Les Streptophyta et Chlorophyta forment le règne des plantes vertes. Les Chlorophyta se divisent en quatre classes: Prasinophyceae, Trebouxiophyceae, Ulvophyceae et Chlorophyceae. Le séquençage des génomes entiers d' organelles et l'étude de ces génomes permettent d'observer les tendances évolutives par rapport à leurs ancêtres et d' identifier les liens qui unissent les différents taxons. L' algue chlorophycéenne Chlamydomonas moewusii, membre de l'ordre des Chlamydomonadales, a un génome chloroplastique très grand et très réarrangé présentant de nombreuses séquences répétées. Quant à son génome mitochondrial, il est petit, compact et contient peu de gènes. Dans les deux cas, ces deux génomes contiennent peu de traits communs avec les génomes homologues apparentés, si ce n' est la divergence qu' ils ont par rapport avec leur ancêtre commun. La présente étude sur C. moewusii a permis de compléter et de vérifier les études précédentes, ainsi que d'apporter plus d'information sur les insertions, uniques au génome chloroplastique

Les plantes vertes se divisent en deux embranchements majeurs : Streptophyta et Chlorophyta. Les Chlorophyta comportent quatre classes d'algues vertes : Prasinophyceae, Ulvophyceae, Trebouxiophyceae et Chlorophyceae. Le séquençage de génomes complets d'organites est effectué dans notre laboratoire sous deux lignes directrices principales : (1) l'évolution des génomes d'organites par rapport à leur ancêtre commun respectif et (2) l'identification des liens évolutifs réunissant les différentes classes par l'analyse des protéines codées par ces génomes. Le séquençage et les analyses comparatives du génome chloroplastique de l'algue chlorophycéenne Stigeoclonium helveticum ont révélé un génome riche en caractéristiques dérivées et extrêmement réarrangé par rapport à ses homologues chez les Chlorophyceae; son génome mitochondrial présente quant à lui des caractères évolutifs intermédiaires dans l'évolution des Chlorophytes. L'apport de Stigeoclonium a également permis de souligner les traits distinctifs des génomes d'organites des Chlorophyceae ainsi que la position basale des Chaetophorales au sein de cette classe.

