Spelling suggestions: "subject:"via"" "subject:"vida""
1 |
Rikud vira-lata: metáforas dos borramentos entre tradição e contemporaneidade na cena da dançaDavidovitsch, Fernando 01 September 2014 (has links)
Submitted by Diana Alves (ppgdancaufba.adm@gmail.com) on 2014-09-09T14:28:29Z
No. of bitstreams: 1
DISSERTAÇÃO FERNANDO DAVIDOVITSCH.pdf: 2051341 bytes, checksum: 6a0cca93e84e687f46161e5e3eab9668 (MD5) / Approved for entry into archive by Alda Lima da Silva (sivalda@ufba.br) on 2014-09-11T17:31:34Z (GMT) No. of bitstreams: 1
DISSERTAÇÃO FERNANDO DAVIDOVITSCH.pdf: 2051341 bytes, checksum: 6a0cca93e84e687f46161e5e3eab9668 (MD5) / Made available in DSpace on 2014-09-11T17:31:34Z (GMT). No. of bitstreams: 1
DISSERTAÇÃO FERNANDO DAVIDOVITSCH.pdf: 2051341 bytes, checksum: 6a0cca93e84e687f46161e5e3eab9668 (MD5) / A presente pesquisa tem como abordagem os modos como a ideia de híbrido e/ou borramentos de fronteiras entre tradição e contemporaneidade foi construída no trabalho de dança, de autoria própria, Rikud Vira-Lata, que é o objeto de investigação neste estudo. Rikud Vira-Lata (rikud significa dança em hebraico) é um trabalho artístico que, por meio de uma autobiografia de um corpo judeubrasileirobrasileirojudeu na contemporaneidade, coloca em discussão temas como borras culturais, tradição israelita, corpo e identidade. Este estudo aporta-se na compreensão de que metáfora não está apenas restrita ao sistema linguístico verbal, mas que está, também, atrelada às nossas experiências corporais diárias, sendo uma ação cognitiva e que, assim, agimos por meio do procedimento metafórico. Como metodologia realizou-se a observação dos vídeos dos resultantes coreográficos em Rikud Vira-Lata entre os anos de 2011 e 2013 e foi feito o levantamento e revisão bibliográfica para o estudo dos substratos conceituais que referenciam esta investigação artística. Os principais teóricos que subjazem os aportes conceituais nesta pesquisa são das áreas de Estudos Culturais (CANCLINI, 2011, HALL, 2006), Ciências Cognitivas (LAKOFF e JHONSON, 2002), Artes Cênicas (ALENCAR, 2007a, 2007b), Estudos do Corpo (RENGEL, 2007a, 2007b, 2009, DOMENICI, 2004, KATZ e GREINER, 2005, GREINER, 2005) e Semiótica (PLAZA, 2010, SANTAELLA, 1990). O objetivo de tal pesquisa foi, então, analisar alguns resultantes coreográficos do trabalho artístico de dança Rikud Vira-Lata, desenvolvido entre os anos de 2011 e 2013, a fim de identificar como a metáfora do híbrido e do borramento entre tradição e contemporaneidade traduz-se através de um sistema de signos próprios da dança.
|
2 |
An Evaluation of Wool Density Sampling Procedures When Using the Wira Fleece CaliperMatthews, Doyle J. 01 May 1951 (has links)
Purpose
Wool is still the most valuable and the most versatile fiber used by man. Many questions regarding its production have gone unanswered for centuries. This problem is undertaken in the hope of contributing information which might be used in further study on the problem of wool density.
It is recognized that wool density is one of the four major factors affecting the total clean wool production of a sheep. If length of staple, diameter of fiber, and total surface area remain constant, an increase in density brings about a corresponding increase in total production of clean wool.
Wool fibers are produced by glands, called fiber follicles, beneath the surface of the skin. Density is controlled by the number of these follicles functioning within a given area.
Before great improvement in density can be made, it is necessary to know the mode of inheritance, it is necessary to know the density of each individual involved. Counting the fibere from any sizeable area is not practicable. Therefore, a technique is necessary for sampling the sheep and estimating the density on the basis of sampling figures.
Scope
The Wira Fleece Caliper is probably the most popular instrument used in sampling for density.
To determine the most effective method of using the Wira Caliper, different-sized samples are taken from a given area. Both sides of each sheep are tested, and sheep from different breeds are sampled. Density on all samples is determined by a standard laboratory procedure. The results are statistically analyzed to determine the variation in density as obtained by the different sample sizes.
