published_or_final_version / abstract / toc / Molecular Biology / Doctoral / Doctor of Philosophy

Cytotoxic chemotherapy is extremely important in adjuvant treatment of breast cancer. Yet, tumours frequently acquire chemoresistance that correlates with increased aggressiveness and poor prognosis. Three theories exist describing how the resistance develops: genetic, epigenetic and karyotypic theory. The epigenetic theory is the least explored. Here we analyzed the role of the epigenetic phenomena in the acquisition of drug resistance. To do so, we employed genome wide screens of microRNA and gene expression, DNA methylation and complete genome hybridization. We identified three novel microRNA interactions involved in the chemoresistant phenotype. These three microRNAs displayed depressed expression in the resistant cell lines and we were able to re-establish some level of drug sensitivity through ectopic expression of these under expressed microRNAs. In addition, we described the role of DNA methylation in impacting expression of a wide range of genes, thus, contributing to the phenotype of chemoresistance. Furthermore, we revealed a distorted global DNA methylation pattern that coincides with massive instability of the resistant genome. Finally, our results present a striking similarity between gene expression, epigenetic profiles and chromosomal aberrations in two different drug resistant cell lines. Taken together, this project suggests that the acquisition of chemoresistant phenotype is epigenetic in nature and may arise with a predictable pattern. Elucidating the specifics of this pattern may in the future prove useful in developing treatment and prognostic chemoresistance biomarkers. / xiii, 116 leaves : ill. (some col.) ; 29 cm

