by Chiu Wing Lok Abe Kurtz. / Thesis (Ph.D.)--Chinese University of Hong Kong, 2001. / Includes bibliographical references (p. 218-230). / Electronic reproduction. Hong Kong : Chinese University of Hong Kong, [2012] System requirements: Adobe Acrobat Reader. Available via World Wide Web. / Mode of access: World Wide Web. / Abstracts in English and Chinese.

Ip Lai Nang. / Thesis (M.Phil.)--Chinese University of Hong Kong, 2001. / Includes bibliographical references (leaves 67-71). / Abstracts in English and Chinese. / ABSTRACT (ENGLISH) --- p.iii / ABSTRACT (CHINESE) --- p.iv / ACKNOWLEDGEMENTS --- p.v / TABLE OF CONTENTS --- p.vi / LIST OF TABLES --- p.viii / LIST OF FIGURES --- p.ix / LIST OF APPENDIX --- p.x / Chapter CHAPTER 1 --- INTRODUCTION --- p.1 / Chapter CHAPTER 2 --- BACKGROUND --- p.3 / Chapter 2.1 --- Structure of DNA --- p.3 / Chapter 2.2 --- Sequence dependent stability --- p.8 / Chapter 2.3 --- Thermodynamics of DNA --- p.9 / Chapter 2.4 --- Model for predicting thermodynamic parameters of DNA sequence --- p.15 / Chapter 2.4.1 --- The nearest-neighbor (NN) model / Chapter 2.4.1.1 --- Background --- p.15 / Chapter 2.4.1.2 --- Method for predicting thermodynamic parameters --- p.16 / Chapter 2.4.1.3 --- Limitation of the NN model --- p.19 / Chapter CHAPTER 3 --- EXPERIMENTAL METHOD --- p.20 / Chapter 3.1 --- Design of DNA sequences PAGE --- p.20 / Chapter 3.2 --- DNA synthesis and purification --- p.22 / Chapter 3.3 --- UV measurement --- p.23 / Chapter CHAPTER 4 --- THE NEXT NEAREST-NEIGHBOR (NNN) MODEL --- p.27 / Chapter 4.1 --- Method for extracting the NNN thermodynamic parameters --- p.30 / Chapter 4.2 --- Discussions --- p.34 / Chapter 4.2.1 --- Comparison of the NN model and the NNN model --- p.34 / Chapter 4.2.2 --- The NNN effect --- p.38 / Chapter 4.2.3 --- Sequence-specific local structure of DNA and the NNN effect / Chapter CHAPTER 5 --- SUMMARY AND FUTURE WORK --- p.49 / APPENDIX I´ؤ XVI --- p.51 / REFERENCE --- p.67

