianas. Agrupamentos específicos foram formados em cada profundidade amostrada. Plantios puros de Eucalipto selecionaram grupos de bactérias diferentes dos que foram encontrados em 100A, A(A+E) e E(E+A). A comunidade de fungos totais não sofreu diferenciação de grupos nos plantios estudados, ao passo que os perfis de fungos micorrízicos arbusculares (FMA) do solo no tratamento A(A+E), foram significativamente diferentes dos grupos encontrados nos demais tratamentos. Numa análise de correlação, realizada por RDA, ficou indicado que a comunidade de FMA do tratamento A(A+E) correlacionou-se positivamente com os valores de P no solo. Outra variável quantificada foi a abundância de bactérias e fungos, indicadas pelo número de cópias do gene ribossomal 16S DNAr e ITS, respectivamente. Quando comparadas as camadas superficiais do solo (0-20 cm), não foi possível encontrar diferenças na abundância de cópias dos genes 16S e ITS em todos os tratamentos. Ocorreu uma queda exponencial no número de cópias desses genes com o aumento da profundidade do solo. Porém, o tratamento 100E apresentou maior número de cópias em profundidade (de 300-800 cm) dos genes 16S e ITS do que qualquer outro tratamento. Em relação a presença específica de FMA, houve baixa colonização e baixa abundância de esporos de FMA em todos os tratamentos, sendo o tratamento 100E mais colonizado que os demais. Ao todo foram encontradas 16 espécies de FMA, sendo a maior parte pertencente ao gênero Acaulospora. Ao contrário dos FMA, os plantios apresentaram colonização radicular pronunciada por ECM. Conclui-se que nestes sistemas florestais uma espécie de planta parece ser mais importante que a outra na estruturação da comunidade microbiana e que alguns fatores do solo podem ser preponderantes nessa separação. O conhecimento dessas comunidades é de suma importância em plantios florestais, principalmente por estarem envolvidos diretamente nos ciclos biogeoquímicos e, sobretudo, por se tratar de uma forma de plantio florestal nova, promissora e que aborda parâmetros de sustentabilidade. / Recently discoveries have shown positive responses in Eucalyptus plantations intercropped with Acacia mangium. The aim of this study was to evaluate the influence of pure and mixed systems (Eucalyptus grandis and A. mangium) on the microbial communities\' structure in soil. We evaluated the structure of these communities in a gradient of soil depth. In this context, deep trenches were digged in pure stands of Acacia (100A), Eucalyptus (100E) and mixed systems (A+E). In mixed forest plantations, soil and roots were sampled at the base of Acacia (A+E) and the base of Eucalyptus (E+A). Soil over 10 layers along the profile from 0 to 800cm were sampled, with 4 replicates each. The microbial communities were monitored by PCRDGGE, where we observed a strong effect of soil depth on microbial communities. As a result, specific clusters were formed in each soil layer. The community composition of Eucalyptus grandis stands was different from the community structure found in the 100A, A (A+E) and E (E+A) systems. The total fungal community did not show any group differentiation due to the plantation system, while the profiles of mycorrhizal fungi (AMF) of these three groups were significantly different from that of the treatment A (A+E). A correlation analysis performed by RDA indicated that the FMA community of the treatment (A+E) was correlated positively with P values in the soil. Another variable quantified was the community of bacteria and fungi, indicated by the number of copies of ribosomal 16S rDNA and ITS, respectively. Comparing the upper soil layers (0-20 cm), we couldn\'t find differences in the abundance of copies of 16S rRNA and ITS region genes in all treatments, but we observed an exponential decrease in 16S rRNA copy numbers with increasing soil depth. Regarding the presence of AMF, we found low root colonization and low abundance of AMF spores in all treatments, although 100E presented higher colonization rates than the others. Altogether, 16 AMF species were found, most of them belonging to the genus Acaulospora. We conclude that these forest systems a plant species seems to be more important than the other in the structuring of the microbial community and that some soil factors may be preponderant in this separation. The processes involving the dynamics of the microbial community structure is a crucial point in understanding the development of forest plantations, mainly by involving the biogeochemical cycles, when seeking for new promising approaches and sustainability parameters.