Titre de l'écran-titre (visionné le 5 septembre 2023) / L'instabilité génomique est considérée comme l'une des « caractéristiques du cancer ». Au cours des dernières décennies, divers processus de réparation de l'information génétique ont été découverts, nous permettant de mieux comprendre comment la dérégulation de ces processus peuvent conduire au développement du cancer. Notre groupe de recherche s'intéresse particulièrement au processus de réparation des cassures double-brin (DSBs) de l'ADN, la forme la plus nocive de dommages à l'ADN. La jonction d'extrémités non homologues canonique (c-NHEJ) et la recombinaison homologue (HR) sont les principales voies de réparation des DSBs. Afin d'enclencher la réparation des DSBs, les cellules régulent soigneusement le choix entre ces deux processus de réparation. Le processus de résection de l'ADN facilite le choix entre ces voies de réparation. La résection de l'ADN est caractérisée par la dégradation de l'ADN pour créer un long substrat d'ADNsb favorisant la réparation par HR. En revanche, l'inhibition de la résection de l'ADN favorise la réparation des DSB par la voie c-NHEJ. Les mutations de perte de fonction des protéines impliquées dans la facilitation de la résection de l'ADN conduisent souvent à des troubles génétiques et au développement de cancers. Le développement du cancer a souvent été associé à des mutations de BRCA1, une protéine impliquée dans la résection de l'ADN et le processus de réparation des RH. La létalité synthétique est devenue un concept important dans la réparation de l'ADN et la recherche sur le cancer. Il décrit le phénomène par lequel l'inactivation simultanée de deux événements conduit à la létalité cellulaire, même si chaque événement individuellement est toléré. Le traitement contre le cancer basé sur la létalité synthétique le plus efficace qui ait été développé jusqu'à présent utilise les inhibiteurs de PARP (PARPi). PARP-1 dans une protéine impliquée dans divers processus cellulaires, dont la régulation de la réparation de l'ADN. Il a été constaté que l'inhibition de PARP-1 est synthétiquement létale avec un déficit en HR. Les tumeurs déficientes en HR, sont sensibles aux PARPi alors que leurs homologues cellulaires normaux HR-compétents tolèrent le traitement. Cependant, bien qu'il s'agisse d'une option de traitement prometteuse, de nombreux patients développent encore une résistance aux PARPi. Une façon par laquelle les tumeurs déficientes en BRCA1 développent une résistance à PARPi est la réactivation de la résection de l'ADN. En l'absence de BRCA1 fonctionnel, les inhibiteurs de la résection de l'ADN empêchent l'utilisation de HR pour la réparation des DSBs. Des mutations de perte de fonction dans ces inhibiteurs de la résection de l'ADN entraînent la réactivation de la résection de l'ADN et de la HR. Par conséquent, il est important de comprendre la relation entre les protéines qui facilitent la résection de l'ADN et celles qui l'inhibent. Avec cette compréhension, de meilleures approches pour atténuer le développement de la résistance peuvent être développées. Dans cette thèse, nous approfondissons la relation entre l'inhibition de la résection de l'ADN et le développement de la résistance aux PARPi. Nous discutons du processus de résection de l'ADN et de la façon dont divers inhibiteurs de la résection de l'ADN fonctionnent pour inhiber la réparation par RH. Nous décrivons une méthode pour développer de nouveaux inhibiteurs chimiques qui peuvent être utilisés pour cibler MRE11, une composante importante de la machinerie de résection de l'ADN. De plus, nous avons identifié un nouvel inhibiteur de la résection de l'ADN, DYNLL1, et caractérisons son rôle dans l'inhibition de la résection de l'ADN. Enfin, nous contribuons davantage à la compréhension du mécanisme d'action d'un inhibiteur connu de la résection de l'ADN, RIF1. En outre, nous identifions une nouvelle interaction synthétique létale entre RIF1 et MRE11 qui pourrait être avantageuse dans le développement d'un nouveau traitement contre le cancer avec un défaut dans l'une ou l'autre des protéines. En résumé, nous décrivons de nouveaux mécanismes d'action pour la régulation négative de la résection de l'ADN impliquant DYNLL1 et RIF1. De plus, ces résultats placent MRE11 au cœur de la régulation de la résection de l'ADN, soulignant l'importance du développement de nouveaux inhibiteurs chimiques qui le ciblent. / Genomic instability is considered to be one of the "Hallmarks of Cancer". In recent decades, research on the topic has uncovered various DNA repair processes that cells use to maintain genome stability. This has also given us a better understanding of how errors from and dysregulation of these processes can lead to cancer development. Our research group is particularly interested in the repair process for DNA double-strand breaks (DSBs), the most harmful form of DNA damage. Canonical Non-Homologous End-Joining (c-NHEJ) and Homologous (HR) Recombination are the major DSB repair pathways. In order to facilitate proper DSB repair, cells carefully regulate the choice between these two repair processes. One manner in which cells facilitate the choice between these two pathways is through the process of DNA resection. DNA resection is the degradation of DNA following DSB induction to create a long ssDNA substrate that favours HR repair. In contrast, inhibition of DNA resection favours DSB repair through the c-NHEJ pathway. Loss-of-function mutations of proteins involved in facilitating DNA resection often lead to genetic disorders and cancer development. Cancer development has often been associated with mutations in BRCA1, a protein involved in the DNA resection and HR repair process. Synthetic lethality has become an important concept in DNA repair and cancer research. It describes the phenomenon wherein the simultaneous occurrence of two events leads to unviability or lethality, in this case of the cell, even though each event individually is tolerated. In cancer research, this has been taken advantage of when developing novel treatments particularly in cancer types with a frequently occurring mutation. The most successful synthetic lethality-based cancer treatment that has been developed thus far has been PARP inhibitors (PARPi). PARP-1 in a protein involved in various cellular processes, including the regulation of DNA repair. It was found that PARP-1 inhibition is synthetically lethal with a deficiency in HR. It was found that HR-deficient tumours, especially those with a loss-of-function mutations in BRCA1, are sensitive to PARPi treatment whereas their HR-proficient normal cell counterparts tolerated the treatment. In the clinic, this meant that patients with cancers that are BRCA1-deficient can be effectively treated with PARPi. However, although a promising treatment option, many of the patients still develop PARPi resistance requiring the need for other treatment options. It has been found that one manner in which BRCA1-deficient tumours develop PARPi-resistance is through the reactivation of DNA resection. In the absence of functional BRCA1, DNA resection inhibitors prevent the use of HR for the repair of DSBs. One of the ways these tumours develop PARPi-resistance is by developing loss-of-function mutations in these DNA resection inhibitors. These mutations lead to the reactivation of DNA resection and HR. Therefore, it is important to understand the relationship between proteins that facilitate DNA resection and those that inhibit it. With this understanding, better approaches for mitigating development of resistance can be developed. To further understand the relationship between DNA resection inhibition and PARPi-resistance development, we discuss what is known in the literature about the DNA resection process and how various DNA resection inhibitors work in order to inhibit HR repair. We describe a method for developing novel chemical inhibitors that can be used to target DNA repair proteins using MRE11--an important component of the DNA resection machinery--as an example. Furthermore, we identify a novel DNA resection inhibitor, DYNLL1, and characterize its role in DNA resection inhibition. Lastly, we contribute further to the understanding of the mechanism of action of a known DNA resection inhibitor, RIF1. Furthermore, we identify a novel synthetic lethal interaction between RIF1 and MRE11 that could be advantageous in the development of novel cancer treatment with defect in either protein. In summary, we describe novel mechanisms of action for the negative regulation of DNA resection involving DYNLL1 and RIF1. Furthermore, these results put MRE11 at the heart of DNA resection regulation highlighting the importance of development of novel chemical candidates that target it.

