Made available in DSpace on 2011-05-04T12:36:24Z (GMT). No. of bitstreams: 0 Previous issue date: 2010 / A silicose é uma pneumoconiose provocada pela inalação da poeira de sílica e consiste em uma lesão pulmonar com participação de citocinas como o Fator de Necrose Tumoral alfa (TNF-a). Há dois polimorfismos nos sítios -238 e -308 do promotor do gene da TNF-a (substituição de uma guanina por uma adenina) que têm sido investigados como possíveis fatores de susceptibilidade para a silicose. A mutação na posição -308 tem sido associada com altos níveis da citocina no sangue, enquanto que a posição -238, com formas mais graves da doença. A exposição ocupacional à sílica continua sendo um problema de Saúde Pública no Brasil. O Centro de Estudos de Saúde do Trabalhador e Ecologia Humana (CESTEH)/FIOCRUZ acompanha trabalhadores do Rio de Janeiro expostos à sílica. Este trabalho teve como objetivo a implementação de uma metodologia para determinação do polimorfismo dos sítios -308 e -238 do promotor da TNF-a para futura utilização na avaliação da exposição à sílica. A genotipagem foi feita através da técnica de PCR-RFLP (Polymerase Chain Reaction Restricition Fragment Length Polymorphism) usando NcoI para -308 e BamHI para -238. Foram realizados ensaios para a implementação da metodologia, sendo esta aplicada em uma amostra populacional de 79 trabalhadores assistidos no ambulatório do CESTEH, sendo todos do sexo masculino e maiores de 18 anos. (...) Nesse estudo, demonstrou-se que a presença do alelo mutante (A) está associada a maiores quantidades da citocina no sangue. Não foram encontradas diferenças significativas entre as médias da enzima GST e a presença ou não do alelo mutante. A presença do alelo -308A apresentou ainda um risco relativo de 3,697 para o desenvolvimento de silicose. A implementação de um método toxico genético permite a identificação de possíveis determinantes de suscetibilidade individual ao desenvolvimento da doença, aumentando o alcanço das avaliações da saúde do trabalhador. / Silicosis is a pneumoconiosis caused by inhalation of silica dust and consists of a lung injury with participation of cytokines, such as Tumor Necrosis Factor alpha (TNF- ). There are two polymorphisms at sites -238 and -308 of the gene promoter in TNF- (replacement of a guanine-adenine), which have been investigated as possible factors of susceptibility for silicosis. The mutation at positon -308 has been associated with high levels of cytokine in the blood, while at -238 with severe forms of the disease. Occupational exposure to silica remains a public health problem in Brazil. The Center for Studies on Workers' Health and Human Ecology (CESTEH) / FIOCRUZ follows Rio de Janeiro's workers exposed to silica. This study aimed to implement a methodology for determining the polymorphism of sites -308 and -238 of the promoter of TNF- for future use in the assessment of exposure to silica. Genotyping was made by PCR-RFLP (Polymerase Chain Reaction – Restricition Fragment Length Polymorphism) using NcoI for -308 and BamHI for -238. Tests were performed for implementing the methodology, which was applied in 79 employees assisted by CESTEH, all male and aged over 18. After the tests, the following conditions were fixed for both sites: 100ng of DNA, extracted from 500μL of whole blood, were used as template for PCR with 1.5 U of Taq-DNA Polymerase Recombinant and a final volume of 50μL. The primers were: 5'AGGCAATAGGTTTTGAGGGCCAT and 5'TCCTCCCTGCTCCGATTCCG as sense and antisense to -308 and 5'AAACAGACCACAGACCTGGTC and 5'CTCACACTCCCCATCCTCCCGGATC to -238. The PCR parameters for -308 site were: 35 cycles using 94ºC/40s, 58ºC/90s and 72ºC/60, generating a fragment of 107 pb. The PCR parameters for -238 site were; 35 cycles using 94ºC/40s, 58ºC/90s and 72ºC/60s, generating a fragment of 165 pb. The digestion was made with 5U of endonuclease for 1mg of DNA incubated at 37°C for 1 hour. Individuals with the mutant allele lose the site which is attacked by the restriction enzyme. Workers genotyped for the -308 site showed 16.4% (n = 13) for the GA genotype, 82.3% (n = 65) for GG and 1.3% (n = 1) for the genotype AA. The -238 site showed the frequencies of 2.3% (n = 2) for GA, 97.7% (n = 77) for GG and zero for AA. This study shows that the presence of the mutant allele (A) is associated with greater amounts of cytokine in the blood. There were no significant differences between the means of the enzyme GST and the presence of the mutant allele. The presence of the -308 mutant allele also showed a relative risk of 3,697 for the development of silicosis. The implementation of a toxicogenetic method allows the identification of possible determinants of individual susceptibility to disease development, increasing the reach of the evaluations of occupational health.

