[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,¹5N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.
Identifer | oai:union.ndltd.org:ADTP/221300 |
Date | January 2006 |
Creators | Thomas, Donald S |
Publisher | University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences |
Source Sets | Australiasian Digital Theses Program |
Language | English |
Detected Language | English |
Rights | Copyright Donald S. Thomas, http://www.itpo.uwa.edu.au/UWA-Computer-And-Software-Use-Regulations.html |
Page generated in 0.0023 seconds