Con la finalidad de estandarizar una prueba para la determinación del sexo en guacamayos se procedió a extraer de 25 – 50 ng. de ADN genómico de sangre de 31 aves previamente sexadas, pertenecientes a 5 especies de guacamayos (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris y Propyrrhura couloni) provenientes del Patronato del Parque de Las Leyendas (PATPAL) y de un zoocriadero privado, mediante un kit de extracción de ADN (Wizard ® Promega). El método empleado fue la técnica del PCR la cual amplificó un fragmento del gen CHD del cromosoma W presente solo en aves hembras (CHD-W), utilizando a los cebadores P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) y P8 (5´- CTCCCAAGGATGAGRAAAYTG – 3´ R igual A / G, Y igual T / C) capaces de amplificar regiones no conservadas (intrones) de este gen, lo cual lo diferencia de su gen homólogo presente en los machos (CHD-Z). La amplificación se llevó a cabo tras la optimización de las condiciones y los ciclos termales, partiendo de las condiciones descritas por Griffiths et al., (1998). Los productos obtenidos fueron separados en gel de agarosa al 3% (Promega) utilizando un sistema de electroforesis horizontal (Hybaid) y visualizados mediante fluorescencia con bromuro de etidio a través de la luz ultravioleta, con lo cual se pudo observar 2 fragmentos en aves hembras y 1 fragmento en aves machos, estos fragmentos estuvieron comprendidos entre 300 - 400 bps. En este grupo se logró sexar a las 31(100%) aves y se obtuvo un 100% de compatibilidad entre los resultados obtenidos por métodos convencionales y por análisis de ADN. Posteriormente se procedió a sexar 28 guacamayos sin sexo conocido, bajo las condiciones anteriormente descritas, lográndose determinar el sexo de estas. Palabras Claves: gen CHD; Cebadores P2 y P8; Guacamayos; Sexo. / --- With the purpose of standardizing a test for the determination of the sex in macaws we proceeded to extract of 25-50 ng. of genomic DNA from the blood of 31 birds previously sexed, belonging to 5 species of macaws (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris and Propyrrhura couloni) coming from the Patronato del Parque de Las Leyendas Zoo and a private center, using an extraction kit of DNA (Wizard ® Promega). The used method was the technique of the PCR which amplified a fragment of the CHD gene of the female exclusive chromosome W (CHD-W), using the P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) and P8 (5´- CTCCCAAGGATGAGRAAAYTG-3´ R same A / G, Y same T / C) primers, which are able to amplify not conserved regions (introns) of this gene. This differentiates it of its male homologous gene (CHD-Z). The amplification was carried by the optimization of the conditions and the thermal cycles. It was based on the conditions described by Griffiths et al. (1998). The obtained products were separated in agarosa gel to 3% (Promega) using a horizontal electrophoresis system (Hybaid) and visualized by fluorescence with etidio bromide through the ultraviolet light. Then we can see 2 fragments in female birds and only one in male birds, these fragments were between 300 - 400 bps. In this group 31(100 %) birds were sexing and we obtain 100% of compatibility between the conventional methods and DNA analysis. Finally, with the conditions previously described we sex 28 macaws with unkowned sex Key Words: CHD gene; P2 and P8 Primers; Macaws; Sex.

Thèse (M.Sc.)--Université Laval, 2005. / Titre de l'écran-titre (visionné le 23 février 2006). Bibliogr.