In addition to the main objective, the variation in density between breeds, between sheep of the same brood, and the variation in density between sides on the same sheep is determined.
|
3 |
O jardim das ilusões / The garden of the illusionsSilva, Édio Raniere da 30 November 2005 (has links)
Made available in DSpace on 2016-04-28T20:38:54Z (GMT). No. of bitstreams: 1
Dissertacaook.pdf: 1574734 bytes, checksum: 8de7b0c1e27c4b84a67ab252bb8885e3 (MD5)
Previous issue date: 2005-11-30 / Conselho Nacional de Desenvolvimento Científico e Tecnológico / The Garden of the Illusions tries to map the 33 years of the Theatrical Group "Vira Lata", from Blumenau, Santa Catarina. Obviously, we work, then, with a past, with an immersed memory in reality. However, it s in its pure form, in itself, this duration remains virtually. Of this form, we were taken, initially, for a problematically: if our body, even that subtly, it serves as a link between the virtual and the current one, could we use the writing as a way to provoke updates of this virtual one? A writing that would finish for being worried not only about what it happened, but with what the event could put in motion the bodies of the people who had tried it. The challenge consists, therefore, in taking a writing to describe the affections that had gained life through the work of the Group "Vira Lata". The result of this challenge is the best of small texts organized in a structure of theatrical spectacle. We count on a Prologue of Illusions, eleven Acts and an Epilogue of Illusions. Each Act sets in motion a Machine Vira Lata . We have an infancy machine, an actor machine, a selling of illusions machine and others. Our map spreads itself in many territories, it dialogues with many forces. But if there is a plus in the Garden of the Illusions it is called: the duel between the forces that cross ourselves when we are trying to survive. It was not without some daring that we condense these forces around two great vectors. I - Vector of destruction of the unique processes, in which are joined the forces that want us weak, sad, servants, fools, frivolous, daily and taxable. It is the will of private, of privatization of the bodies. A condensation where the fear and the paranoia take account of the life. They congeal the creation processes leading to the destruction of the potentials and an oppressive submission to the ideal. The models, the essences, they appear as redeemer of pain. II - Vector of increase of the unique processes, in which are joined the forces that cross us. It is the will of delirium, of creation, of intoxication. The life is flooded by the risk. The models, the essences, the ideal could not support themselves. There is not a correct way, insurance, comfortable to survive. Greedy is still delirious. Balsams only slacken / O Jardim das Ilusões tenta cartografar os 33 anos da Equipe Teatral Vira Lata , de Blumenau, Santa Catarina. Obviamente, trabalhamos, então, com um passado, com uma memória imersa em realidade. Porém, que em sua forma pura, em seu em si, essa duração permanece virtual. Dessa forma, fomos tomados, inicialmente, por uma problematização: se nosso corpo, ainda que sutilmente, serve de ponte entre o virtual e o atual, poderíamos utilizar a escritura como meio de provocar atualizações desse virtual? Uma escritura que acabaria por preocupar-se não apenas com aquilo que aconteceu, mas com aquilo que o acontecimento fez/faz movimentar nos corpos das pessoas que o experimentaram. O desafio consiste, portanto, em levar uma escrita a descrever as afecções que ganharam passagem através do trabalho da Equipe Vira Lata . O resultado desse desafio é uma coletânea de pequenos textos organizados numa estrutura teatral de espetáculo. Contamos com um Prólogo de Ilusões, onze Atos e um Epílogo de Ilusões. Cada Ato aciona uma Máquina Vira Lata. Temos uma máquina infância, uma máquina ator, uma máquina vendedor de ilusões etc. Nosso mapa se espalha em muitos territórios, dialoga com muitas forças. Mas se há uma unidade diferenciante em O Jardim das Ilusões ela se chama: o duelo entre as forças que nos atravessam ao tentarmos sobreviver. Não foi sem alguma ousadia que condensamos essas forças em torno de dois grandes vetores. I Vetor de aniquilamento dos processos de singularização, no qual são reunidas as forças que nos querem fracos, tristes, servos, tolos, fúteis, cotidianos e tributáveis. É a vontade de privada, de privatização dos corpos. Uma condensação onde o medo e a paranóia tomam conta da vida. Congelam os processos de criação levando ao aniquilamento das potencias e a uma opressiva submissão ao ideal. Os modelos, as essências, surgem como redentores da dor. II Vetor de potencialização dos processos de singularização, no qual são reunidas as forças que pedem passagem, que nos atravessam. É a vontade de delírio, de criação, de embriaguez. A vida é inundada pelo risco. Os modelos, as essências, o ideal não conseguem mais se sustentar. Não há uma maneira correta, segura, confortável de sobreviver. Famintos ainda deliram. Bálsamos apenas amortecem