Since the discovery of cisplatin as an anti-cancer agent, there has been a broad and multidisciplinary interest over four decades in the development of metal complexes as metallotherapeutic drugs. The principal objective of this thesis was to develop and characterize a novel library of gold(III) complexes of aromatic and non-aromatic quinoline- and pyridine-amido ligands and to test their efficacy as cytotoxic agents against multiple human cancer cell lines. To this end, fifteen novel (16 in total) gold(III) complexes have been prepared and studied by multiple methods including FTIR, NMR, MS, and UV-visible spectroscopy, and in numerous cases, single crystal X-ray diffraction. Ligands H2L1–HL14 were prepared via the reaction of the relevant pyridine or quinoline carboxylic acid in the presence of triphenylphosphite and either picolylamine or 8-aminoquinoline in pyridine, in moderate to good yields. Ligands HL15 and HL16 were prepared via the reaction between benzoyl or 1-naphthoyl chloride and 8-aminoquinoline in good yields. The synthesis of complexes [Au(HL1)Cl2]–[Au(L4)Cl2] were prepared by the reaction between the respective ligand, K[AuCl4] and NaOAc in 1:1 MeOH:DCM. Metal complexes [Au(L5)Cl](PF6)–[Au(L14)Cl](PF6) were synthesised by encouraging the formation of a AuCl4- counter ion in acetic acid and 3-fold excess of NaHCO3. Subsequent metathesis afforded the desired PF6- anion. Complexes [Au(L15)Cl] and [Au(L16)Cl] were synthesised by the reaction of H[AuCl4] and respective ligand in acetic acid and a 3-fold excess of NaHCO3. The solubility of all complexes was assessed, with complexes [Au(L8)Cl](PF6)–[Au(L14)Cl](PF6) proving to be the most stable in biologically relevant media (TBS 50 mM, NaCl 10mM, pH 7.34, 37°C). Complex [Au(L12)Cl](PF6) was further evaluated for its stability in the presence of glutathione and imidazole and found to be sensitive to reduction by thiols, but substitution-inert to N-donor heterocycles such as imidazole. The DNA binding constants of [Au(L8)Cl](PF6)–[Au(L11)Cl](PF6) were subsequently evaluated by UV-vis spectroscopy and found to be in the range of 2.7(5) x 105 to 4.7(6) x 105 M-1. Complexes [Au(L12)Cl](PF6)–[Au(L14)Cl](PF6) were similarly assessed using ethidium bromide displacement fluorescence assays, however their ability to bind DNA could not be conclusively proven. The log Po/w values of complexes [Au(L12)Cl](PF6)–[Au(L14)Cl](PF6) were measured and spanned the range -0.8 to -2.16, consistent with significant hydrophilic character. The solid state structures of all complexes, with the exception of [Au(L10)Cl](PF6), [Au(L14)Cl](PF6) and [Au(L16)Cl](PF6), were determined by X-ray crystallography with the gold(III) ion co-ordinated to the ligand in a square planar geometry. The co-ordination mode in complexes Au(HL1)Cl2]–[Au(HL3)Cl2] was unexpected with the metal centre only co-ordinating to half the tetradentate ligand with a pair of cis-dichloro ions completing the square planar geometry. The average Au–Npy/qu distance is 2.02(2) Å while the average Au–Namide distance is 1.97(4) Å. In all complexes the trans labilising effect of the anionic amide nitrogen was observed through a structural elongation of the respective Au–Cl bond length. Almost all complexes studied exhibited π-stacking interactions, with compound [Au(L12)Cl](PF6) exhibiting a mean plane separation between rings of 3.307 Å. This is a result of the extended aromatic rings present in all compounds DFT geometry optimizations, frequency, NMR, and energy calculations were carried out on all the gold(III) complexes at the HSEH1PBE/6-311G(d,p)/LanL2DZ level of theory. The 6-311G(d,p) basis set was used for all atoms with the exception of the gold atom for which the LanL2DZ basis set was used. In general, the chosen level of theory satisfactorily correlates with the experimental data for all complexes and was instrumental in deconvoluting the UV-vis spectra of all complexes. The lowest energy transitions (300–500 nm) were assigned to a LMCT while the higher energy transitions were assigned to π-π* transitions. The cytotoxicity profiles of all compounds, with the exception of [Au(HL1)Cl2] and [Au(L16)Cl], were evaluated through one-dose screens against the 60 human cancer cell lines at the NCI, where [Au(HL3)Cl2], [Au(L6)Cl](PF6)–[Au(L8)Cl](PF6), [Au(L10)Cl](PF6)–[Au(L13)Cl](PF6) and [Au(L15)Cl](PF6) were deemed sufficiently cytotoxic to proceed further to five-dose screening. The cytotoxicity results for compound [Au(L12)Cl](PF6) were most encouraging with GI50, TGI and LC50 values of 0.11(0.1), 0.70(0.7) and 26.5(1.5) μM, respectively, against the breast cancer cell line MDA-MB-468. Statistical analysis of the GI50 values for complexes [Au(HL3)Cl2] and [Au(L12)Cl](PF6) revealed they may exert their cytotoxicity through the inhibition/poisoning of topoisomerase II and I enzymes, respectively. Both compounds were assessed for this through a topoisomerase IB DNA unwinding assay and a topoisomerase IIα decatenation assay. [Au(HL3)Cl2] was found to be a dual catalytic inhibitor and poison of topoisomerase IIα between concentrations of 500 nM and 50 μM while [Au(L12)Cl](PF6) was found to be a dual catalytic inhibitor and poison of topoisomerase IB between concentrations of 1 and 100 μM. Electrophoretic mobility shift assays were performed on both complexes, with [Au(HL3)Cl2] indicating DNA binding at a concentration of 50 μM, while [Au(L12)Cl](PF6) displayed no evidence for DNA binding despite an unexpected increase in mobility shift of the substrate DNA. This is indicative of an alternative mechanism of DNA interaction such as electrostatic binding. In summary, we present in this thesis, the discovery, synthesis and application of a novel series of gold(III) amide-based metal complexes as anti-cancer agents with the mechanism of action by which the complexes exert their cytotoxic activity being elucidated. The compounds show immense potential in the metallo-drug discovery field of research, and with further development, a leading class of metallotherapeutic drugs may be developed from this research. / Thesis (Ph.D.)-University of KwaZulu-Natal, Pietermaritzburg, 2012.

Thesis (Ph.D.)-University of KwaZulu-Natal, Pietermaritzburg, 2013.