Yang, Hao. / Thesis (M.Phil.)--Chinese University of Hong Kong, 2009. / Includes bibliographical references (leaves 53-57). / Abstract also in Chinese. / Title Page --- p.i / Thesis Committee --- p.ii / Abstract (English version) --- p.iv / Abstract (Chinese version) --- p.vi / Acknowledgment --- p.vii / Table of Contents --- p.viii / List of Tables --- p.xi / List of Figures --- p.xii / List of Abbreviations and Symbols --- p.xv / Chapter 1 --- Introduction --- p.1 / Chapter 1.1 --- DNA Methylation --- p.1 / Chapter 1.2 --- DNA Methylation Repair --- p.2 / Chapter 1.3 --- Objectives of This Work --- p.2 / Chapter 1.4 --- DNA Structure --- p.3 / Chapter 1.4.1 --- Nomenclature Scheme for DNA --- p.3 / Chapter 1.4.2 --- Base Pair Scheme --- p.4 / Chapter 1.4.3 --- Sugar Conformation --- p.5 / Chapter 1.4.4 --- Backbone Conformation --- p.5 / Chapter 2 --- Materials and Methods --- p.7 / Chapter 2.1 --- Sample Design --- p.7 / Chapter 2.2 --- Sample Preparation --- p.7 / Chapter 2.3 --- UV Optical Melting Study --- p.8 / Chapter 2.4 --- NMR Study --- p.9 / Chapter 2.4.1 --- NMR Melting Study --- p.10 / Chapter 2.4.2 --- Resonance Assignment --- p.10 / Chapter 2.4.3 --- Determination of Sugar Conformation --- p.12 / Chapter 2.4.4 --- Determination of Backbone Conformation --- p.13 / Chapter 3 --- Effect of 1-Methyladenine on Double-Helical DNA Structures --- p.14 / Chapter 3.1 --- NMR Resonance Assignments --- p.14 / Chapter 3.1.1 --- TA-oligo Resonance Assignments --- p.14 / Chapter 3.1.2 --- TmlA-oligo Resonance Assignments --- p.16 / Chapter 3.2 --- DNA Double-Helical Structures upon 1-Methylation of Adenine --- p.18 / Chapter 3.2.1 --- Base Pairing Mode --- p.18 / Chapter 3.2.2 --- Sugar Puker --- p.21 / Chapter 3.2.3 --- Backbone Conformation --- p.22 / Chapter 3.3 --- Summary --- p.24 / Chapter 4 --- Effect of 1-Methyladenine on Double-Helical DNA Stabilities --- p.25 / Chapter 4.1 --- Thermodynamic Studies --- p.26 / Chapter 4.1.1 --- Influence of m6A on UV Melting Studies --- p.26 / Chapter 4.1.2 --- Thermodynamics by NMR Melting Studies --- p.28 / Chapter 4.2 --- "NMR Structural Studies on Gm1A-, Am1A- and Cm1A-oligo" --- p.33 / Chapter 4.2.1 --- Gml A-oligo --- p.33 / Chapter 4.2.1.1 --- Gm1A-oligo Resonance Assignments --- p.33 / Chapter 4.2.1.2 --- Base Pair Structures of Gm1A-oligo --- p.35 / Chapter 4.2.2 --- AmiA-oligo --- p.37 / Chapter 4.2.2.1 --- Am1A-oligo Resonance Assignments --- p.37 / Chapter 4.2.2.2 --- Base Pair Structures of Am1A-oligo --- p.39 / Chapter 4.2.3 --- Cm1A-oligo --- p.43 / Chapter 4.2.3.1 --- Cm1A-oligo Resonance Assignments --- p.43 / Chapter 4.2.3.2 --- Base Pair Structures of Cm1A-oligo --- p.45 / Chapter 4.3 --- Summary --- p.46 / Chapter 5 --- Conclusion and Future work --- p.47 / Appendix I Proton chemical shift values of TA-oligo --- p.48 / Appendix II Proton chemical shift values of TmlA-oligo --- p.49 / Appendix III Proton chemical shift values of GmlA-oligo --- p.50 / Appendix IV Proton chemical shift values of Am1A-oligo --- p.51 / Appendix V Proton chemical shift values of CmlA-oligo --- p.52 / References --- p.53

"February, 2002" / Includes bibliographical references (leaves 156-182) / xiv, 182, [26] leaves : ill. (some col.) ; 30 cm. / Title page, contents and abstract only. The complete thesis in print form is available from the University Library. / Thesis (Ph.D.)--University of Adelaide, Dept. of Molecular Biosciences, 2002

