• Refine Query
  • Source
  • Publication year
  • to
  • Language
  • 11
  • 6
  • 3
  • Tagged with
  • 14
  • 14
  • 14
  • 14
  • 7
  • 7
  • 7
  • 7
  • 7
  • 4
  • 3
  • 3
  • 3
  • 3
  • 3
  • About
  • The Global ETD Search service is a free service for researchers to find electronic theses and dissertations. This service is provided by the Networked Digital Library of Theses and Dissertations.
    Our metadata is collected from universities around the world. If you manage a university/consortium/country archive and want to be added, details can be found on the NDLTD website.
11

Molecular modelling and NMR studies of multinuclear platinum anticancer complexes

Thomas, Donald S January 2006 (has links)
[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,&sup15N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.
12

Novel traditional Chinese medicine-platinum compound that bypasses mitotic DNA damage checkpoints in cancer cells. / 新型傳統中藥-鉑類化合物躍過腫瘤細胞周期有絲分裂基因損傷檢查點之研究 / CUHK electronic theses & dissertations collection / Digital dissertation consortium / Xin xing chuan tong Zhong yao-bo lei hua he wu yue guo zhong liu xi bao zhou qi you si fen lie ji yin sun shang jian cha dian zhi yan jiu

January 2010 (has links)
Aim: Cisplatin is the first platinum drug that shows promising anti-tumor effect clinically. Oxaliplatin, a third-generation platinum drug that incorporates a diaminocyclohexane (DACH) structural entity, can overcome cisplatin resistance. R,R-5, a novel platinum compound that integrates the DACH entity with a demethylcantharidin (DMC) component that is derived from a traditional Chinese medicine (TCM) , can also overcome cisplatin resistance. The principal objectives of this study was to investigate in detail, the effect of these compounds at the antephase and G2 checkpoints of the cell cycle, and to establish the relationship (if any) between different structural entities with checkpoint activation. The ultimate aim of the study was to ascertain the potential for the development of novel checkpoint abrogators as anti-tumor agents. / Background: A common procedure in current cancer chemotherapy is to induce genomic stress in cancer cells, leading to irreparable DNA damage and eventually cell death. However, there are several DNA repair mechanisms in cancer cells to maintain genomic stability, which require cell cycle checkpoints to stop cell proliferation for DNA damage repair, thereby avoiding errors in cellular events like DNA replication, transcription and mitosis. Among these cell cycle checkpoints, antephase and G2 checkpoints are two gate checkpoints for mitosis. Abrogation of G2 checkpoint has been reported to give rise to synergistic cytotoxic effect with DNA damaging agents, representing a means of circumventing drug resistance in chemotherapy. / Conclusions: Acute stress to cisplatin can activate the MMR/c-Abl/MEKK1/p38MAPK pathway, leading to the activation of antephase checkpoint, and stop cells from entering mitosis immediately. DACH-containing platinum compound oxaliplatin fails to activate this antephase checkpoint. However, both cisplatin and oxaliplatin can activate the G2 checkpoint, which can be abrogated by DMC. In contrast, RR-5 can bypass both the antephase and G2 checkpoints. In summary, novel TCM-platinum compound R,R-5 can bypass mitotic DNA damage checkpoints in cancer cells and thus has the potential for further development as an anti-cancer drug. / Methods: Microarray analysis was used to detect gene transcription profiles after drug treatments. The activation of mitotic checkpoints was inspected by counting mitotic cells and utilizing flow cytometry. Using Western blotting, the activation of certain key players in the antephase and G2 checkpoint was revealed. MTT assays were performed to show the outcome of checkpoint activation. / Results: In HCT116 cells, 35 genes that facilitate G2/M transition were found to be up-regulated after R,R-5 treatment compared with oxaliplatin in the microarray analysis, implying the bypass of mitotic checkpoints by R,R-5 rather than oxaliplatin. Acute stress (2 hour) of cisplatin activated the antephase checkpoint, resulting in a rapid decrease in mitotic index and phosphorylation of histone H1, which avoided mitotic catastrophe and promoted cell survival in HeLa cells. Further experiments demonstrated that this antephase checkpoint could be abrogated by c-Abl and p38MAPK inhibitors, or siRNAs against c-Abl or MEKK1, suggesting that this checkpoint may be controlled by an MMR/c-Abl/MEKK1/p38MAPK pathway. In contrast, oxaliplatin and R,R-5 did not activate this antephase checkpoint. Moreover, after 24 hour oxaliplatin treatment in HeLa cells, the mitotic index and CDK1 activity were decreased, which could be restored by concomitant treatment with ATM/ATR inhibitor and DMC. This indicated the activation of G2 checkpoint by oxaliplatin and implied that DMC can abrogate oxaliplatin-activated G2 checkpoint by restoring CDK1 activity. Cisplatin could also activate G2 checkpoint, whereas R,R-5 apparently bypassed this G2 checkpoint. / Guan, Huaji. / Adviser: Vincent Hon Leung Lee. / Source: Dissertation Abstracts International, Volume: 72-04, Section: B, page: . / Thesis (Ph.D.)--Chinese University of Hong Kong, 2010. / Includes bibliographical references (leaves 212-249). / Electronic reproduction. Hong Kong : Chinese University of Hong Kong, [2012] System requirements: Adobe Acrobat Reader. Available via World Wide Web. / Electronic reproduction. Ann Arbor, MI : ProQuest Information and Learning Company, [200-] System requirements: Adobe Acrobat Reader. Available via World Wide Web. / Electronic reproduction. Ann Arbor, MI : ProQuest Information and Learning Company, [200-] System requirements: Adobe Acrobat Reader. Available via World Wide Web. / Abstract also in Chinese.
13

