Thesis (Microbiology)--University of Limpopo, 2008 / Twenty three phytase producing yeasts were isolated from soil in the Limpopo Province. The Limpopo Province has been found to be an ideal source of yeast able to function at high temperatures. The focus of this study was to profile the yeast isolates in terms of their phytase activities in order to confirm and establish the organism with the highest phytase activities. Three best phytase producing yeasts, HBD6.2, LD9 and LD7 were selected for further studies and illustrated activities of 676.02, 630.21 and 440.94 U.ml-1, respectively. HBD6.2, LD9 and LD7 were identified as Candida guilliermondii, Candida diddensiae and Candida famata, respectively, using standard conventional identification methods and PCR-RFLP was used to confirm the identities of these yeast isolates. Six known yeast strains obtained from the yeast culture collection (University of the Free State) were used as reference strains in the analysis. Pichia guilliermondii Y0209, Pichia guilliermondii Y0053 and Pichia guilliermondii Y0054 were used as reference strains for HBD6.2; Candida diddensiae for LD9; Debaryomyces hansenii Y0210 and Debaryomyces hansenii Y0610 as the reference strains for LD7. Eleven restriction digestion profiles used generated 84 markers with primers NS1 (5′ GTAGTCATATGCTTGTCTC 3′) and ITS2 (5′ GCTGCGTTCTTCATCGATGC 3′). The similarity matrix was generated with the DICE coefficient using the NTSYS (pc) program. The genetic distance between the taxa was used to generate a UPGMA (unweighted pair group method using arithmetic averages) phylogenetic tree with a bootstrap of 100 replications using the Treecon program. The three test yeasts did not cluster with their reference strains, however, C. guilliermondii HBD6.2 clustered closely with C. diddensiae Y0774 at a bootstrap value of 90 and have a similarity level of 100 %. C. diddensiae LD9 and C. diddensiae Y0774 are both within the same cluster separated by a bootstrap of 65, but shared a genetic similarity of 87 %. Candida famata LD7 was found to be distantly related to all the yeast strains and it was only genetically similar to its reference strains D. hansenii Y0209 and D. hansenii Y0610 at 51 % and 48 %, respectively. To determine the optimal growth and enzyme activities, the three yeast isolates were grown in PSM broth in shake flasks at temperature ranges of 25, 30 and 35º C and the following pHs 4.0, 4.5, 5.0, 5.5 and 6.0, for each temperature. The optimum growth temperature of the three test yeasts was 30º C for HBD6.2 at pH 5.5, LD9 at pH VI 6.0, and LD7 at pH 5.5 or 6.0. The maximum enzyme activity was also obtained when the organisms were grown at 30º C. Maximum enzyme activity for HBD6.2 and LD9 was reached at pH 5.0 or 6.0, LD7 at pH 5.5 or 6.0. Phytases from all three yeast isolates were stable at 35º C, pH 5.5 for an average of 3 hrs retaining almost 80 % residual activity under these optimal conditions. / National Research Foundation

No description available.

No description available.

Made available in DSpace on 2014-06-11T19:32:54Z (GMT). No. of bitstreams: 0 Previous issue date: 2005-04-18Bitstream added on 2014-06-13T20:04:35Z : No. of bitstreams: 1 ruivo_ccc_dr_rcla.pdf: 3407189 bytes, checksum: 12661371c25b663cd051faf1d555f863 (MD5) / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) / No período de março de 1999 a fevereiro de 2002, foram coletadas 311 flores e 72 frutos de 19 espécies vegetais nativas de Mata Atlântica na região de Ubatuba, SP - núcleo Picinguaba, com o objetivo de descrever as espécies de leveduras presentes. Os locais de coleta abrangeram uma grande extensão de áreas de mata de encosta, planície, restinga e beira mar. Ainda, 75 amostras da água acumulada nos tanques de outras duas espécies vegetais foram analisadas com o mesmo objetivo. Trezentas e vinte e seis linhagens de leveduras foram isoladas, das quais, 75,8% apresentaram afinidade ascomicética e 24,2% basideomicética. O gênero Candida foi predominante, seguido por Metschnikowia, Hanseniaspora, Bullera e Cryptococcus. Entre os ascomicetos e seus anamorfos, 37 espécies foram identificadas, sendo que a espécie mais freqüentemente isolada em flores e frutos foi Hanseniaspora uvarum, com 22 e 20 isolados, respectivamente. Outras espécies que também foram isoladas com freqüência em flores foram Bullera unica e Metschnikowia koreensis. Como esperado, muitas das linhagens isoladas não se enquadraram dentro dos padrões descritos na literatura e, nesses casos, as mais freqüentes tiveram a região do domínio D1/D2 do rDNA seqüenciada. Todos os oito isolados da nova espécie Candida leandrae foram obtidos a partir de frutos de Leandra reversa (Melastomataceae), sugerindo forte associação entre ambos. Das amostras da água de tanque foram isoladas cinco novas espécies. De Canistropsis seidelii (Bromeliaceae) foram descritas duas novas espécies: Candida bromeliacearum e Candida ubatubensis. A partir de Heliconia velloziana (Heliconiaceae) foram descritas Candida heliconeae, Candida picinguabensis e Candida sanpauloensis. Alguns isolados designados como Candida sp. A, B, C, D, E, F, G, H, I e Debaryomyces sp. A, B, C e outros, também não corresponderam às características das espécies-padrão descritas na literatura e ainda não foram seq / From March of 1999 to February of 2002, 311 flowers and 72 fruits of 19 native plant species of the Atlantic Forest in the region of Ubatuba, SP Picinguaba area were sampled for the presence of yeasts. The sites of collection included a great extension of coastal areas like hillsides, plains, restinga and seashores. Seventy five samples of the water accumulated in the tank of two other plant species were also examined. Three hundred and twenty six yeast strains were isolated, with 75.8% being ascomycetes and 24.2% basideomycetes. The genus Candida was predominant, followed by Metschnikowia, Hanseniaspora, Bullera and Cryptococcus. Regarding the ascomycetous and their anamorphs, 37 species were identified, and Hanseniaspora uvarum was the prevalent in flowers and fruits, with 22 and 20 isolated respectively. Bullera unica and Metschnikowia koreensis were also frequently isolated from flowers. As expected, many of the strains did not fit the standard found in literature and most of them had their D1/D2 domain of rDNA sequenced. All the eight strains of new species, Candida leandrae were isolated from fruits of Leandra reversa (Melastomataceae), suggesting a strong association between them. Another five new species were isolated from tank water as follows: Candida ubatubensis and Candida bromeliacearum from Canistropsis seidelii (Bromeliaceae) and Candida heliconeae, Candida sanpauloensis and Candida picinguabensis from Heliconia velloziana (Heliconiaceae). Some strains previously identified as Candida sp. A, B, C, D, E, F, G, H, I and Debaryomyces sp. A, B, C and others, could not be identified as well but they were not sequenced to date.

No description available.

No description available.

No description available.

No description available.

No description available.

No description available.