The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)

Research efforts to determine the causes, effects and locations of mutations within the human genome have been widely pursued due to their role in the development of various diseases. The main cause of mutations in vivo is oxidative damage to DNA via oxidants and free radical species. Numerous studies have been performed in vitro to determine how oxidative damage is induced in DNA. Most of these in vitro studies require photosensitizers to initiate the oxidative damage through various mechanisms. For the purposes of this research, all the photosensitizers that were used initiated oxidative damage in DNA through the electron transfer mechanism. In the charge transport studies, an anthraquinone photosensitizer was covalently linked to the 5 end of DNA by a short carbon tether in order to determine the pattern of damage induced along the length of the DNA. Anthraquinone preferentially damages guanine bases. Our first work sought to determine the effects of charge transport through guanine rich quadruplex DNA dimers. The dimers were formed by the combination of two hairpins with duplex overhangs extending beyond the quadruplex region. This enabled the optimal comparison of the effects of charge transport between duplex and quadruplex DNA structures. Another area of research we pursued in this area was to determine the effects of charge transport in M-DNA (a novel DNA conformation that was reported to form in the presence of zinc ions at a pH above 8). Earlier work on M-DNA suggested that it behaved like a molecular wire. Our research attempted to determine the effects of charge transport on this structure in order to show the behavior of a DNA molecular wire as compared to the standard studies performed in this area on normal B-DNA structures. Lastly, in collaboration with Dr. Ramaiah and colleagues we designed some viologen linked acridine photosensitizers which were tested for any ability to cleave GGG bulges. In preliminary studies, these viologen linked acridine derivatives showed preferential cleavage for guanine bases. They were not covalently bound to DNA, although they could potentially form non covalent interactions with DNA such as intercalation and/or groove binding. Our overall research goal was to determine the extent and overall effect of oxidative damage (using different photosensitizers) on the various DNA structures mentioned above.

The thesis entitled “New DNA-Targeting Small Molecules as Potential Anticancer Agents and for in vivo Specificity toward Enhanced Silk Production” encompasses design, computational calculations, and syntheses of diverse small molecular scaffolds to explicitly target duplex and higher order DNA morphologies (G-quadruplex DNA). Some of these molecules have a potential as anticancer agents. Besides, an attempt has been made elucidate the importance of novel oligopyrrole carboxamides in the enhancement of silk yield, hence proving to a boon in the field of sericulture. The work has been divided into six chapters. Chapter 1. DNA Binding Small Molecules as Anticancer Agents Figure 1. DNA targeting by small molecules. Cancer has always been a dreadful disease and continues to attract extensive research investigations. Various targets have been identified to restrain cancer. Among these DNA happens to be the most explored one. A wide variety of small molecules, often referred to as “ligands”, has been synthesized to target numerous structural features of DNA (Figure 1). The sole purpose of such molecular design has been to interfere with the transcriptional machinery in order to drive the cancer cell toward apoptosis. The mode of action of the DNA targeting ligands focuses either on the sequence-specificity by groove binding and strand cleavage, or by identifying the morphologically distinct higher order structures like that of the G-quadruplex DNA. Chapter 2. Ligand 5, 10, 15, 20-tetra(N-methyl-4-pyridyl)porphine (TMPyP4) Prefers the Parallel Propeller-type Human G-Quadruplex DNA over its other Polymorphs The binding of ligand 5, 10, 15, 20-tetra(N-methyl-4-pyridyl)porphine (TMPyP4) with telomeric and genomic G-quadruplex DNA has been extensively studied. However, a comparative study of interactions of TMPyP4 with different conformations of human telomeric G-quadruplex DNA, namely parallel propeller-type (PP), antiparallel basket-type (AB), and mixed hybrid-type (MH) G-quadruplex DNA has not been done. We considered all the possible binding sites in each of the G-quadruplex DNA structures and docked TMPyP4 to each one of them. The resultant most potent sites for binding were analyzed from the mean binding free energy of the complexes. Molecular dynamics simulations were then carried out and analysis of the binding free energy of the TMPyP4-G-quadruplex complex showed that the binding of TMPyP4 with parallel propeller-type G-quadruplex DNA is preferred over the other two G-quadruplex DNA conformations. The results obtained from the change in solvent excluded