|
4 |
Do falar, do ouvir, do calar: sobre a linguagem no pensamento de Martin Heidegger / From the speech, the listen and the mute: regarding the language in the thought of Martin HeideggerMarcello, Guilherme Conti 05 November 2012 (has links)
Made available in DSpace on 2016-04-27T17:27:03Z (GMT). No. of bitstreams: 1
Guilherme Conti Marcello.pdf: 808702 bytes, checksum: 78ef204f0c992da9bbf70efeef6bc89b (MD5)
Previous issue date: 2012-11-05 / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior / The purpose of this research is to investigate the language concept at the second phase of Martin Heidegger thought, more specific at On the way to language, published in 1959. This work gathers and solidifies the considerations from Heidegger throughout the turning (Kehre).This work is divided in four parties designed to the language discussion: general considerations concerning the thought from Heidegger and the language, one chapter about listen (Hören) and silence (Schwaigen), another chapter about speech (Sprache) and discussion (Rede) and concluding with the final considerations. At the turning, the discussion about the language is established from one ontological point of view. The reference to the language is now performed as a speech (Sagen), the narrative of what is said can undercover the meanings and feelings from the Being manifestation (Seyn), also in the history through the Ereignis. The language then, makes the question regarding the history if the Being´s true in order to be thought by the mortals in an appropriate method. Heidegger displays the poetry as an existent way of language, which provides to unveil the Being. The listen acts, also, as an existent manifestation, which pervades the Dasein and establish a previous relation, equally related to the way of exist from Being, as the silence of the Being in its originality. The final considerations returns to the work percussion, concluding some of consistent issues, and intended to a reflection of an ethic propose based on the language, the possibility of hosting from Being intermediated by the language comprehension articulation, which provides the truth of its unveil / O propósito desta pesquisa é investigar o conceito de linguagem na segunda fase do pensamento de Martin Heidegger, mais especificamente, em A caminho da linguagem, publicado em 1959. Esta obra agrupa e solidifica as considerações de Heidegger acerca do tema da linguagem ao longo da assim chamada vira-volta (Kehre) no percurso do pensador. O trabalho é dividido em quatro: considerações gerais sobre o pensamento de Heidegger e a linguagem, um capítulo sobre escuta (Hören) e silêncio (Schwaigen), outro capítulo sobre fala (Sprache) e discurso (Rede) e encerrando com as considerações finais. Na vira-volta, a discussão acerca da linguagem se estabelece a partir de um ponto de vista ontológico. A referência à linguagem agora é feita na forma do dizer (Sagen), a saga do que é dito que pode desencobrir os significados e sentidos das manifestações do Ser (Seyn), também na história pelo acontecimento apropriador (Ereignis). A linguagem, então, faz com que a pergunta sobre a história da verdade do Ser possa ser pensada de modo apropriado. Heidegger apresenta a poesia como modo de ser da linguagem que possibilita o desvelamento do Ser em sua originariedade. A escuta atua, também, como uma manifestação do Ser que perpassa o ente humano, isto é, o Dasein e estabelece uma relação de anterioridade, igualmente atrelada aos modos de ser do Ser, com o silêncio. As considerações finais revisitam o percurso do trabalho, propondo fechamento a algumas pontuações expressas, e intencionando a reflexão de uma proposta ética baseada na linguagem, a possibilidade de acolhimento do Ser mediada pela articulação compreensiva da linguagem, que possibilita à verdade seu desvelamento
|
5 |
A viralatice brasileira: transformática para o Quarto ImpérioSouza, Marcelo Henrique Marques de 03 March 2016 (has links)
Submitted by Geandra Rodrigues (geandrar@gmail.com) on 2018-01-29T13:39:57Z
No. of bitstreams: 0 / Approved for entry into archive by Adriana Oliveira (adriana.oliveira@ufjf.edu.br) on 2018-03-21T19:23:35Z (GMT) No. of bitstreams: 0 / Made available in DSpace on 2018-03-21T19:23:35Z (GMT). No. of bitstreams: 0