O fósforo (P) é limitante tanto na produtividade da cana-de-açúcar (Saccharum officinarum L.) quanto na atividade da microbiota do solo. Em solos de regiões tropicais, devido à elevada saturação por óxidos de ferro e alumínio, o P se encontra normalmente indisponível às plantas. Portanto, o manejo da adubação de P, baseado no uso de microrganismos capazes de promover uma melhor ciclagem do P, se faz necessário. Assim, o objetivo do estudo foi avaliar as mudanças na microbiota do solo e na produtividade da cana-de-açúcar, em condições de campo, em resposta ao manejo orgânico associado à inoculação de bactérias solubilizadoras de fosfato (BSF). Para tanto, foi utilizado um composto, obtido previamente por meio da compostagem de subprodutos da indústria sucroenergética (torta de filtro e cinzas), enriquecido com fosfatos de rocha (fosfato de Araxá-FA ou fosfato de Bayóvar-FB). No campo foram estabelecidos sete tratamentos, sendo um destes o tratamento controle, adubado com superfosfato triplo. Seis tratamentos compreendiam áreas adubadas com composto, sendo duas com composto que continha FA, duas com FB e duas somente com composto sem enriquecimento com P (C). A metade dessas áreas recebeu também inoculação com BSF, contendo os tratamentos FA+I, FB+I e C+I. A inoculação foi feita com Bacillus simplex BACBR04, Bacillus sp. BACBR06 e Rhizobium sp. RIZBR0. As avaliações foram realizadas durante o primeiro ano de cultivo (cana planta) em dois períodos (aos seis e 12 meses). As mudanças na microbiota foram acessadas por meio da atividade das enzimas fosfatases (ácida e alcalina), fitases e β-glucosidase. Mudanças na estrutura da comunidade bacteriana e fúngica foram acessadas por meio do T-RFLP. A abundância dos genes 16S RNAr, phoD (relacionado à solubilização de P) e ITS foram avaliadas por meio de PCR quantitativo. A atividade das fosfatases e β-glucosidase aumentaram com a inoculação na cana adubada com composto enriquecido com fosfato de Araxá (FA+I) e também no solo adubado com composto sem enriquecimento (C+I). Nos tratamentos FA+I e C+I houve incremento do fósforo disponível e aumento de 10% na produtividade, em relação ao tratamento controle (M). As comunidades bacteriana e fúngica do tratamento C+I se estruturaram de forma distinta em relação ao tratamento controle (M). Nos solos inoculados houve menor abundância do gene ITS aos seis meses, enquanto que, para o gene 16S RNAr, os solos inoculados apresentaram menor abundância no período de 12 meses. Verificou-se que o consórcio bacteriano inoculado, associado com a aplicação de composto, superou, no primeiro ano de cultivo, o manejo rotineiramente utilizado em cana-de-açúcar (adubação com superfosfato triplo). É possível que haja efeito residual no decorrer dos ciclos da cana-de-açúcar, o que ainda reforçaria a importância do manejo orgânico associado à inoculação com BSF. / Phosphorus (P) is limiting both the yield of sugarcane (Saccharum officinarum L.) and the activity of the soil microbiota. In tropical soils, due to the high saturation of iron and aluminum oxides, P is normally unavailable to plants. Therefore, the management of P fertilization, based on the use of microorganisms that promote better P cycling is necessary. Thus, the objective of this study was to evaluate changes in the soil microbiota and in sugarcane yield under field conditions, in response to the organic management associated with the inoculation of phosphate solubilizing bacteria (PSB). In our field experiment, our fertilizer was an organic compost, previously obtained by the composting process of by-products of the sugarcane industry (filter cake and ashes), enriched with rock phosphates (Araxá phosphate-AP or Bayóvar phosphate-BP). Seven treatments were established in the field, one of which was the control treatment, fertilized with triple superphosphate. Six treatments comprised compost fertilized areas, two with compost containing AP, two with BP, and two only with compost, and without any enrichment with P (C). Half of these areas were also inoculated with PSB, containing the treatments AP+I, BP+I and C+I. Field inoculation was done with Bacillus simplex BACBR04, Bacillus sp. BACBR06 and Rhizobium sp. RIZBR0. We