Made available in DSpace on 2011-05-04T12:36:31Z (GMT). No. of bitstreams: 0 Previous issue date: 2010 / A sílica é um composto natural formado pelos dois elementos mais abundantes na Terra - oxigênio e silício. A exposição a partículas de sílica cristalina induz a uma inflamação pulmonar crônica, que pode evoluir para fibrose pulmonar, acarretando na doença conhecida como silicose. O estresse oxidativo desempenha um papel importante na patogênese desta fibrose pulmonar. Sendo assim, a expressão de genes antioxidantes, como glutationa S-transferases (GSTs), são importantes componentes de proteção das células contra o estresse oxidativo e são conhecidas como genes altamente polimórficos, podendo contribuir para a susceptibilidade a silicose. O polimorfismo da GSTP1 A/G resulta na substituição do aminoácido isoleucina por valina, diminuindo, substancialmente, a atividade da enzima GSTP1. O estudo teve como objetivo a determinação do polimorfismo da enzima GSTP1 em trabalhadores expostos à sílica e associação com silicose. A população foi composta por 82 trabalhadores expostos à sílica oriundos, principalmente, da indústria naval. O polimorfismo da GSTP1 foi analisado por PCR-RFLP. Como resultado verificou-se que 31,6 por cento dos trabalhadores tinham genótipo A/A, 57,9 por cento A/G e 10,5 por cento G/G. Observou-se que a média da atividade enzimática da GST foi menor (1,58 U/mL enzima) em indivíduos com o alelo G em relação ao alelo A (1,84 U/mL de enzima). Trabalhadores expostos à sílica portadores do alelo G mostraram um maior risco de desenvolver silicose, embora os resultados não tenham sido significativos, provavelmente, em função do universo amostral. Os indivíduos portadores do alelo G tiveram níveis menores na atividade da GST, independente do genótipo das enzimas GSTM1 e GSTT1. Em conclusão, estudos adicionais devem ser realizados para determinar o polimorfismo da GSTP1 em populações expostas à sílica em comparação com populações não-expostas, pois os resultados deste trabalho sugerem a utilização da determinação do polimorfismo da GSTP1, no processo de avaliação da exposição à sílica, como uma ferramenta complementar na identificação de subgrupos mais susceptíveis ao desenvolvimento da doença silicose. / Sílica is the natural compound of the two most abundant elements on Earth - oxygen and silicon. Exposure to crystalline silica particles induces chronic lung inflammation, which may progress to lung fibrosis, a disease known as silicosis. The oxidative stress plays an important role in the pathogenesis of pulmonary fibrosis. In this respect, the expression of antioxidant genes such as glutathione S-transferases (GSTs) are important to protect cells from oxidative stress and they are known as highly polymorphic genes, that may contribute to silicosis susceptibility. The GSTP1 A G polymorphism results in amino acid substitution isoleucine for valine which substantially diminishes GSTP1 enzyme activity. The objetive of study was the determination of enzyme GSTP1 polymorphism in workers exposed to silica and association with silicosis. The population was composed of 82 workers exposed to silica coming mainly from the shipbuilding industry.GSTP1 polymorphism was analyzed by PCR-RFLP. As a result it was found that 31,6% of workers had genotype A/A, 57,9% A/G and 10.5% G/G. It was observed that the mean enzyme activity of GST was lower (1.58 U / mL enzyme) in individuals with allele G compared with allele A (1.84 U / mL enzyme). Workers exposed to silica with allele G showed a higher risk of developing silicosis, although the results had not been significant, probably because of sample size. Individuals with allele G had lower levels of GST activity, independent of the genotype of GSTM1 and GSTT1 enzymes. In conclusion, further studies to determine the polymorphism of GSTP1 should be conducted in populations exposed to silica compared with non-exposed populations, because the results in this paper suggest the use of the determination of the polymorphism of GSTP1, in the process of evaluating the exposure to silica, as a complementary tool in the identification of subgroups more likely to develop the disease silicosis. / Sílica is the natural compound of the two most abundant elements on Earth - oxygen and silicon. Exposure to crystalline silica particles induces chronic lung inflammation, which may progress to lung fibrosis, a disease known as silicosis. The oxidative stress plays an important role in the pathogenesis of pulmonary fibrosis. In this respect, the expression of antioxidant genes such as glutathione S-transferases (GSTs) are important to protect cells from oxidative stress and they are known as highly polymorphic genes, that may contribute to silicosis susceptibility. The GSTP1 A G polymorphism results in amino acid substitution isoleucine for valine which substantially diminishes GSTP1 enzyme activity. The objetive of study was the determination of enzyme GSTP1 polymorphism in workers exposed to silica and association with silicosis. The population was composed of 82 workers exposed to silica coming mainly from the shipbuilding industry.GSTP1 polymorphism was analyzed by PCR-RFLP. As a result it was found that 31,6% of workers had genotype A/A, 57,9% A/G and 10.5% G/G. It was observed that the mean enzyme activity of GST was lower (1.58 U / mL enzyme) in individuals with allele G compared with allele A (1.84 U / mL enzyme). Workers exposed to silica with allele G showed a higher risk of developing silicosis, although the results had not been significant, probably because of sample size. Individuals with allele G had lower levels of GST activity, independent of the genotype of GSTM1 and GSTT1 enzymes. In conclusion, further studies to determine the polymorphism of GSTP1 should be conducted in populations exposed to silica compared with non-exposed populations, because the results in this paper suggest the use of the determination of the polymorphism of GSTP1, in the process of evaluating the exposure to silica, as a complementary tool in the identification of subgroups more likely to develop the disease silicosis.