Previous issue date: 2016-03-03 / Nelson Rodrigues criou, na década de 1950, a expressão “complexo de vira-lata” para designar o comportamento autodepreciativo do brasileiro. Esse comportamento, que já havia sido descrito por vários pensadores e viajantes do século XIX como uma característica bastante disseminada no Brasil, continua mais vivo do que nunca, o que ficou bem claro durante a copa do mundo de 2014, quando o tema voltou a ocupar o noticiário e os comentários gerais, diante dos problemas com os estádios e, evidentemente, depois do fracasso diante da Alemanha, nas semifinais. O complexo de vira-lata se tornou, assim, a denúncia de uma série de sintomas brasileiros. Entretanto, mais que isso, hoje a própria repetição da expressão se tornou, ela também, um dos nossos maiores sintomas. Importante frisar isso porque um dos principais objetivos desta pesquisa é tentar mostrar que a metáfora do vira-lata, a despeito de seu uso corrente no sentido de alimentar a percepção do brasileiro como aquele que joga o tempo todo contra si mesmo – o que guarda sua parcela de verdade –, carrega também a potência de apontar para o outro lado da mesma moeda, ou seja, para algumas peculiaridades do comportamento brasileiro, que são fundamentais para pensar o mundo de hoje. Para observar esse outro lado, apoiaremos a pesquisa no escopo teórico da transformática – que é a psicanálise entendida como uma grande teoria da comunicação –, especialmente em conceitos como revirão, teoria das formações, a tópica ‘Primário, Secundário e Originário’ e a teoria dos impérios de MD Magno. O propósito é mostrar que o vira-lata pode ser uma metáfora das mais ricas para demonstrar certas particularidades significativas da sintomática que estamos vivendo hoje, a passagem do terceiro para o quarto império, e o que os brasileiros têm a ver com isso. / -
|
6 |
Character Development and its Utilization for Convergent Media FormatsHaglund, Vira January 2012 (has links)
The thesis caters to the demands of the creative industries for products and contents which can be utilized for convergent media usage and cross-marketing strategies. In this regard character design serves as an important element of entertainment franchises since it is a means to produce media content with high recognition value. However, numerous character adaptations in different media formats illustrate that characters who are successful in one medium are not necessarily as successful in another media format. The thesis takes a closer look at characters in the context of media convergence and discusses the main principles of character creation and development. By favoring a heuristic approach which analyzes the aesthetic phenomena of arts and entertainment by the means of theoretical research which is supported by practical examples, the thesis concludes that character development is based on three dimensions which have to be combined in order to create characters which can be utilized for different media formats. In this context the work discusses character creation in writing, visuals and interactive media by focusing on ways which secure the successful transfer of characters into different media formats without a loss of character depth and quality.
|
7 |
Análise molecular da interação entre Tospovirus e o gene resistência Sw-5 / Molecular analysis of the tospovirus Sw-5 resistance gene interactionLau, Douglas 31 March 2004 (has links)
Submitted by Marco Antônio de Ramos Chagas (mchagas@ufv.br) on 2017-04-27T13:57:34Z
No. of bitstreams: 1
texto completo.pdf: 2630530 bytes, checksum: 112de5671b9d3e521f0446f6d6d7237e (MD5) / Made available in DSpace on 2017-04-27T13:57:34Z (GMT). No. of bitstreams: 1
texto completo.pdf: 2630530 bytes, checksum: 112de5671b9d3e521f0446f6d6d7237e (MD5)
Previous issue date: 2004-03-31 / Conselho Nacional de Desenvolvimento Científico e Tecnológico / Alguns aspectos da interação entre o gene de resistência Sw-5 e os tospovírus, foram analisados neste trabalho. A capacidade de Sw-5 conferir resistência em Nicotiana benthamiana foi avaliada em plantas transformadas com uma construção na qual a ORF e a região 3' do gene estavam sob controle do promotor 35S. As plantas transformadas foram resistentes à infecção por tospovírus. A comparação do espectro da resistência destas plantas com o observado para outras solanáceas , indica que as vias de sinalização e as respostas de defesa ativadas por Sw-5 estão conservadas nesta família, e que o polimorfismo genético nos componentes das vias de transdução de sinais pode resultar em diferentes níveis de resistência. A fim de identificar o gene de avirulência dos tospovírus, os genes N, NSm e NSs , foram expressos isoladamente ou em combinações, por meio do vetor viral PVX, em plantas com Sw-5. A expressão destes genes não foi capaz de desencadear a resposta de hipersensibilidade e tampouco interferiu na infecção da planta por PVX. Portanto, outro componente dos tospovírus deve ser responsável pelo desencadeamento da reação de resistência. Independentemente da presença do gene Sw-5, a expressão do gene NSs por meio do PVX , agravou os sintomas provocados por este vírus em algumas solanáceas, o que pode ter relação com a capacidade desta proteína de suprimir silenciamento gênico. Em plantas com Sw-5, a co-expressão da região 5' deste gene por meio do vetor PVX , favoreceu a infecção sistêmica por tospovírus. Uma vez que