surface area (SESA) and solvent accessible surface area (SASA) also support the more pronounced binding of the ligand with the parallel propeller-type G-quadruplex DNA (Figure 2). Figure 2. Ligand TMPyP4 prefers parallel propeller-type G-quadruplex DNA morphology. Chapter 3. A Theoretical Analysis on the Selective Stabilization of Intermolecular G-quadruplex RNA with a bis-Benzimidazole Ligand EtBzEt over TMPyP4 in K+ Environment Ever since the discovery of G-quadruplex RNA, a constant urge exists to target these higher order RNA conformations. These structures play a significant role in the transcriptional and translational mechanism. Herein we have determined the mode and extent of association of certain G-quadruplex DNA binding bisbenzimidazole ligand (EtBzEt) in comparison to a known porphyrin ligand (TMPyP4). We have performed docking studies of the known G-quadruplex DNA binding ligands with the parallel propeller G-quadruplex RNA (PPR) to determine the most potent binding conformation which showed EtBzEt to be a better RNA binder than others. Furthermore, a molecular dynamics (MD) simulation (6 ns) was performed for the most stable docked complex in explicit solvent environment. The role of K+ ions, Hoogsteen hydrogen bond formation and backbone dihedral angle between the tetrads were carefully analyzed during the entire simulation run to determine the stability of each ligand associated PPR complex. All the analyses conclusively showed that while TMPyP4 merely stabilized the PPR, the ligand EtBzEt stabilized PPR very efficiently (Figure 3). Figure 3. Stabilzation and destabilization by EtBzEt and TMPyP4, repectively. Red and green ovals represent EtBzEt and TMPyP4, repectively. Chapter 4A. Design and Synthesis of New DNA Binding Fe(III) and Co(II) Salen Complexes with Pendant Oligopyrrole Carboxamides Extensive research on these oligopyrrole carboxamides has shown their specificity toward AT-rich sequences with high binding affinity. Here we have designed and synthesized Fe (III)-and Co (II)-based salen complexes attached with minor groove targeting oligopyrrole carboxamide side-chains (Figure 4). While the ligands showed excellent activity toward DNA damage, they also exhibited high affinity toward the minor grooves of the ds-DNA. This was also reflected in the high efficiency of the ligands toward cancer cell cytotoxicity. Further studies revealed that the ligands resulted in prominent nuclear condensation and fragmentation thereby driving the cells toward apoptosis. The presence of metal coordinated salen moiety conjugated with positively charged pendants ending with minor groove binding oligopyrrole carboxamides might have resulted in the increased activity of the ligands toward DNA targeting and cancer cell death. Figure 4. Chemical structures of the ligands used in this study. Chapter 4B. Design and synthesis of novel oligopyrrole based salen metal complexes and their efficiency toward stabilization of G-quadruplex DNA DNA targeting has been the key strategy toward the restriction of cancer cell proliferation. In a similar effort, we have designed and synthesized novel salen based Ni(II) and Pd(II) metal complexes with positively charged flanking side-chains comprising attached N-methylpyrrole carboxamides of varying lengths (Figure 5). The ligands showed efficient stabilization of the G-quadruplex DNA morphologies, with specificity over the duplex DNA. Sufficient inhibition of the telomerase activity was observed by the TRAP-LIG assay which was ascertained by the prominent restriction of cancer cell proliferation in the long-term cell viability assay. The ligands exhibited condensation and fragmentation of the nucleus when observed under confocal microscopy which is indicative of the cells undergoing apoptosis. Further annexin V-FITC and PI dual staining showed apoptosis to be the mechanistic pathway underlying the cancer cell cytotoxicity by the ligands. Modeling studies clearly showed the stacking of the salen moiety over the G-tetrads with the association of the pendant oligopyrrole carboxamide units to the grooves. Figure 5. Chemical structures of the ligands used in this study. Chapter 5A. Role of Metal Ions in Novel Fluorescein based Salen and Salphen Complexes toward Efficient DNA Damage and their Effect on Cancer Cells Metal ions play an important role toward DNA damage and numerous ligands have been synthesized for their use in anticancer therapy. Herein, we have designed and synthesized Fe(III) and Co(II) based salen/salphens by bridging two fluorescein moieties with varying spacers (Figure 6). Although the ligands exhibit dual binding mode, the more flexible salen ligands prefer to associate to the minor groove of the DNA while the relatively rigid salphen ligands show greater intercalation. The biophysical experiments reveal better binding affinity of the salphens toward duplex DNA as compared to the salen ligands. The metal coordination resulted in efficient DNA cleavage of plasmid at low ligand concentrations. The