Drug action mechanism of platinum antitumour compounds: a DFT study. / CUHK electronic theses & dissertations collection

January 2004 (has links)
Pang Siu Kwong. / "August 2004." / Thesis (Ph.D.)--Chinese University of Hong Kong, 2004. / Includes bibliographical references (p. 181-191) / Electronic reproduction. Hong Kong : Chinese University of Hong Kong, [2012] System requirements: Adobe Acrobat Reader. Available via World Wide Web. / Mode of access: World Wide Web. / Abstracts in English and Chinese.
14

In vitro evaluation of potential drug combination in cancer therapy: demethylcantharidin and platinum drug.

January 2007 (has links)
Ng, Po Yan. / Thesis submitted in: November 2006. / Thesis (M.Phil.)--Chinese University of Hong Kong, 2007. / Includes bibliographical references (leaves 109-120). / Abstracts in English and Chinese. / Acknowledgement --- p.i / Abstract --- p.ii / 摘要 --- p.iii / Table of Contents --- p.iv / List of Figures --- p.viii / List of Tables --- p.xi / List of Abbreviation --- p.xii / Chapter Chapter 1 --- Introduction / Chapter 1.1 --- A General Introduction to the Development and Clinical Activities of Platinum Drugs --- p.1 / Chapter 1.1.1 --- Platinum Drugs used in a Clinical Setting --- p.4 / Chapter 1.1.2 --- Platinum Drugs under Clinical Trials --- p.5 / Chapter 1.1.3 --- Platinum Compounds with Dual Mechanisms --- p.7 / Chapter 1.2 --- Platinum Drug Antitumor Mechanism --- p.9 / Chapter 1.3 --- Limitations of Platinum Drugs --- p.12 / Chapter 1.3.1 --- Toxicity --- p.12 / Chapter 1.3.2 --- Drug Resistance or Cross Resistance --- p.15 / Chapter 1.3.2.1 --- Reduced Drug Accumulation or Increased Drug Efflux --- p.16 / Chapter 1.3.2.2 --- Drug Inactivation --- p.18 / Chapter 1.3.2.3 --- Enhanced DNA Repair --- p.19 / Chapter 1.4 --- Why Combinational Therapy? --- p.21 / Chapter 1.4.1 --- Antimetabolites --- p.20 / Chapter 1.4.2 --- Topoisomerase Inhibitors --- p.22 / Chapter 1.4.3 --- Tubulin-Active Antimitotic Agents --- p.24 / Chapter 1.4.4 --- Demethylcantharidin as a potential candidate for drug combination --- p.28 / Chapter 1.5 --- Study Objectives --- p.31 / Chapter Chapter 2 --- Materials and Methods / Chapter 2.1 --- Cell Lines --- p.33 / Chapter 2.2 --- Cancer Cell Preparation / Chapter 2.2.1 --- Chemicals and Reagents --- p.33 / Chapter 2.2.2 --- Cell Culture Practice --- p.34 / Chapter 2.2.2.1 --- Subcultures --- p.35 / Chapter 2.2.2.2 --- Cryopreservation --- p.37 / Chapter 2.2.2.3 --- Thawing Cryopreservated Cells --- p.38 / Chapter 2.2.3 --- Development of Drug-Resistant Cell Lines --- p.39 / Chapter 2.3 --- Growth Inhibition Assay / Chapter 2.3.1 --- Evaluation of Cytotoxicity in vitro --- p.40 / Chapter 2.3.2 --- Drug Pretreatment --- p.43 / Chapter 2.3.3 --- Drug Pre-sensitization with Concurrent Treatment --- p.44 / Chapter 2.4 --- Calculations for Drug Combinations --- p.46 / Chapter 2.5 --- Statistical Analysis --- p.49 / Chapter Chapter 3 --- Results and Discussions / Chapter 3.1 --- In vitro Cytotoxicity and Evaluation of Drug Resistance --- p.50 / Chapter 3.2 --- Role of Leaving Ligand in a Platinum Complex --- p.58 / Chapter 3.3 --- Priority in Selecting the Most Effective Drug Combination --- p.66 / Chapter 3.4 --- Drug Combination Studies / Chapter 3.4.1 --- Drug Combination Prescreening --- p.68 / Chapter 3.4.1.1 --- Comparison of the effectiveness of the three Drug Combinations --- p.72 / Chapter 3.4.1.2 --- Rationale for Drug Combination Studies presented in Section 3.4.2 & 3.4.3 --- p.73 / Chapter 3.4.2 --- Drug Pre-sensitization Studies in Colorectal Cancer Cell Lines --- p.74 / Chapter 3.4.2.1 --- Comparison of Drug Pre-sensitization Treatment in Sensitive Colorectal Cancer Cell Lines --- p.84 / Chapter 