Bostryx scalariformis (Mollusca, Gastropoda) es un molusco terrestre endémico de las lomas costeras de la costa central del Perú que habita principalmente las zonas arenosas. Sólo se encuentran individuos vivos en las siguientes lomas del departamento de Lima: Ancón, Pasamayo, Lachay y Cerro de Agua. Además, posee morfotipos geográficamente aislados, uno en Ancón-Pasamayo y el otro en Lachay-Cerro de Agua. La fragmentación de su hábitat y la disminución en su tamaño poblacional pueden haber conllevado al decremento en su diversidad genética y una diferenciación genética entre sus poblaciones. El objetivo principal de esta investigación fue evaluar la diversidad genética en B. scalariformis comparándola con su distribución geográfica y morfotipos, para así obtener información sobre la estructura genético-poblacional de la especie. Para ello, se realizó un análisis morfométrico del diseño de la concha en 200 individuos. De las 10 variables utilizadas, 8 fueron digitalizadas y procesadas para encontrar las distancias entre los puntos de medición; a este conjunto se sumaron las variables: número de costillas por cada 3 mm y número de vueltas. Luego, se utilizaron individuos colectados vivos para la extracción de DNA total a partir de tejido del músculo del pie y se realizaron las amplificaciones del gen mitocondrial 16S rRNA por PCR. Los productos de amplificación fueron secuenciados y las secuencias obtenidas se utilizaron en el análisis filogenético intraespecífico y poblacional. / Bostryx scalariformis (Mollusca, Gastropoda) is a land snail species from central Peru. It is endemic to coastal "lomas" ecosystem and inhabits mainly in sand formations. Alive individuals have only been found in Ancon, Pasamayo, Lachay and Cerro de Agua lomas from Lima department. This species has two morphotypes, which in turn are geographically isolated, one morphotype inhabits in Ancon-Pasamayo lomas and the other one in Lachay-Cerro de Agua. Habitat fragmentation and decreasing of population size could have lead to reduction of genetic diversity and to genetic differentiation between its populations. The aim of this research was to evaluate genetic diversity in B. scalariformis comparing it with both its geographical distribution and morphotypes, in order to know about its population genetic structure.

La Zona Pelúcida es la matriz extracelular que rodea a los ovocitos de vertebrados, cumple roles trascendentales en la reproducción, incluyendo el reconocimiento y unión de gametos especie-específico, inducción de la reacción acrosómica (RA) del espermatozoide, el bloqueo de la poliespermia, mantiene la integridad del embrión temprano durante su transición por el oviducto; está constituida por tres glicoproteínas: ZP3 que induce RA; ZP1, estructural, que interconecta a ZP3 y ZP2. ZP2 es la molécula de unión secundaria, interactúa con los receptores espermáticos expuestos después de RA siendo necesaria para mantener la unión del espermatozoide al ovocito, su modificación proteolítica después de la fertilización permite el bloqueo de la poliespermia. ZP2 participa también en la organización, el desarrollo y maduración del ovocito, puesto que mantiene consistente la matriz y la interacción entre las células periféricas y la célula germinal. Se caracterizó y analizó in silico la secuencia codificante parcial de la glicoproteína de Zona Pelúcida tipo 2 (aZP2) en alpacas, se determinó que esta proteína se expresa exclusivamente en los ovarios. Además está secuencia parcial analizada se encuentra conservada, constituyéndose un grupo monofilético entre los Cetarteodactyla. La presente Tesis aporta conocimiento básico sobre la glicoproteína aZP2 en alpacas, proteína implícita en la fecundación, conocerla implícitamente beneficia el mejoramiento de las actuales técnicas biotecnológicas reproductivas tales como la maduración folicular-ovocitaria, criopreservación de gametos y embriones, fertilización in vitro e inyección intracitoplasmática del espermatozoide, técnicas que se intentan aplicar con muchas dificultades en camélidos. / The zona pellucida is a extracellular matriz that surrounds vertebrate oocytes, and plays important roles in the recognition and interaction of gametes specie- specific, induction of Acrosome Reaction (AR) of the spermatozoa, block to polyspermy, keeps th integrity of the early embryo through its transicion by the oviduct; It is composed of three glycoproteins: ZP3 that induces RA; ZP1, structural, crosslink ZP3 and ZP2. ZP2 acts as a secondary sperm receptor that is necessary for the maintenance of sperm binding to the egg, its proteolytical modification after fertilization permits the block to polyspermy ZP2 participates also in the organization, development, maturation of the oocyte beacuse it keeps consistently the matrix and the interaction between peripherical cells with the germ cell. We isolated and analized in silico a partial coding secquence of the glycoprotein of type 2 (aZP2) in alpacas, we determined that this protein is express exclusively in the ovaries. Also this amalized partial secquence is conserved, constituting a monophyletic group between Cetarteodactyla. This thesis work provides basic knowledge on the glycoprotein a ZP2 in alpacas, a protein implicitly involved in fertilization, to know it benefits the improvement of existing reproductive biotechnology techniques such as the follicular-oocyte maturation, cryopreservation of gametes and embryos in vitro fertilization and injection of intracytoplasmic sperm, techniques that are trying to be implemented with many difficulties in camelids.

