Dissolved organic matter (DOM) is comprised of a complex array of molecular constituents that are linked to many globally-relevant processes and yet this material is still largely molecularly uncharacterized. Research presented here attempted to probe the molecular complexity of this material from both Arctic and temperate climates via multifaceted and novel approaches. DOM collected from remote Arctic watersheds provided evidence to suggest that permafrost-disturbed systems contain more photochemically- and biologically-labile material than undisturbed systems. These results have large implications for predicted increasing temperatures where widespread permafrost melt would significantly impact stores of organic carbon in polar environments. In attempting to address the complexities and reactivity of DOM within global environments, more information at the molecular-level is necessary. Further research sought to unravel the molecularly uncharacterized fraction via use of nuclear magnetic resonance (NMR) spectroscopy in conjunction with hyphenated and varied analytical techniques. Directly hyphenated high performance size exclusion chromatography (HPSEC) with NMR was explored. This hyphenation was found to separate DOM into structurally distinct fractions but proved limited at reducing DOM heterogeneity. Of the many high performance liquid chromatography (HPLC) techniques tested, hydrophilic interaction chromatography (HILIC) was found the most effective at simplifying DOM. HILIC separations utilizing a sample from Florida resulted in fractions with highly resolved NMR signals and substantial reduction in heterogeneity. Further development with a 2D-HILIC/HILIC system to achieve additional fractionation was employed. This method produced fractions of DOM that were homogenous enough to produce excellent resolution and spectral dispersion, permitting 2D and 3D NMR experiments to be performed. Extensive NMR analyses of these fractions demonstrated strong evidence for the presence of highly oxidized sterols. All fractions, however, provided 2D NMR spectra consistent with oxidized polycyclic structures and support emerging data and hypotheses suggesting that cyclic structures, likely derived from terpenoids, are an abundant, refractory and major component of DOM. Research presented within this thesis demonstrates that HILIC and NMR are excellent co-techniques for the analysis of DOM as well as that oxidized sterols and other cyclic components with significant hydroxyl and carboxyl substituents are major constituents in DOM.

In this dissertation, the intermolecular interactions between soil organic matter (SOM) and organofluorine compounds have been studied at the molecular-level using Nuclear Magnetic Resonance (NMR) spectroscopy. NMR probes the local magnetic environment surrounding atomic nuclei, and is uniquely capable as an analytical tool to probe molecular environments in complex disordered materials, such as soils. Several NMR techniques were employed in this work, including Pulse Field Gradient (PFG)-NMR based diffusion measurements, solid-state cross-polarization (CP), saturation transfer difference (STD) spectroscopy, and reverse-heteronuclear saturation transfer difference (RHSTD) spectroscopy. Using organofluorine compounds as molecular probes, xenobiotic interactions with SOM were studied. Using 1H{19F} RHSTD, the interaction sites in humic acid for organofluorine compounds were identified by direct molecular-level methods. Protein and lignin were identified as major binding sites, with different preferences exhibited for these sites by dissimilar organofluorine compounds: aromatic organofluorine compounds display varied preference for aromatic humic acid sites while perfluorooctanoic acid exhibits near total selectivity for protein-derived binding sites. The mechanisms underlying these preferences were probed in the solution state. Using crucial knowledge from the humic acid studies, a detailed molecular-level investigation of xenobiotic interactions in an intact and unmodified whole soil was made possible. A direct and in situ elucidation of the components in soil organic matter that interact with small organofluorine xenobiotic molecules has been presented, allowing, for the first time, resolution of multiple interactions occurring for xenobiotics simultaneously at different sites within a whole soil.

The topology and dynamics of biomolecules are intricately linked with their biological function. The focus of this thesis is the NMR-based measurement of topology and dynamics in biomolecular systems, and methods of measuring immersion depth and orientation of membrane-associated molecules. In detergent micelles and lipid bilayers, the local concentrations of hydrophobic and hydrophilic molecules are a function of their bilayer immersion depth. For paramagnetic molecular oxygen or metal cations, the magnitudes of the associated paramagnetic isotropic contact shifts and relaxation rate enhancements (PREs) are therefore depth-dependent. NMR measurements of these effects reveal the immersion depth of bilayer- or detergent-associated molecules. This work first explores transbilayer oxygen solubility and thermodynamics, as measured from contact shifts and PREs of the constituent lipid molecules in the presence of 30 bar oxygen. Contact shifts revealed the transmembrane O2 solubility profile spans a factor of seven across the bilayer, while PREs indicated that oxygen partitioning into bilayers and dodecylphosphocholine (DPC) micelles is entropically driven. Next, this work describes how paramagnetic effects from molecular oxygen and Ni(II) cations may be employed to study the immersion depth and topology of drug and protein molecules in DPC micelles. In one study, the positioning of the amphipathic drug imipramine in micelles was determined from O2- and Ni(II)-induced contact shifts. A second study, relying solely on O2-induced PREs, determined the tilt angles and micelle immersion depths of the two alpha helices in a monomeric mutant of the membrane protein phospholamban. A third study utilized 19F NMR to explore the importance of juxtamembraneous tryptophans on the topology of the membrane protein synaptobrevin, via O2-induced contact shifts and solvent-induced isotope shifts of a juxtamembraneous 19F-phenylalanine. Comparison of synaptobrevin constructs with zero, one, and two juxtamembraneous tryptophans revealed that while one tryptophan is sufficient to ‘anchor’ the protein in micelle, the addition of a second tryptophan dampens local dynamics. These solution state NMR studies demonstrate how paramagnetic effects from dissolved oxygen, complemented with measurements of local water exposure, provide detailed, accurate descriptions of membrane immersion depth and topology. These techniques are readily extended to the study of a wide range of biomolecules.

<p>The Application of Magnetic Resonance (MRI) and Computed Tomography Imaging (CT) in the Diagnosis and Management of Maxillofacial Tumours. For decades maxillofacial surgeons over the world have been frustrated by the high and often fatal recurrence of certain advanced jaw tumours. This study conclusively proves that Computed Tomography and especially Magnetic Resonance Imaging significantly decreases recurrence of Odontogenic Keratocyst and Ameloblastoma and allows surgical planning to avoid these recurrences.</p>

Proteins play an important role in cells, as the morphology, function and activities of the cell depend on the proteins they express. The key to understanding how different proteins function lies in an understanding of the molecular structure. The overall aim of this thesis was the determination of the structure of DWNN domains. This thesis described the preparation of samples of human DWNN suitable for structural analysis by nuclear magnetic resonance spectroscopy (NMR), as well as NMR analysis.

No description available.

No description available.

[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,&sup15N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.

Thesis (M.S.)--Rochester Institute of Technology, 1989. / Includes bibliographical references (leaves 62-64).

Thesis (Ph.D.) -- McMaster University, 1999. / [Íta] in title is a Greek letter. Includes bibliographical references (leaves 180-191). Also available via World Wide Web.