3.4.2.2 --- Comparison of Drug Pre-sensitization Treatment in Sensitive and Oxaliplatin Resistant HCT116 Colorectal Cancer Cell Lines --- p.87 / Chapter 3.4.3 --- Drug Pre-sensitization Studies in Liver Cancer Cell Lines --- p.89 / Chapter 3.4.3.1 --- Comparison of Drug Pre-sensitization Treatment in Sensitive Liver Cancer Cell Lines --- p.99 / Chapter 3.4.3.2 --- Comparison of Drug Pre-sensitization Treatment in Sensitive and Cisplatin Resistant SK-Hepl Liver Cancer Cell Line --- p.101 / Chapter 3.5 --- Possible Explanation to the Observed Drug Combination Effect --- p.103 / Chapter 3.6 --- General Protocols for Drug Combinations --- p.105 / Chapter Chapter 4 --- Conclusions / Reference --- p.109 / Appendices --- p.121 / Chapter I a. --- "Raw Data of Pre-screening for HCT116 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.122 / Chapter I b. --- "Raw Data of Pre-screening for HCT116 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.123 / Chapter II a. --- "Raw Data of Pre-screening for SK-Hepl (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.124 / Chapter II b. --- "Raw Data of Pre-screening for SK-Hepl ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.125 / Chapter III a. i) --- "Isobolograms for HCT116 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.126 / Chapter III a. ii) --- "Raw Data for HCT116 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.127 / Chapter III b. i) --- "Isobolograms for HCT116 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.128 / Chapter III b. ii) --- "Raw Data for HCT116 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.129 / Chapter IV a. i) --- "Isobolograms for HCT1160xaR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.130 / Chapter IV a. ii) --- "Raw Data for HCT1160xaR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.131 / Chapter IV b. i) --- "Isobolograms for HCT1160xaR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.132 / Chapter IV b. ii) --- "Raw Data for HCT1160xaR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.133 / Chapter V a. i) --- "Isobolograms for HT29 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.134 / Chapter V a. ii) --- "Raw Data for HT29 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.135 / Chapter V b. i) --- "Isobolograms for HT29 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.136 / Chapter V b. ii) --- "Raw Data for HT29 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.137 / Chapter VI a. i) --- Isobolograms for Hep G2 (Cisplatin and [Pt(DMC)(NH3)2]) --- p.138 / Chapter VI a. ii) --- Raw Data for Hep G2 (Cisplatin and [Pt(DMC)(NH3)2]) --- p.139 / Chapter VI b. i) --- "Isobolograms for Hep G2 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.140 / Chapter VI b. ii) --- "Raw Data for Hep G2 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.141 / Chapter VII a. i) --- "isobolograms for SK Hep 1 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.142 / Chapter VII a. ii) --- "Raw Data for SK Hep 1 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.143 / Chapter VII b.i) --- "Isobolograms for SK Hep 1 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.144 / Chapter VII b. ii) --- "Raw Data for SK Hep 1 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.145 / Chapter VIII a. i) --- "Isobolograms for SK Hep ICisR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.146 / Chapter VIII a. ii) --- "Raw Data for SK Hep ICisR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.147 / Chapter VIII b. i) --- "Isobolograms for SK Hep ICisR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.148 / Chapter VIII b. ii) --- "Raw Data for SK Hep ICisR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.149

Page generated in 0.1155 seconds