performed evaluations during the first year of cultivation at two periods (at six and twelve months after planting). We accessed the changes in the microbiota through the activity of acid and alkaline phosphatases, phytases and β-glucosidase. Changes in bacterial and fungal community structure were accessed through T-RFLP. We evaluated the abundance of the 16S RNAr, phoD (related to P solubilization) and ITS genes by quantitative PCR. The phosphatases and β-glucosidase activity increased with the inoculation in sugarcane fertilized with compost and enriched with Araxá phosphate (AP+I) and in the soil fertilized with compost, but without any enrichment (C+I). In these treatments (AP+I and C+I), we found an increase in available phosphorus and a 10% increase in productivity, in relation to the control treatment (M). The bacterial and fungal communities of the treatments C+I presented a different structure in relation to the control treatment (M). In the soils that received bacterial inoculations, there was a lower abundance of the ITS gene at six months, whereas for the 16S RNAr gene the inoculated soils presented lower abundance at 12 months. We verified that the inoculated bacterial consortium, associated with the application of compost, overcame the conventional management in sugarcane (triple superphosphate fertilizer) in the first year of cultivation. In addition, it is possible residual effect during the sugarcane cycles, which would further reinforce the importance of organic management associated with BSF inoculation.

Os microrganismos são responsáveis por diversos processos biológicos essenciais ao ambiente, sendo estes intimamente relacionados com as taxas de decomposição da matéria orgânica e com a persistência da fertilidade nos solos. Apesar da importância e grande diversidade, a identificação de táxons envolvidos em processos específicos está geralmente restrita a uma pequena fração da microbiota que pode ser isolada e cultivada. Sendo assim, pouco se sabe sobre os microrganismos que atuam no ciclo do carbono no solo, como, aqueles que participam da oxidação do metano (CH4), por exemplo. Estes, chamados metanotróficos exercem papel importante no controle da emissão desse gás de efeito estufa para a atmosfera podendo servir como um filtro de metano e mitigar suas emissões. A Terra Preta Antropogênica (TPA) é um importante ecossistema na região amazônica e contém fragmentos cerâmicos e frações orgânicas, como o carvão (biocarvão), que foram incorporados em períodos pré-colombianos. Isso resultou em solos sustentáveis com elevada fertilidade, apresentando cerca de três vezes mais matéria orgânica, setenta vezes mais biocarvão e diversidade microbiana maior quando comparados com os solos adjacentes. Com o presente trabalho, objetivou-se avaliar o efeito do enriquecimento atmosférico com metano sobre a abundância da comunidade bacteriana total e de metanotróficas nos solos de Terra Preta da Amazônia sob floresta e cultivo (TPA Floresta e TPA Cultivada) e seus respectivos solos adjacentes (ADJ Floresta e ADJ Cultivado), coletados Estação Experimental do Caldeirão (Iranduba, AM). Para tanto, foi realizado um experimento de microcosmo no qual os solos foram incubados com atmosfera contendo 10% de metano e meio de cultura NMS (do inglês, Nitrate mineral salts), utilizado para crescimento de metanotróficas, a fim de avaliar a resposta dessas comunidades ao longo de 21 dias. A variação da concentração de metano na atmosfera dos frascos foi monitorada através de cromatografia gasosa e o DNA do solo recuperado nos tempos de coleta durante o experimento foi extraído para utilização na técnica de PCR quantitativo (qPCR), a qual possibilitou a quantificar o número de cópias dos genes 16S rRNA Bacteria e pmoA nas amostras. O solo de Terra Preta da Amazônia se mostrou um potencial dreno de CH4 atmosférico Comparando as respostas dos solos com floresta (TPA Floresta e ADJ Floresta) e cultivados (TPA Cultivada e ADJ Cultivado), notou-se uma menor variação da abundância da comunidade metanotrófica presente nestes últimos, o que indica que alteração do uso do solo afeta a capacidade do mesmo em retirar metano da atmosfera. Os solos Adjacentes