Previous evidence has shown that the simple sequences microsatellites and poly-purine/poly-pyrimidine tracts (PPTs) could be both a cause, and an effect, of meiotic recombination. The causal link between simple sequences and recombination has not been much explored, however, probably because other evidence has cast doubt on its generality, though this evidence has never been conclusive. Several questions have remained unanswered in the literature, and I have addressed aspects of three of them in my thesis. First, what is the scale and magnitude of the association between simple sequences and recombination? I found that microsatellites and PPTs are strongly associated with meiotic double-strand break (DSB) hotspots in yeast, and that PPTs are generally more common in human recombination hotspots, particularly in close proximity to hotspot central regions, in which recombination events are markedly more frequent. I also showed that these associations can't be explained by coincidental mutual associations between simple sequences, recombination and other factors previously shown to correlate with both. A second question not conclusively answered in the literature is whether simple sequences, or their high levels of polymorphism, are an effect of recombination. I used three methods to address this question. Firstly, I investigated the distributions of two-copy tandem repeats and short PPTs in relation to yeast DSB hotspots in order to look for evidence of an involvement of recombination in simple sequence formation. I found no significant associations. Secondly, I compared the fraction of simple sequences containing polymorphic sites between human recombination hotspots and coldspots. The third method I used was generalized linear model analysis, with which I investigated the correlation between simple sequence variation and recombination rate, and the influence on the correlation of additional factors with potential relevance including GC-content and gene density. Both the direct comparison and correlation methods showed a very weak and inconsistent effect of recombination on simple sequence polymorphism in the human genome.Whether simple sequences are an important cause of recombination events is a third question that has received relatively little previous attention, and I have explored one aspect of it. Simple sequences of the types I studied have previously been shown to form non-B-DNA structures, which can be recombinagenic in model systems. Using a previously described sodium bisulphite modification assay, I tested for the presence of these structures in sequences amplified from the central regions of hotspots and cloned into supercoiled plasmids. I found significantly higher sensitivity to sodium bisulphite in humans in than in chimpanzees in three out of six genomic regions in which there is a hotspot in humans but none in chimpanzees. In the DNA2 hotspot, this correlated with a clear difference in numbers of molecules showing long contiguous strings of converted cytosines, which are present in previously described intramolecular quadruplex and triplex structures. Two out of the five other hotspots tested show evidence for secondary structure comparable to a known intramolecular triplex, though with similar patterns in humans and chimpanzees. In conclusion, my results clearly motivate further investigation of a functional link between simple sequences and meiotic recombination, including the putative role of non-B-DNA structures.

SMFD techniques offer genuine detection possibilities which are often inaccessible using ensemble methods. This was demonstrated in three projects investigating translocation activity of CHD4 protein, analysis of MS2 phage capsid assembly and in-cell characterization of DNA structure. In other projects, binding interactions between two fluorescent probes and a short oligonucleotide were characterized and all optical depth of focus extended microscope configuration for imaging of individual molecules inside bacterial cells was developed and tested.

Indiana University-Purdue University Indianapolis (IUPUI) / The DNA minor groove continues to be an important biological target in the development of anticancer, antiviral, and antimicrobial compounds. Among agents that target the minor groove, studies of well-established benzimidazole-based DNA binders such as Hoechst 33258 have made it clear that the benzimidazole-amidine portion of these molecules promotes an efficient, site-selective DNA association. Building on the beneficial attributes of existing benzimidazole-based DNA binding agents, a series of benzimidazole-amino acid conjugates was synthesized to investigate their DNA recognition and binding properties. In this series of compounds, the benzimidazole-amidine moiety was utilized as a core DNA “anchoring” element accompanied by different amino acids to provide structural diversity that may influence DNA binding affinity and site-selectivity. Single amino acid conjugates of benzimidazole-amidines were synthesized, as well as a series of conjugates containing 20 dipeptides with the general structure Xaa-Gly. These conjugates were synthesized through a solid-phase synthetic route building from a resin-bound amino acid (or dipeptide). The synthetic steps involved: (1) the coupling of 4-formylbenzoic acid to the resin-bound amino acid (via diisopropylcarbodiimide and hydroxybenzotriazole); followed by (2) introduction of a 3,4-diaminobenzamidoxime in the presence of 1,4-benzoquinone to construct the benzimidazole ring; and, finally, (3) reduction of the resin-bound amidoxime functionality to an amidine via treatment with 1M SnCl2•2H2O in DMF before cleavage of final product from the resin. The synthetic route developed and employed was simple and straightforward except for the final reduction that proved to be very arduous. All target compounds were obtained in good yield (based upon weight), averaging 73% mono-amino acid and 78% di-amino acid final compound upon cleavage from resin. Ultimately, the DNA binding activities of the amino acid-benzimidazole-amidine conjugates were analyzed using a fluorescent intercalator displacement (FID) assay and calf thymus DNA as a substrate. The relative DNA binding affinities of both the mono- and di-amino acid-benzimidazole-amidine conjugates were generally weaker than that of netropsin and distamycin with the dipeptide conjugates showing stronger binding affinities than the mono-amino acid conjugates. The dipeptide conjugates containing amino acids with positively charged side chains, Lys-Gly-BI-(+) and Arg-Gly-BI-(+), showed the strongest DNA binding affinities amongst all our synthesized conjugates.