o efeito foi observado tanto para expressão senso quanto anti-senso, a redução dos níveis de mRNA de Sw-5 provocada por silenciamento gênico , poderia ser a causa desta interferência na resistência, embora a análise de Northern blot não tenha demonstrado tal redução. Uma seqüência homóloga a Sw-5 contendo uma ORF sem deleções ou interrupções prematuras foi clonada a partir do acesso LA371-20 de Lycopersicon peruvianum. Análises moleculares demonstraram que esta seqüência é originada do loco Sw-5 ou de região próxima a este e que segrega com a resistência a tospovírus. A capacidade deste e de outros três homólogos oriundos de distintos acessos de tomateiro de conferir resistência a tospovírus, foi avaliada em plantas transgênicas de tomateiro e tabaco. As plantas transformadas foram suscetíveis ao vírus. A não-funcionalidade destes homólogos pode ser devido à estrutura das construções utilizadas na transformação. Alternativamente, outros homólogos presentes nestes acessos de tomateiro podem ser os responsáveis pela resistência. / In this work some aspects of the tospovirus - Sw-5 interaction was analyzed. The capacity of the Sw-5 to confer resistance in Nicotiana benthamiana was evaluated in transgenic plants transformed with Sw-5 ORF containing its own 3 ́ UTR region under 35S promoter control. Transgenic plants were resistant to tospovirus infection. Comparisons of the resistance spectrum with other members of the Solanaceae suggest that the signal transduction pathways and resistance responses triggered by Sw-5 are conservated in solanaceae and that the genetic polymorphism in the signal transduction components may result in different resistance levels. The N, NSm and NSs genes isolated or in combination were expressed by PVX vector in plants harboring Sw-5 in order to detect the tospovirus avirulence gene. These genes were not able to trigger the hypersensitive response and to affect PVX infection in Sw-5 plants, which suggest that another tospovirus component is the elicitor of the resistance response. Independently of the Sw-5 gene, PVX clones harboring NSs gene induced more severe symptoms in some solanaceae plants. Gene silencing may be the cause of this symptoms. In transgenic plants harboring Sw-5 gene, the co-expression of the 5 ́ region of this gene by PVX favored tospovirus infection. As this effect was observed both for 5 ́ sense and anti- sense constructions it is possible that it has been caused by reduction on mRNA levels by gene silencing, although Northern blot analysis did not agree with this hypothesis. An Sw-5 homolog was cloned from LA371-20 accession. This homolog is localized in or near of Sw-5 locus and segregated with tospovirus resistance. The capacity of this and other three homologs originated from others accessions to confer tospovirus resistance was evaluated in tobacco and tomato transgenic plants. All the transformants were susceptible to the virus. Other homologs presents in the different accessions evaluated may be responsible for the resistance, although problems in the structure of the constructions can not be discarded. / Tese importada do Alexandria
|
8 |
Caracterização agronômica e molecular de linhagens de tomateiro resistentes a tospovírus / Agronomic and molecular characterization of advanced breeding tomato lines resistant to tospovirusBruna Fernanda Longatti 23 January 2017 (has links)
A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.
|
9 |
Caracterização agronômica e molecular de linhagens de tomateiro resistentes a tospovírus / Agronomic and molecular characterization of advanced breeding tomato lines resistant to tospovirusLongatti, Bruna Fernanda 23 January 2017 (has links)
A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.
|
10 |
Desarrollo de sondas acopladas a Quantum dots para analizar la localización subcelular del ARN genómico de VIH-1 mediante microscopía confocalLeyva Gutiérrez, Alejandra. January 2018 (has links)
Título de Ingeniería en Biotecnología Molecular / Los mecanismos involucrados en el control post-transcripcional del ciclo
replicativo del Virus de la Inmunodeficiencia Humana (VIH), específicamente los
eventos moleculares que permiten la interacción del ARN genómico (ARNg) viral
con la maquinaria celular para su transporte, traducción o empaque dentro de la
célula, aún no han sido completamente dilucidados. Actualmente existen diversas
técnicas para el estudio de la localización sub-celular de ARNg, entre las que
destaca RNA FISH (RNA Fluorescent in situ hybridization), método ampliamente
utilizado para el estudio de la localización y cambios temporales de ARN y
ribonucleoproteínas. Generalmente, en esta técnica se utilizan sondas acopladas
a fluoróforos orgánicos que hibridan a regiones específicas para las que han sido
diseñadas. No obstante, estas sondas presentan fotoblanqueamiento
significativo, y un espectro de emisión amplio (50-100 nm), lo que limita su uso.