Research on the putative health benefits has indicated that kefir, a traditional fermented milk, might have antimutagenic and antitumor properties. The major objective of the present thesis was to isolate and identify antitumor compounds in cow's milk kefir and investigate the possible mechanisms involved. High speed centrifugation (HSC), molecular weight cut-off filtration (MWCO), size exclusion high performance liquid chromatography (SEC-HPLC) and reverse phase-HPLC (RP-HPLC) were utilized for fractionation of kefir and a cell culture model was developed to screen for the antiproliferative effects of the kefir fractions. The antiproliferative effects of bacteria-free extracts from different fermentation stages of kefir production, as well as bacteria-free extracts from milk and yogurt were compared. The results showed that extracts from an early stage of fermentation (i.e., kefir mother culture) and the final commercial kefir product both exerted dose-dependent inhibition effects on human mammary tumor MCF-7 cells, yogurt extracts showed less potent antiproliferative effects, while pasteurized milk extracts showed no antiproliferative effects. No antiproliferative effects of the kefir extracts were observed on human mammary epithelial cells (HMEC) whereas the yogurt extracts showed antiproliferative action in HMEC cells at a high dose. A fraction of the kefir mother culture isolated by HSC, MWCO and RP-HPLC contained components that inhibited MCF-7 cell growth and had no effect on HMEC cells. Characterization of the bioactive fraction using mass spectrometry (MS) indicated that the main components in the fraction are likely fragments of kefiran and/or ceramide containing compounds such as gangliosides. The growth inhibitory effect may be mainly caused by the induction of TNF-alpha in MCF-7 cells. Whole extracts of kefir depleted glutathione (GSH) in MCF-7 cells, while the SEC-HPLC Fraction 7 and the RP-HPLC Fraction 30 induced GSH produc

The use of metallo-pharmaceuticals, such as the platinum drugs, for cancer treatment illustrates the utility of metal complexes as therapeutic agents. Platinum group metal complexes therefore offer potential as anti-tumour agents to fight cancer. This study was aimed at synthesizing and evaluating the effects of palladium(II) and platinum(II) complexes as anticancer agents.

[Truncated abstract] The Phase II clinical candidate, [(trans-Pt(NH3)2Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) shows a unique binding profile when compared to the anticancer agent cis-[Pt(NH3)2Cl2] (cisplatin) and dinuclear platinum complexes of the general formula [(trans-Pt(NH3)2Cl)2(H2N(CH2)nNH2)]2+. There is evidence that the increased efficacy of 1,0,1/t,t,t results from the presence of the charged central linker, which can alter the mode of binding to DNA. This alternate binding mode may be due to an electrostatic and hydrogen bonding association of the central platinum moiety in the minor groove that occurs prior to covalent binding (termed “pre-association”) . . . This research shows that 0,0,0/t,t,t is an adequate model to study the pre-association process of 1,0,1/t,t,t and that it binds in the minor groove of DNA. Therefore it is likely that 1,0,1/t,t,t pre-associates in the minor groove of DNA prior to covalent binding. This work supports the conclusions reached in NMR studies of the binding of 1,0,1/t,t,t with the 1,4-GG sequence (Qu et al. JBIC. 8, 19-28 (2003)), which showed simultaneous binding in the major and minor groove. The findings of the current work may also explain the observed binding mode of 1,0,1/t,t,t, which can bind to DNA in both the 3',3' and 5',5' directions (Kasparkova et al. JBC. 277, 48076-48086 (2002)). These unique binding characteristics are thought to be responsible for the increased efficacy of 1,0,1/t,t,t, and in light of the current results the observed binding mode most likely stems from the electrostatic pre-association of the central platinum moiety.

[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,&sup15N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.

Thesis (M.S.)--University of Texas at El Paso, 2007. / Title from title screen. Vita. CD-ROM. Includes bibliographical references. Also available online.

Diss. (sammanfattning) Stockholm : Karolinska institutet, 2007. / Härtill 4 uppsatser.