apresentaram resposta diferente dos solos de TPA, indicando que a história de formação, ocupação e uso do solo também influenciam na capacidade do solo em drenar o metano da atmosfera. / Microorganisms are responsible for several biological processes essential to the environment, which are closely related to the rates of decomposition of organic matter and with the persistence of fertility in soils. Despite the importance and high diversity, identification of taxa involved in specific processes is usually restricted to a small fraction of the microbiota that can be isolated and cultivated. Thus, little is known about the microorganisms that act on the carbon cycle in the soil, such as those participating in the oxidation of methane (CH4), for example. These, known as methanotrophs play an important role in controlling the emission of greenhouse gas into the atmosphere and may serve as a methane filter and mitigate their emissions. Amazonian Dark Earth (ADE) is an important ecosystem in the Amazonian region and contains ceramic fragments and organic amendments, such as charcoal (biochar), which were incorporated in Pre-Columbian periods. This resulted in sustainable soils with high fertility, presenting about three times more organic matter, seventy times more biochar and higher microbial diversity when compared to adjacent soils. The present work aimed to evaluate the effect of atmospheric methane enrichment on the abundance of the bacterial and methanotrophic community in ADE soils under forest and cultivation (ADE Forest and ADE Cultivated) and their respective adjacent soils (ADJ Forest and ADJ Cultivated), sampled at Caldeirão Experimental Station (Iranduba, AM). For this purpose, a microcosm experiment was performed in which the soils were incubated under an atmosphere containing 10% of methane and NMS (Nitrate mineral salts) culture medium used for methanotrophic growth in order to evaluate the response of these communities over 21 days. The variation of methane concentrations in the atmosphere of the vials was measured by gas chromatography and the soil DNA recovered in the collection time during the experiment was extracted for use in the technique of quantitative PCR (qPCR), which made it possible to quantify the number of copies of 16S rRNA Bacteria and pmoA on samples. The Amazonian Dark Earth soil showed a potential sink for atmospheric CH4. Comparing atmospheric responses of forest soils (ADE Forest and ADJ Forest) and cultivated soils (ADE Cultivated and ADJ Cultivated), noted a minor variation in the abundance of methatroph community in these last, indicating that land use change affects the ability of it to sink the methane atmosphere. Adjacent soils had different responses of ADE soils, indicating that the history formation, occupation and land use also influence the capacity of the soil to drain methane from the atmosphere.

O Brasil é o maior produtor de laranja do mundo, liderando também a produção e exportação de suco concentrado congelado. Um dos fatores que ameaçam o setor é o grande número de doenças, principalmente, as bacterianas como o Huanglongbing (HLB). O HLB é considerado uma das mais graves doenças dos citros, que compromete seu desenvolvimento e produção, podendo levar à morte das plantas afetadas. Os agentes associados a esta doença são bactérias endógenas restritas ao floema (Candidatus Liberibacter spp.). No gênero Citrus, ainda não foram encontradas espécies resistentes ao HLB, o que tem estimulado a utilização de ferramentas biotecnológicas, como a transformação genética, para auxiliar os programas de melhoramento genético, nos quais genes de interesse agronômico são introduzidos visando resistência a doenças. Na busca por uma planta transgênica resistente ao HLB, é desejável obter construções gênicas nas quais o gene de interesse se expresse, preferencialmente, na região em que a bactéria coloniza a planta, ou seja, no caso do HLB, no floema. Este trabalho objetivou avaliar plantas transgênicas de citrange \'Carrizo\' [Poncirus trifoliata (L.) Raf. x Citrus sinensis (L.) Osbeck] com gene uidA (β-glucuronidase), dirigido pelos promotores dos genes CsPP2.1 (Phloem protein 2) e CsVTE2 (homogentisato fitiltransferase) obtidos