• Refine Query
  • Source
  • Publication year
  • to
  • Language
  • 1
  • Tagged with
  • 1
  • 1
  • 1
  • About
  • The Global ETD Search service is a free service for researchers to find electronic theses and dissertations. This service is provided by the Networked Digital Library of Theses and Dissertations.
    Our metadata is collected from universities around the world. If you manage a university/consortium/country archive and want to be added, details can be found on the NDLTD website.
1

Determinación del sexo en guacamayos de las especies Ara ararauna, Ara macao, Ara chloropthera, Ara militaris, Propyrrhura couloni mediante el uso del ADN

Liza Rodríguez, Jacqueline Susann January 2006 (has links)
Con la finalidad de estandarizar una prueba para la determinación del sexo en guacamayos se procedió a extraer de 25 – 50 ng. de ADN genómico de sangre de 31 aves previamente sexadas, pertenecientes a 5 especies de guacamayos (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris y Propyrrhura couloni) provenientes del Patronato del Parque de Las Leyendas (PATPAL) y de un zoocriadero privado, mediante un kit de extracción de ADN (Wizard ® Promega). El método empleado fue la técnica del PCR la cual amplificó un fragmento del gen CHD del cromosoma W presente solo en aves hembras (CHD-W), utilizando a los cebadores P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) y P8 (5´- CTCCCAAGGATGAGRAAAYTG – 3´ R igual A / G, Y igual T / C) capaces de amplificar regiones no conservadas (intrones) de este gen, lo cual lo diferencia de su gen homólogo presente en los machos (CHD-Z). La amplificación se llevó a cabo tras la optimización de las condiciones y los ciclos termales, partiendo de las condiciones descritas por Griffiths et al., (1998). Los productos obtenidos fueron separados en gel de agarosa al 3% (Promega) utilizando un sistema de electroforesis horizontal (Hybaid) y visualizados mediante fluorescencia con bromuro de etidio a través de la luz ultravioleta, con lo cual se pudo observar 2 fragmentos en aves hembras y 1 fragmento en aves machos, estos fragmentos estuvieron comprendidos entre 300 - 400 bps. En este grupo se logró sexar a las 31(100%) aves y se obtuvo un 100% de compatibilidad entre los resultados obtenidos por métodos convencionales y por análisis de ADN. Posteriormente se procedió a sexar 28 guacamayos sin sexo conocido, bajo las condiciones anteriormente descritas, lográndose determinar el sexo de estas. Palabras Claves: gen CHD; Cebadores P2 y P8; Guacamayos; Sexo. / With the purpose of standardizing a test for the determination of the sex in macaws we proceeded to extract of 25-50 ng. of genomic DNA from the blood of 31 birds previously sexed, belonging to 5 species of macaws (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris and Propyrrhura couloni) coming from the Patronato del Parque de Las Leyendas Zoo and a private center, using an extraction kit of DNA (Wizard ® Promega). The used method was the technique of the PCR which amplified a fragment of the CHD gene of the female exclusive chromosome W (CHD-W), using the P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) and P8 (5´- CTCCCAAGGATGAGRAAAYTG-3´ R same A / G, Y same T / C) primers, which are able to amplify not conserved regions (introns) of this gene. This differentiates it of its male homologous gene (CHD-Z). The amplification was carried by the optimization of the conditions and the thermal cycles. It was based on the conditions described by Griffiths et al. (1998). The obtained products were separated in agarosa gel to 3% (Promega) using a horizontal electrophoresis system (Hybaid) and visualized by fluorescence with etidio bromide through the ultraviolet light. Then we can see 2 fragments in female birds and only one in male birds, these fragments were between 300 - 400 bps. In this group 31(100 %) birds were sexing and we obtain 100% of compatibility between the conventional methods and DNA analysis. Finally, with the conditions previously described we sex 28 macaws with unkowned sex Key Words: CHD gene; P2 and P8 Primers; Macaws; Sex.

Page generated in 1.4962 seconds