ligands also showed cancer cell cytotoxicity, cellular internalization with apoptosis as the proposed mechanism for cell death. Figure 6. Chemical structures of the salen and salphen ligands used in this study. Chapter 5B. Fluorescein based Salen and salphen Complexes as stabilizers of the Human G-quadruplex DNA and Promising Telomerase Inhibitors Metal based salen complexes have been considered as an important scaffold toward targeting of DNA structures. In the present work we have designed and synthesized nickel(II)-and palladium(II)-salen and salphen ligands by using fluorescein as the backbone to provide an extended aromatic surface (Figure 7). The ligands exhibit sufficient affinity toward the human telomeric G-quadruplex (G4) DNA in preference to the duplex DNA and also exhibit promising inhibition of telomerase activity. This is ascertained by their potency in the long-term cell viability assay which shows significant cancer cell cytotoxicity in presence of the ligands. Confocal microscopy showed cellular internalization followed by nuclear localization. Considerable population at the sub-G1 phase of the cell cycle showed cell death via apoptotic pathway. Figure 7. Chemical structures of the ligands used in this study. Chapter 6. Knockdown of Broad-Complex Gene Expression of Bombyx mori by Oligopyrrole carboxamides Enhances Silk Production Bombyx mori (B. mori) is important due to its major role in the silk production. Though DNA binding ligands often influence gene expression, no attempt has been made to exploit their use in sericulture. The telomeric heterochromatin of B. mori is enriched with 5′-TTAGG-3′ sequences. These sequences were also found to be present in several genes in the euchromatic regions. We examined three synthetic oligopyrrole carboxamides that target 5′-TTAGG-3′ sequences in controlling the gene expression in B. mori (Figure 8). The ligands did not show any defect or feeding difference in the larval stage, crucial for silk production. The compounds caused silencing of various isoforms of the broad-complex transcription factor and cuticle proteins which resulted in late pupal developmental defects. This study shows for the first time use of oligopyrrole carboxamide drugs in controlling gene expression in B. mori and their long term use in enhancing silk production. Figure 8. Chemical structures of the ligands used in this study (top) and increased cocoon size on ligand treatment.

Exposure of DNA to reactive oxygen species (ROS) results in the modified nucleobases (lesions) as well as strand scissions under physiological conditions. Due to its lowest oxidation potential (1.29 eV), guanine is the most easily oxidisable nucleobase. Furthermore, it has been observed that the 5'-guanine in G-tracts (e.g. GGG) has even lower oxidation potential (1.00 V vs. NHE). One of the representative G-rich examples is telomeres that consist of repeating units of 5'-d [TTAGGG]-3' found at the ends of chromosomes. Telomeres play an important role in biological functions, serving as guardians of genome stability; however, their G-rich nature implies that they can be readily oxidized. So how does nature protect these biologically important regions from oxidation? We believe the formation of a secondary structure known as G-Quadruplex in telomeric regions can partly serve as a protective role. In the first part of this work, we investigated DNA G-Quadruplex damage under various oxidation conditions and compare the damage results with single-stranded telomeric sequences. Damage to G-Quadruplex is generally less than single strands and is condition dependent. Guanines are the primary damage sites, but damage of adenine and thymine is also possible. Based on our studies, telomeric DNA can be readily oxidized to produce DNA lesions. How do DNA lesions affect the conformation and the stability of telomeric G-Quadruplex DNA? In the second part, we sought to address this question using various biophysical methods. Several native (OxodG, OxodA, and abasic site) and non-native (8-NH 2 -dA and 8-Br-dA) lesions were tested. UV thermal denaturation and circular dichroism revealed that the conformation and the stability of G-Quadruplex DNA are dependent on the location and the type of lesion in the sequence. G-Quadruplex DNA containing OxodG maintains its conformation with a decreased stability. Abasic site in the TTA loop affects the conformation of G-Quadruplex DNA but shows little effect on its stability. An unexpected stabilization of telomeric G-Quadruplex DNA was observed when deoxyadenosine (dA) in the loops was replaced with its native oxidized form OxodA. This is the first example of native DNA lesion that increases the stability of G-Quadruplex DNA. Like OxodA lesion, 8-NH 2 -dA (a non native DNA lesion) increases the stability of G-Quadruplex DNA while 8-Br-dA only affects the stability in KCl but has no significant effect in NaCl. In addition, studies of the effect of OxodA lesion on the human telomerase activity using TRAP assay will be discussed.