No description available.

Mammalian genomes are characterised by global and pervasive DNA methylation and this modification is generally thought to be inhibitory to transcription. An exception to this widespread DNA modification are genomic elements called CpG islands (CGI), contiguous regions of non-methylated DNA which encompass the transcription start site of two thirds of mammalian genes. Although CGIs represent the most prominent feature of mammalian promoters, the contribution of these elements to promoter function remains unclear. Work in this study shows that the histone lysine demethylase KDM2B (FBXL10/ JHDM1B) is a nuclear protein which binds specifically to non-methylated CpG dinucleotides and associates with CGI elements genome-wide through its zinc-finger CxxC (ZF-CxxC) DNA binding domain. Furthermore, in mouse embryonic stem cells, biochemical investigation revealed that KDM2B associates with Polycomb group E3 ubiquitin ligase RING1B to form a variant Polycomb repressive complex 1 (PRC1) characterized by the PCGF1 subunit. Considering that KDM2B has clear DNA-binding activity and that CGIs were reported to function as nucleation sites for polycomb repressive complexes, a potential role for KDM2B in mediating PRC1 recruitment to target genes was investigated. Stable depletion studies indicated that KDM2B is required for the normal targeting of RING1B to CGIs and the regulation of expression of a subset of Polycomb-occupied genes. By taking advantage of a genetic ablation system in which the DNA binding domain of KDM2B can be conditionally deleted, results in this thesis reveal that the ability of KDM2B to recognize non-methylated DNA is essential for polycomb domain formation and normal embryonic development. Finally, through the use of a de novo targeting assay, an unexpected PRC2 recruitment pathway was discovered which is dependent on PRC1-mediated H2AK119ub1 deposition. Together this work uncovers a novel mechanism linking KDM2B-dependent recognition of non-methylated DNA with recruitment of Polycomb proteins and provides the framework on which to further investigate the contribution of CGIs to formation of polycomb domains.

The CCCTC-binding factor (CTCF) is a versatile, multifunctional zinc-finger protein involved in a broad spectrum of cellular functions. In mammalian cells, CTCF functions together with the Cohesin complex, an essential regulator of sister chromatid cohesion. Together, CTCF and Cohesin have been shown to regulate gene expression at a genome-wide level in mammalian cells. In the yeast Saccharomyces pombe, Cohesin has been implicated in transcription termination of convergently transcribed genes, in a cell cycle dependent manner. The aim of this thesis was to investigate the possibility of direct transcriptional involvement of CTCF and Cohesin in human cells. The first model system applied for this experimental purpose was the β-globin gene with introduced canonical CTCF-binding sites replacing the endogenous Co- Transcriptional Cleavage (CoTC) element downstream of β-globin. The results obtained indicate that recruitment of CTCF to the β-globin 3` flanking region does not prevent read-through transcription. However, CTCF-binding does mediate RNA Polymerase II (Pol II) pausing at the site of recruited CTCF. This results in more efficient pre-mRNA 3` end processing and therefore rescues β-globin mRNA to wild type levels. Cohesin was not detected at the introduced CTCF-binding sites. These results are a contribution to our understanding of the spatio-temporal requirements for cotranscriptional events like 3` end pre-mRNA processing and Pol II kinetics. The second part of my thesis presents an investigation on the involvement of CTCF and Cohesin in lipopolysaccharide (LPS)-induced Tumor Necrosis Factor α (TNFα) gene expression regulation in human monocytes and differentiated M1- and M2-type macrophages. These studies provide first evidence of Cohesin recruitment to the TNFα gene body and its regulatory NFκB-binding sites. Differences in the recruitment profiles obtained indicate potential regulatory differences of TNFα among the three cell types. Preliminary data provide an insight into the effects on TNFα mRNA levels upon down-regulation of Cohesin subunits.

The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)