Es por esto que surge la necesidad de recurrir a nuevas alternativas, tales como
sondas acopladas a Quantum dots (QDs), los cuales en contraste con fluoróforos
orgánicos poseen una vida fluorescente significativamente más larga, mayor
fotoestabilidad y un amplio espectro de absorción. Considerando lo anterior, en
el presente trabajo se propone la construcción de sondas específicas asociadas
a QDs compuestos de Cadmio-Telurio recubiertos por Glutatión (QDs CdTe-
GSH) que reconocen la región pBSK-GagPol como matriz para la transcripción
in vitro, obteniendo así fragmentos de ARN, los cuales fueron desfosforilados en
su extremo 5', para luego incorporarles en su lugar un fosfato γ unido a un grupo
sulfhidrilo (SH). De esta forma, los transcritos de ARN fueron capaces de unirse
a QDs CdTe-GSH a través de enlaces disulfuro. Generando así sondas de ARN
xiii
acoplada a QDs CdTe-GSH capaces de unirse al ARNg de VIH-1 en presencia
y ausencia de la proteína Rev,la cual actúa como un regulador clave en el control
post-transcripcional de la expresión génica viral, actuando principalmente en los
procesos de exportación nuclear y traducción. De manera que en estas
condiciones fue posible validar a través de experimentos de RNA FISH, el ingreso
citoplasmático y nuclear de la sonda de ARN acoplada a QDs CdTe-GSH,
además de una interacción específica con el ARN genómico de VIH-1. Este
hecho representa la prueba de concepto de que es posible generar una sonda
acoplada a QDs específica contra el ARN genómico de VIH-1, permitiendo el
estudio de la expresión génica del virus, lo que también abre nuevas posibilidades
para el estudio de VIH-2 u otros tipos de virus. / The mechanisms involved in the post-transcriptional control of the replicative
cycle of the Human Immudeficiency Virus (HIV), specifically the molecular events
allowing the interaction between the viral genomic RNA (gRNA) and the cellular
machinery for the transport, translation or packaging, have not been elucidated
yet. Currently, the study of localization and temporary changes of RNA and
ribonucleoproteins relies mainly on RNA FISH (RNA Fluorescent in situ
hybridization)-based strategies. RNA FISH uses specific hybridization probes
coupled to organic fluorophores. However, these fluorescent molecules
commonly present limiting characteristics such as significant photobleaching and
a wide emission spectrum (50-100 nm). Therefore, a considerable demand arises
for new alternatives, such as probed coupled to Quantum dots (QDs), which in
contrast to organic fluorophores, exhibit longer fluorescence lifetime, higher
photostability and broad absorption spectra. Considering previous facts, the aim
of this work was to develop specific probes coupled to glutathione-capped
cadmium-telluride quantum dots (QDs CdTe-GSH), able of recognizing and
associate with the Gag-Pol region present on the HIV-1 genomic RNA (gRNA).
Thus, in order to achieve this objective, the vector pBSK-GagPol was used as a
template for in vitro transcription of Gag-Pol complementary RNA, which was
fragmented and dephosphorylated at the 5' end, with the purpose to incorporate
a γ phosphate coupled to a sulfhydryl group (SH) instead. Then, the SH-containing
RNA fragments were attached to QDs CdTe-GSH by a disulfide bond. As a result,
we generated single-stranded RNA probes coupled to QDs CdTe-GSH capable
of hybridizing to HIV-1 gRNA in the presence and absence of the viral protein Rev,
which acts as a key regulator of the post-transcriptional control of viral gene
expression acting mainly during nuclear export and translation. Thereby, under
these conditions, we validated the cytoplasmic and nuclear entrance of the probe
coupled to Qds CdTe-GSH, and specific interaction between the probe and gRNA
of HIV-1. This fact represents the proof of concept that it is possible to generate
RNA probes coupled to QDs CdTe-GSH to study genetic expression of HIV-1,
and also opens up new opportunities for the study of HIV-2 or other virus types.
|
Page generated in 0.0523 seconds