de Citrus sinensis. Foram analisadas as especificidades de cada promotor, e estes foram comparados com a ação do promotor constitutivo CaMV35S. Análises moleculares, como Southern blot e qPCR, foram realizadas a fim de verificar o número de cópias do transgene em cada planta avaliada, e quantificar a expressão relativa do gene uidA dirigido pelos diferentes promotores, respectivamente. Análises histológicas foram feitas para verificar a localização da expressão do gene repórter GUS (uidA). A expressão relativa do gene uidA dirigido pelos promotores específicos foi mais baixa quando comparada com o promotor constitutivo CaMV35S, uma vez que estes promotores direcionam a expressão apenas para tecidos específicos. O promotor CsPP2.1 direcionou a expressão do gene uidA para o tecido floemático, mais especificamente junto às células companheiras e elementos de tubo crivado. O promotor CsVTE2 direcionou a expressão do gene repórter preferencialmente para a periferia do parênquima cortical e para as células guarda, o que corresponde às áreas com presença de cloroplastos, além de também direcionar a expressão para o tecido floemático. Apesar de não ser específico de floema, o promotor CsVTE2 constitui-se em uma boa alternativa para construções visando o combate a doenças vasculares por estar envolvido em importantes processos fisiológicos da planta, como o combate a estresses oxidativos e o carregamento de fotoassimilados no floema. Os resultados sugerem que CsPP2.1 e CsVTE2 são promotores potenciais para serem utilizados em construções gênicas visando o controle de doenças vasculares tais como o HLB. / Brazil is the world\'s largest sweet orange producer, leading also the export of frozen concentrated orange juice. However, the citrus industry is constantly threatened by diseases, particularly those caused by bacteria, such as Huanglongbing (HLB). HLB is considered one of the most harmful citrus diseases, leading the plants to their death. The associated agents of this disease are endogenous bacteria restricted to the phloem of the plants (Candidatus Liberibacter spp.). No resistance has been found in Citrus spp. that could be used in breeding programs. Therefore, biotechnological strategies, such as genetic transformation, could help such programs to introduce genes for disease resistance. It is desirable the use of gene constructs that are preferentially expressed where the bacterium colonizes the plant, i.e., the phloem in plants affected by HLB. This study aimed to evaluate transgenic plants of \'Carrizo\' citrange [Poncirus trifoliata (L.) Raf. x Citrus sinensis (L.) Osbeck] with uidA gene (β-glucuronidase), driven by the promoters of CsPP2.1 (Phloem protein 2) and CsVTE2 (homogentisato fitiltransferase) genes obtained from Citrus sinensis plants. Each promoter specificity was analyzed and gene expression was compared with that induced by the constitutive promoter CaMV35S. Molecular analyses such as Southern blot and qPCR were performed in order to verify the number of transgenic copies in plants and to quantify relative expression of the uidA gene driven by different promoters, respectively. Histological analyses were done in order to identify the exact location of the GUS (uidA) reporter gene expression. Relative expressions of the uidA gene driven by specific promotors were lower than that driven by the CaMV35S constitutive promoter, since the expression was limited to specific tissues. The CsPP2.1 promoter drove the uidA gene expression to the phloem tissue, specifically to the companion cells and sieve elements. On the other hand, CsVTE2 promoter drove the reporter gene expression mainly to the periphery of the cortical parenchyma and to the guard cells, where high number of chloroplasts were present, and also drove the expression to the phloem. Although the CsVTE2 promoter is not phloem-specific, it might be used in gene constructs aiming vascular disease control, since it is involved in physiological processes such as mitigating oxidative stress and photoassimilate phloem loading. The results suggest that CsPP2.1 e CsVTE2 are promising promoters to be used in gene constructs in order to control vascular diseases, such as HLB.