Mycobacterium tuberculosis has one ribosomal RNA operon. The survival of this bacillus thus depends on a transcription mechanism that can effectively couple gene expression to changes in the environment. σ factors are transcription proteins that bind to the RNA polymerase (RNAP) and dictate gene expression. Extra Cytoplasmic Function σ factors (ECF) are a subset of σ factors that coordinate environment-induced changes in transcription. The environment specific binding of ECF σ factors to the RNAP presents an effective mechanism for the bacillus to modulate gene expression. ECF σ factors, in turn, are regulated by their interaction with an anti-σ factor. The active σ factor is released from this complex upon specific cellular or environmental stimuli. The aim of this study was to understand the structural and mechanistic aspects of σ factor activation. Towards this goal, two ECF σ factors, σC and σL, were examined. Structural and biophysical studies on M. tuberculosis σC provided a novel insight into ECF σ factor regulation. Inter-domain interactions in σC were sufficient to occlude the DNA recognition regions even in the absence of an interacting protein. The structure of M. tuberculosis σL in complex with the anti-σ factor RslA provides a structural basis to rationalize the release of active σL under oxidative stress. The other chapters of this thesis include a description of the structure and biochemical features of a hypothetical protein Rv2704 that is co-transcribed with the primary σ factor σA. In an effort to understand the collaboration-competition-redundancy model of prokaryotic σ factors, we performed a computational analysis of this system compiling experimental data from the E. coli and B. subtilis model systems. These results are also presented in this thesis. Put together, the structural and biochemical characteristics of the σ factors presented in this thesis suggest substantial variations in the regulatory mechanisms of the M. tuberculosis σ factors when compared to the canonical E. coli or B. subtilis model systems. This thesis is organized as follows: Chapter 1: The introductory chapter of this thesis is organized to frame the pertinent mechanistic issues involved in the σ factor-regulatory protein interactions in the context of the underlying biology of M. tuberculosis. The first part of this chapter provides an overview of σ factors and a summary of the classification of these proteins and their roles in different prokaryotes. The latter part of this chapter is a summary of the pathogen M. tuberculosis in terms of its genetic composition, gene expression as well as aspects of virulence and pathogenecity. Chapter 2: This chapter describes the characterization of the ECF σ factor, σC. Here we report the structure of an ECF σ factor σC from M. tuberculosis. σC is essential for the lethality of M. tuberculosis in a mouse model of infection. Our studies suggest that M. tuberculosis σC differs from the canonical ECF σ factors as it has an N-terminal domain comprising of 126 amino acids that precedes the σC2 and σC4 domains. In an effort to understand the regulatory mechanism of this protein, the crystal structures of the σC2 and C4 domains of σC were determined. These promoter recognition domains are structurally similar to the corresponding domains of E. coli σA despite the low sequence similarity. Fluorescence experiments using the intrinsic tryptophan residues of σC2 as well as surface plasmon resonance measurements reveal that the σC2 and σC4 domains interact with each other. Mutational analysis suggests that the Pribnow box-binding region of σC2 is involved in this inter-domain interaction. Interactions between the promoter recognition domains in M. tuberculosis σC are thus likely to regulate the activity of this protein even in the absence of an anti-σ factor. Chapter 3 provides an account of the regulatory features of the ECF σ factor, σL. ECF σ factors are often regulated by their interactions with an anti-σ factor that can sense diverse environmental stimuli. Transcriptional responses to changes in the oxidation state are particularly important for M. tuberculosis as it adapts to the environment of the host alveoli and macrophages. Here we demonstrate that the protein RslA binds Zinc and can sequester σL in a reducing environment. Our data suggests that the cytosolic domain at the N-terminus of RslA alone is involved in binding σL. Under oxidizing conditions, the σL/RslA complex undergoes substantial conformational rearrangements that coincide with the release of the Zinc cofactor. In the absence of Zinc, the affinity of RslA for σL reduces by ca 8 fold compared to the holo form. The CXXC motif of RslA acts as a redox sensor. In response to oxidative stimuli, the proximal cysteines in this motif can form a disulfide bond with the release of the bound Zn2+ ion. This observation could be rationalized based on the crystal structure of the σL4/RslA complex. Put together, RslA is a distinct variant of the Zinc binding anti-σ factor (ZAS) family. The structural and biophysical parameters that control σL/RslA interactions demonstrate how variations in the rate of Zinc release and associated conformational changes in RslA could regulate the release of free σL in a measured response to oxidative stress. Chapter 4 is based on the biochemical and structural characterization of a hypothetical protein Rv2704. The gene for M. tuberculosis Rv2704 is located in the same operon as the principal σ factor σA. The biochemical and structural features of Rv2704 were thus examined to identify its role, if any, in the regulation of σA. This protein is a trimer in solution and adopts a chorismate mutase-like fold. The crystal structure reveals that Rv2704 is a member of the functionally diverse YjgF family of proteins. The important structural differences between Rv2704 and other YjgF proteins lie in the arrangement of secondary structural elements and the putative functional clefts between the subunit interface. Although Rv2704 does not interact with σA in vitro, the structural similarities to the YjgF family suggests that this protein could interact with a variety of metabolites, potentially influencing its function. Chapter 5 of this thesis is based on a computational analysis of σ factors. Four conformational segments of σ factors, referred to as σ1, σ2, σ3 and σ4 interact with specific regions of promoter DNA. ECF σ factors are a subset of σ factors that coordinate environment-induced transcription. ECF σ factors are minimalist σ factors with two DNA binding domains viz., σ2 and σ4 that recognize the –10 and –35 promoter elements and are unable to interact with either upstream-activating regions or the extended –10 element of the promoter. There are several ECF σ factors in a typical bacterium often characterized by substantial overlap in function. Here we present an analysis of B. subtilis ECF σ factors and their cognate promoters to understand functional overlap and redundancy in this class of proteins. As expected, conserved bases in the –10 element appear more critical for promoter selectivity than the –35 element. However, we note distinct conformational features in the –35 promoter interaction with the helix-turn-helix (HTH) motif when compared to a data-set of known HTH-DNA complexes. Furthermore, we note differences in –35 element interaction between σ factors that act alone and those that overlap in function. The σ factor promoter interactions were then examined vis-à-vis the estimated cellular concentration of these proteins and their affinity to bind the core RNAP. Put together, this analysis suggests that while the cellular protein concentration dictates the choice of an ECF σ factor to form a complex with the RNAP, conformational features of the –35 element serve to select potential collaborative members, a subset of which eventually initiate transcription. Collaborative arrangements and functional redundancy in ECF σ factors are thus possible within the limits placed by these two parameters. Chapter 6 is a summary of the work reported in this thesis and the conclusions that can be drawn based on these studies. The appendix section of this thesis comprises of technical details that were not included in the main text of this thesis. Appendix I describes the initial characterization of the M. tuberculosis σD/anti-σD complex. Appendix II provides the experimental protocols as well as some of the supplementary data to the work reported in Chapters 2-5 of this thesis.