Fu Zhenming. / Thesis submitted in: December 2003. / Thesis (M.Phil.)--Chinese University of Hong Kong, 2004. / Includes bibliographical references (leaves 138-162). / Abstracts in English and Chinese. / List of abbreviations --- p.i / Abstract (in English) --- p.ii / 摘要（中文） --- p.iii / Acknowledgement --- p.iv / Chapter Chapter 1. --- Introduction and Objectives of Study --- p.1 / Chapter 1.1 --- Hepatocellular carcinoma in general --- p.2 / Chapter 1.1.1 --- "Epidemiology, risk factors" --- p.2 / Chapter 1.1.2 --- Pathology and staging --- p.4 / Chapter 1.1.3 --- Treatment --- p.6 / Chapter 1.1.4 --- Improvement of early detection and treatment of HCC --- p.7 / Chapter 1.2 --- General aspects of mitochondria and mitochondrial DNA (mtDNA) --- p.10 / Chapter 1.2.1 --- Structure and dynamics of mitochondria --- p.10 / Chapter 1.2.1.1 --- General introduction of mitochondria --- p.10 / Chapter 1.2.1.2 --- Respiration chain of mitochondria --- p.11 / Chapter 1.2.2 --- The mitochondrial genome --- p.14 / Chapter 1.2.2.1 --- Strucure --- p.14 / Chapter 1.2.2.2 --- Genes for structure proteins --- p.16 / Chapter 1.2.2.3 --- Genes for translation --- p.17 / Chapter 1.2.2.4 --- Imported proteins and RNAs --- p.17 / Chapter 1.2.3 --- Mitochondrial DNA maintenance --- p.19 / Chapter 1.2.4 --- Mitochondrial DNA replication --- p.25 / Chapter 1.2.5 --- Mitochondrial DNA transcription --- p.30 / Chapter 1.2.6 --- Mitochondrial DNA translation --- p.32 / Chapter 1.3 --- MtDNA diseases --- p.35 / Chapter 1.4 --- MtDNA mutation and HCC --- p.35 / Chapter 1.5 --- Aims of the study --- p.39 / Chapter Chapter 2. --- Materials and Methods --- p.41 / Chapter 2.1 --- Materials --- p.42 / Chapter 2.1.1 --- Chemicals --- p.42 / Chapter 2.1.2 --- Primers --- p.42 / Chapter 2.1.3 --- Enzymes --- p.45 / Chapter 2.1.4 --- Cell line --- p.45 / Chapter 2.1.5 --- Collection of specimens --- p.46 / Chapter 2.2 --- Methodology --- p.47 / Chapter 2.2.1 --- "DNA extraction from hcc tissues, cell line Hep3B and PBMCs" --- p.47 / Chapter 2.2.1.1 --- DNA extraction from HCC tissues --- p.47 / Chapter 2.2.1.2 --- DNA extraction from cell line Hep3B --- p.49 / Chapter 2.2.1.3 --- DNA extraction from and PBMCs --- p.50 / Chapter 2.2.1.3.1 --- Preparation of PBMCs --- p.50 / Chapter 2.2.1.3.2 --- DNA extraction from and PBMCs --- p.51 / Chapter 2.2.2 --- Detection of mt whole genome mutation by direct sequencing --- p.51 / Chapter 2.2.2.1 --- Design of mtDNA primers --- p.51 / Chapter 2.2.2.2 --- PCR amplification of the whole mt genome --- p.51 / Chapter 2.2.2.3 --- Direct sequencing of the whole mt genome --- p.52 / Chapter 2.2.2.3.1 --- Primer used in sequencing --- p.52 / Chapter 2.2.2.3.2 --- Purification of the PCR products of the whole mt genome --- p.53 / Chapter 2.2.2.3.3 --- Dye terminator cycle sequencing reaction --- p.53 / Chapter 2.2.2.3.4 --- Purification of extension products --- p.54 / Chapter 2.2.3 --- Detection of mtDNA control region mutation --- p.55 / Chapter 2.2.3.1 --- PCR amplification of D310 in the mtDNA control region --- p.55 / Chapter 2.2.3.2 --- Screening of D310 mutation by PFLDA --- p.55 / Chapter 2.2.3.2.1 --- Making 8% denatured gel mixture --- p.55 / Chapter 2.2.3.2.2 --- Setting up and Pouring the denatured gel --- p.56 / Chapter 2.2.3.2.4 --- Preparing and Loading the PCR products --- p.57 / Chapter 2.2.3.2.5 --- Electrophoresis --- p.57 / Chapter 2.2.3.2.6 --- "Gel fixing, silver staining and color development " --- p.58 / Chapter 2.2.3.3 --- Direct sequencing of D310 in the mtDNA control region --- p.59 / Chapter 2.2.4 --- Detection of mt DNA coding region mutation --- p.60 / Chapter 2.2.4.1 --- PCR amplification of the 5 respiratory chain subunit genes --- p.60 / Chapter 2.2.4.2 --- Restriction enzyme digestion of 5 genes in mtDNA coding region --- p.60 / Chapter 2.2.4.3 --- Screening of mtDNA coding region mutation by SSCP --- p.61 / Chapter 2.2.4.3.1 --- Making 6% 49:1 acrylamide/Bis SSCP gel mixture --- p.61 / Chapter 2.2.4.3.2 --- "Setting up the SSCP gel, loading sample, fixing, staining and developing of the gel " --- p.62 / Chapter 2.2.4.4 --- Sequencing conformation of the mtDNA coding region mutation --- p.62 / Chapter 2.2.5 --- Statistics --- p.63 / Chapter 2.2.5.1 --- The chi-square test --- p.63 / Chapter 2.2.5.2 --- The Friedman test --- p.63 / Chapter 2.2.5.3 --- Wilcoxon signed ranks test --- p.63 / Chapter Chapter 3. --- Results --- p.64 / Chapter 3.1 --- Detection mt DNA whole genome mutation --- p.65 / Chapter 3.1.1 --- Identification of mtDNA whole genome by direct sequencing --- p.65 / Chapter 3.2 --- Detection mt DNA D-loop mutation --- p.76 / Chapter 3.2.1 --- Screening of C-tract alteration in HCC tissus by PCR fragments length detection assay (PFLDA) --- p.76 / Chapter 3.2.2 --- Screening of coding region alteration in HCC tissues by SSCP --- p.77 / Chapter 3.2.2.1 --- Identification of C-tract alterations in HCC and non-tumorous tissues by direct sequencing --- p.77 / Chapter 3.2.3 --- Identification of C-tract alterations by direct sequencing --- p.82 / Chapter 3.2.3.1 --- Identification of C-tract alterations in HCC tissues by direct sequencing --- p.82 / Chapter 3.2.3.2 --- Identification of C-tract alteration in PBMC of normal subjects by direct sequencing --- p.82 / Chapter 3.2.3.3 --- Identification of C-tract alteration in PBMC of HCC patients by direct sequencing --- p.82 / Chapter 3.2.4 --- Statistics of the analysis of C-tract alterations --- p.82 / Chapter 3.3 --- Detection mt DNA mutation in the coding region --- p.87 / Chapter Chapter 4. --- Discussion --- p.98 / Chapter 4.1 --- Detection mtDNA whole genome mutation --- p.99 / Chapter 4.2 --- Detection mtDNA D-loop mutation --- p.107 / Chapter 4.3 --- Detection mtDNA mutation in the coding region --- p.119 / Chapter 4.4 --- Possible mechanisms of mtDNA mutation in HCC carcinogenesis --- p.125 / Chapter 4.5 --- Proposals for prospective studies --- p.126 / Chapter 4.5.1 --- Function of C7 in D310 --- p.128 / Chapter 4.5.2 --- Function changes of mtDNA coding region mutation --- p.130 / Chapter 4.5.3 --- Detection of D310 C-tract mutation in patients' plasma --- p.131 / Chapter 4.5.4 --- Relationship between nMSl and mtMSI --- p.132 / Chapter 4.6 --- Summary --- p.134 / References --- p.137

No description available.

The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)