Pesquisas atuais demonstram respostas positivas em plantios de Eucalipto consorciados com Acacia mangium. O objetivo principal desse trabalho foi avaliar a influência dos sistemas puros e mistos de Eucalyptus grandis e A. mangium na estrutura das comunidades de bactérias e fungos do solo. Avaliou-se a estrutura dessas comunidades num gradiente de profundidade do solo. Foram abertas trincheiras profundas em plantios puros de Acácia (100A), Eucalipto (100E) e em sistemas mistos entre as duas espécies (A+E). No plantio misto fizeram-se coletas de solo e raízes na base da Acácia A(A+E) e na base do Eucalipto E(E+A). Cerca de 10 camadas do solo foram avaliadas ao longo do perfil das trincheiras, sendo coletados pontos de 0 a 800 cm, com 4 repetições cada. As comunidades microbianas foram monitoradas por PCR-DGGE, onde foi observado um forte efeito da profundidade do solo nas comunidades microbianas. Agrupamentos específicos foram formados em cada profundidade amostrada. Plantios puros de Eucalipto selecionaram grupos de bactérias diferentes dos que foram encontrados em 100A, A(A+E) e E(E+A). A comunidade de fungos totais não sofreu diferenciação de grupos nos plantios estudados, ao passo que os perfis de fungos micorrízicos arbusculares (FMA) do solo no tratamento A(A+E), foram significativamente diferentes dos grupos encontrados nos demais tratamentos. Numa análise de correlação, realizada por RDA, ficou indicado que a comunidade de FMA do tratamento A(A+E) correlacionou-se positivamente com os valores de P no solo. Outra variável quantificada foi a abundância de bactérias e fungos, indicadas pelo número de cópias do gene ribossomal 16S DNAr e ITS, respectivamente. Quando comparadas as camadas superficiais do solo (0-20 cm), não foi possível encontrar diferenças na abundância de cópias dos genes 16S e ITS em todos os tratamentos. Ocorreu uma queda exponencial no número de cópias desses genes com o aumento da profundidade do solo. Porém, o tratamento 100E apresentou maior número de cópias em profundidade (de 300-800 cm) dos genes 16S e ITS do que qualquer outro tratamento. Em relação a presença específica de FMA, houve baixa colonização e baixa abundância de esporos de FMA em todos os tratamentos, sendo o tratamento 100E mais colonizado que os demais. Ao todo foram encontradas 16 espécies de FMA, sendo a maior parte pertencente ao gênero Acaulospora. Ao contrário dos FMA, os plantios apresentaram colonização radicular pronunciada por ECM. Conclui-se que nestes sistemas florestais uma espécie de planta parece ser mais importante que a outra na estruturação da comunidade microbiana e que alguns fatores do solo podem ser preponderantes nessa separação. O conhecimento dessas comunidades é de suma importância em plantios florestais, principalmente por estarem envolvidos diretamente nos ciclos biogeoquímicos e, sobretudo, por se tratar de uma forma de plantio florestal nova, promissora e que aborda parâmetros de sustentabilidade. / Recently discoveries have shown positive responses in Eucalyptus plantations intercropped with Acacia mangium. The aim of this study was to evaluate the influence of pure and mixed systems (Eucalyptus grandis and A. mangium) on the microbial communities\' structure in soil. We evaluated the structure of these communities in a gradient of soil depth. In this context, deep trenches were digged in pure stands of Acacia (100A), Eucalyptus (100E) and mixed systems (A+E). In mixed forest plantations, soil and roots were sampled at the base of Acacia (A+E) and the base of Eucalyptus (E+A). Soil over 10 layers along the profile from 0 to 800cm were sampled, with 4 replicates each. The microbial communities were monitored by PCRDGGE, where we observed a strong effect of soil depth on microbial communities. As a result, specific clusters were formed in each soil layer. The community composition of Eucalyptus grandis stands was different from the community structure found in the 100A, A (A+E) and E (E+A) systems. The total fungal community did not show any group differentiation due to the plantation system, while the profiles of mycorrhizal fungi (AMF) of these three groups were significantly different from that of the treatment A (A+E). A correlation analysis performed by RDA indicated that the FMA community of the treatment (A+E) was correlated positively with P values in the soil. Another variable quantified was the community of bacteria and fungi, indicated by the number of copies of ribosomal 16S rDNA and ITS, respectively. Comparing the upper soil layers (0-20 cm), we couldn\'t find differences in the abundance of copies of 16S rRNA and ITS region genes in all treatments, but we observed an exponential decrease in 16S rRNA copy numbers with increasing soil depth. Regarding the presence of AMF, we found low root colonization and low abundance of AMF spores in all treatments, although 100E presented higher colonization rates than the others. Altogether, 16 AMF species were found, most of them belonging to the genus Acaulospora. We conclude that these forest systems a plant species seems to be more important than the other in the structuring of the microbial community and that some soil factors may be preponderant in this separation. The processes involving the dynamics of the microbial community structure is a crucial point in understanding the development of forest plantations, mainly by involving the biogeochemical cycles, when seeking for new promising approaches and sustainability parameters.