A major challenge of platinum anticancer therapy lies in overcoming the severe side-effects associated with treatment. Photoactivatable PtIV azido complexes, which are stable in the dark and reduced to cytotoxic PtII species upon irradiation, have recently emerged as a potential site-specific treatment. This thesis is concerned with the investigation of PtII and PtIV azido complexes as potential cytotoxic and photochemotherapeutic agents. PtII azido complexes such as [Pt(en)(N3)2] were shown to bind to both 5'-guanosine monophosphate (5'-GMP) and glutathione, at a much reduced rate compared with their PtII chlorido analogues. Interestingly, and unexpectedly, these PtII azido complexes showed moderate cytotoxicity towards the A2780 cancer cell line (IC50 21–47 μM). Binding to 5'-GMP was observed to occur more rapidly upon irradiation with UVA light, although the extent of binding was low and the complexes did not demonstrate phototoxicity towards HaCaT keratinocytes. The pendant hydroxyl group of a PtII azido complex was functionalised with a fluorescent probe; conjugation to one axial hydroxyl ligand of a PtIV azido complex was also achieved. The latter conjugate showed a rapid increase in fluorescence intensity upon irradiation, resulting from loss of the axial ligands upon photoreduction. The functionalisation of quantum dots with PtII complexes was also investigated. Water soluble CdSe-ZnS quantum dots were synthesised and derivatised with an amine ligand to which platinum was bound. Conjugation of apo-transferrin to quantum dots was also achieved, with subsequent platinum binding yielding a conjugate with improved aqueous solubility and fluorescence properties. However, the conjugate was inactive towards the A2780 cancer cell line, likely due to surface modifications preventing cellular internalisation. PtII chlorido and azido conjugates with a porphyrin were synthesised and found to show differing behaviour upon irradiation with visible light; evidence of hydrogen peroxide generation from the chlorido complex was much reduced in the case of the azido complex; it is suggested this may result from quenching of reactive oxygen species by the azide anion released upon irradiation. PtII chlorido and azido complexes of highly coloured azo ligands were synthesised in an attempt to shift the wavelength of activation into the visible region. TD-DFT calculations allowed frontier orbital analysis and assignment of the transitions in the absorption spectra. Irradiation of the PtII azido complexes with UVA or broadband visible light led to their decomposition; one water-soluble complex was found to show moderate cytotoxicity and phototoxicity; in addition, its intense blue colour allowed for visual monitoring of this complex inside cells.

Cis-diamminedichloroplatinum (II), or cisplatin, is a widely prescribed anticancer compound, currently one of only three platinum (II) complexes FDA approved for cancer treatment. Despite its widespread use, we lack a comprehensive picture of global drug targets, which would lend valuable insights into the molecular mechanisms of action and resistance in different tissues. Drug binding to genomic DNA is an accepted cause of downstream apoptotic signaling, but less than 10% of Pt (in the case of cisplatin) accumulates within genomic DNA. Non-genomic contributions to cisplatin's therapeutic action are also under active investigation. In particular, cisplatin treatment can disrupt RNA-based processes such as splicing and translation. Pt(II) targeting of non-DNA species such as RNA may contribute to or sensitize a cell to the downstream effects of this drug, including the induction of apoptosis. Chapter I summarizes the activity profile of Pt(II) therapeutics, describing cellular uptake, cellular localization, incidences of Pt(II) accumulation within RNA, and RNA processes affected following drug treatment. Chapter II reports our thorough investigation of the distribution of Pt species throughout messenger and ribosomal RNA, with the discovery that Saccharomyces cerevisiae ribosomes act as a de facto cellular Pt sponge. In Chapter III, we report the synthesis of an azide-functionalized platinum (II) species, picazoplatin, for post-treatment click labeling and isolation of drug targets in vivo. Picazoplatin was designed to circumvent mislocalization and misprocessing of Pt typically encountered when trying to track small molecules tethered to large, charged fluorophores. This chapter contains several proof-of-principle studies validating the use of this class of reagents for future purification and sequencing of Pt-bound nucleic acids. Chapter IV describes the first application of the click-capable Pt reagent technology: the demonstration of significant in-gel fluorescent detection of Pt-bound ribosomal RNA and transfer RNA extracted from picazoplatin-treated S. cerevisiae and the first evidence that cellular tRNA is a platinum substrate. Chapter V summarizes these data, which suggest a potential ribotoxic mechanism for cisplatin cytotoxicity and broadly describe a convenient click chemistry methodology that can be applied to identify other metal or covalent modification-based drug targets. This dissertation includes previously published and unpublished co-authored material.