Con la finalidad de estandarizar una prueba para la determinación del sexo en guacamayos se procedió a extraer de 25 – 50 ng. de ADN genómico de sangre de 31 aves previamente sexadas, pertenecientes a 5 especies de guacamayos (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris y Propyrrhura couloni) provenientes del Patronato del Parque de Las Leyendas (PATPAL) y de un zoocriadero privado, mediante un kit de extracción de ADN (Wizard ® Promega). El método empleado fue la técnica del PCR la cual amplificó un fragmento del gen CHD del cromosoma W presente solo en aves hembras (CHD-W), utilizando a los cebadores P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) y P8 (5´- CTCCCAAGGATGAGRAAAYTG – 3´ R igual A / G, Y igual T / C) capaces de amplificar regiones no conservadas (intrones) de este gen, lo cual lo diferencia de su gen homólogo presente en los machos (CHD-Z). La amplificación se llevó a cabo tras la optimización de las condiciones y los ciclos termales, partiendo de las condiciones descritas por Griffiths et al., (1998). Los productos obtenidos fueron separados en gel de agarosa al 3% (Promega) utilizando un sistema de electroforesis horizontal (Hybaid) y visualizados mediante fluorescencia con bromuro de etidio a través de la luz ultravioleta, con lo cual se pudo observar 2 fragmentos en aves hembras y 1 fragmento en aves machos, estos fragmentos estuvieron comprendidos entre 300 - 400 bps. En este grupo se logró sexar a las 31(100%) aves y se obtuvo un 100% de compatibilidad entre los resultados obtenidos por métodos convencionales y por análisis de ADN. Posteriormente se procedió a sexar 28 guacamayos sin sexo conocido, bajo las condiciones anteriormente descritas, lográndose determinar el sexo de estas. Palabras Claves: gen CHD; Cebadores P2 y P8; Guacamayos; Sexo. / With the purpose of standardizing a test for the determination of the sex in macaws we proceeded to extract of 25-50 ng. of genomic DNA from the blood of 31 birds previously sexed, belonging to 5 species of macaws (Ara ararauna, Ara chloropthera, Ara macao, Ara militaris and Propyrrhura couloni) coming from the Patronato del Parque de Las Leyendas Zoo and a private center, using an extraction kit of DNA (Wizard ® Promega). The used method was the technique of the PCR which amplified a fragment of the CHD gene of the female exclusive chromosome W (CHD-W), using the P2 (5´- TCTGCATCGCTAAATCCTTT - 3´) and P8 (5´- CTCCCAAGGATGAGRAAAYTG-3´ R same A / G, Y same T / C) primers, which are able to amplify not conserved regions (introns) of this gene. This differentiates it of its male homologous gene (CHD-Z). The amplification was carried by the optimization of the conditions and the thermal cycles. It was based on the conditions described by Griffiths et al. (1998). The obtained products were separated in agarosa gel to 3% (Promega) using a horizontal electrophoresis system (Hybaid) and visualized by fluorescence with etidio bromide through the ultraviolet light. Then we can see 2 fragments in female birds and only one in male birds, these fragments were between 300 - 400 bps. In this group 31(100 %) birds were sexing and we obtain 100% of compatibility between the conventional methods and DNA analysis. Finally, with the conditions previously described we sex 28 macaws with unkowned sex Key Words: CHD gene; P2 and P8 Primers; Macaws; Sex.

Dissertation--Institut für Anthropologie--Mainz--Johannes Gutenberg-Universität. / Bibliogr. p.183-202.

Thèses (Ph.D.)--Université de Sherbrooke (Canada), 2001. / Titre de l'écran-titre (visionné le 20 juin 2006). Publié aussi en version papier.