Since the discovery of anti-tumor activity of cisplatin in 1960, significant progress has been made in treating metastatic or advanced cancer with cisplatin and platinum compounds. Platinum compounds covalently bind to DNA and disrupt DNA function. They are also known to bind with amino acids like methionine, histidine and cysteine to form cisplatin-protein adducts which are responsible for most of its cytotoxicity and side effects. Recent articles on cisplatin-protein have shown that adding bulky adjuncts to cisplatin or using different platinum compounds varies the degree and extent of reaction thus possibly reducing cisplatin resistance and side effects. One of the proteins to study is cytochrome C, which is an intermediate in apoptosis (a controlled form of cell death used to kill cells in the process of development or in response to infection or DNA damage). Cytochrome C activates caspase 9, a cysteine protease, which in turn goes on to activate caspases 3 and 7, which are responsible for destroying the cell from within. In this study, we tried to examine how various platinum compounds like cis-Pt(NH3)2Cl2, cis-Pt(NH3)2(NO3)2, Pt(en)(NO3)2, Pt(Me4en)(NO3)2, Pt(NH3)2 (oxalate), Pt(en)(oxalate),Pt(Me4en)(oxalate), which have different ligands/bulk, react with cytochrome C in different physiological conditions. This research project subsequently focused on three main aspects: 1) to determine whether the concentration of platinum compounds made a difference in the reaction rate, 2) to determine whether the pH of the buffer shows any difference in the reaction rate, 3) to determine how the ligands coordinated to the platinum affected the rate. We used 1) HPLC with vitamin B12 (cyanocobalamin) as an internal standard. 2) Separate samples of platinum compounds with bovine serum albumin were then subjected to dialysis and were then sent to the Materials Characterization Center for analysis by ICP-AES spectroscopy. In summary, the following conclusions are stated: •The leaving group, pH, bulk and the concentration play a very vital role in determining the reaction rate for platinum-cytochrome C interactions. •Chlorides form excellent leaving groups followed by oxalates then nitrates. •Pt(en) reacts faster than Pt(NH3)2 which reacts faster than Pt(Me4en). •Nitrates, Pt(en) and few oxalate form multiple products showing non-specific binding. Only cis-Pt(NH3)2Cl2 and Pt(Me4en)(oxalate) formed predominately a single product showing target specific binding. •cis-Pt(NH3)2Cl2 showed an increased reaction rate at lower pH while cis-Pt(NH3)2(NO3)2 and Pt(Me4en)(NO3)2 showed higher reactions at higher pH. •Despite platinum compound was present in significant molar excess relative to cytochrome C, at the end of 21 hrs there was a significant amount of unreacted cytochrome C left except in case of cis-Pt(en)Cl2 which reacted with the whole cytochrome C in less than ten minutes. •We saw the rate of reaction in order of cis-Pt(en)Cl2 > Pt(en)(oxalate) > cis-Pt(NH3)2Cl2 > Pt(en)(NO3)2 > cis-Pt(NH3)2(NO3)2 > cis-Pt(NH3)2(oxalate) > Pt(Me4en)(oxalate) > Pt(Me4en)(NO3)2

[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,&sup15N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.

Development of Non-Traditional Platinum Anticancer Agents: trans-Platinum Planar Amine Compounds and Polynuclear Platinum Compounds By Daniel E. Lee, Ph.D. A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy at Virginia Commonwealth University. Virginia Commonwealth University, 2015 Major Director: Nicholas P Farrell, Ph.D., Professor, Department of Chemistry Platinum anticancer compounds with cis geometry, similar to cisplatin, have been explored to circumvent the cisplatin resistance; however, they were not considered broadly active in cisplatin cells due to exhibiting similar or same cell death mechanism as cisplatin. Platinum compounds with trans geometry were less studied due to transplatin being clinically inactive; but with few structural modifications, they resulted in unaffected cytotoxic activities in cisplatin resistant cells with structural modification by exhibiting different modes of DNA binding. This research focused on further exploring and establishing structure-activity relationship of two promising non-classical series of platinum compounds with trans-geometry: trans-platinum planar amine (TPA) compounds and noncovalently binding polynuclear platinum compounds (PPC-NC). During this research, further optimizations of the reactivity of TPA compounds were accomplished by modifying the leaving carboxylate groups. The effects of modified reactivity were probed by a systematic combination of chemical and biophysical assays, followed by evaluating their biological effects in cells. To establish the structural-activity relationship of PPC-NCs, Mono-, Di-, Tri-, and Tetraplatin NC with charge of 4+, 6+, 8+, and 10+ were synthesized and evaluated by utilizing biophysical and biological assays. Lastly, a new class of polynuclear platinum compounds, Hybrid-PPCs, were synthesized and evaluated to overcome the pharmacokinetic problems of BBR3464, phase II clinical trial anticancer drug developed previously in our laboratory.