Platinum complexes (cisplatin, carboplatin and oxaliplatin) are effective anticancer agents. However the major drawbacks of platinum chemotherapy are toxic side effects and resistance. The affinity of platinum complexes to sulfur donor ligands of side chains of methionine and cysteine amino acids was assumed to be responsible for toxicity and resistance. Recently, it was found that the reaction of platinum complex with proteins containing sulfur donor ligands could actually favor its anticancer activity. Copper transporter 1 (Ctr 1), a protein involved in the transport of copper into the cell, also helps in the influx of cisplatin by binding to N-terminal domain of Ctr 1 which is rich in methionine and histidine residues. A better understanding of how the size and shape of amine ligand, and leaving groups affect the reaction of platinum (II) complexes with methionine could give new ways to optimize its anticancer activity. This preliminary research focuses to answer this by HPLC-UV-VIS analysis of bulky platinum complexes including [Pt(dien)Cl]Cl, Pt(Me4en)(NO3)2 and Pt(en)(NO3)2 with two methionine containing small peptides that serve as models for protein interactions.

Bone marrow transplantation (BMT) involves the use of maximal doses of chemotherapy and total body irradiation. As a result, even well-nourished patients exhibit negative nitrogen balance and hypoproteinemia in the post-transplant period, despite a high energy and protein intake from Total Parenteral Nutrition (TPN). The purpose of this research was to investigate the impact of cytotoxic therapy, with a view toward explaining and improving the response to nutritional support. Stool, urine and serum biochemistry were studied prospectively in 10 BMT patients. Analysis of stool revealed increased sodium and decreased potassium. Examination of serum electrolytes indicated hyponatremia and hyperkalemia. A significant decrease in nitrogen balance, serum albumin and net protein utilization immediately followed the disturbances in serum electrolytes; improvement began as serum sodium and potassium returned to normal. Thus, electrolyte imbalance may have reduced the capacity of cells to utilize nitrogen. Lowering the volume of TPN dramatically decreased serum electrolyte aberrations and improved nitrogen utilization.

The emergence of multidrug resistant tumours during the course of chemotherapeutic treatment of cancer patients is a major obstacle in cancer chemotherapy. Although several mechanisms may contribute to the appearance of multidrug resistance phenotype (MDR) in tumour cells, reduced drug accumulation and the ability of cells to undergo apoptosis are thought to be very important in expression of MDR. The work in this thesis focuses on the mechanism responsible for the reduced drug accumulation in tumour cells, mainly the multidrug resistance protein (MRP1). / The molecular mechanism underlying the binding and efflux of drugs by the MRP1 is currently not well understood. Several studies have now demonstrated that the cysteinyl leukotriene C$ sb4$ (LTC$ sb4$) and other glutathione (GSH) S-conjugated anions are substrates for the MRP. To learn more about MRP-drug interactions, we characterized the binding of MRP to a non-glutathione photoactive quinoline compound (abbreviated, ASA-AQ) (Chapter II). Since MRP mediated multi-drug resistance can be modulated by the anionic quinoline LTD$ sb4$ cysteinyl leukotriene receptor antagonist (MK571), we speculated that other quinoline-based compounds are likely to interact with MRP. In Chapter III, we show that MDR cells that express MRP1 are more resistant to the antimalarial drug, chloroquine. We also show that. chloroquine is a substrate for MRP1 drug efflux. / Taken together, the results of this thesis describe the interactions of MRP1 with a quinoline-based photoactive drug and the antimalarial drug chloroquine.

ABSTRACT MULTIDRUG RESISTANCE IN LOCALLY ADVANCED BREAST CANCER ATALAY, Mustafa Can Ph. D., Department of Biotechnology Supervisor: Prof. Dr. Ufuk G&Uuml / ND&Uuml / Z June 2004, 70 pages Breast cancer is the most frequently detected cancer among women. Early diagnosis leads to long term survival when the patients are treated with surgery, radiotherapy, chemotherapy, and hormone therapy. Unfortunately, advanced disease could still be encountered in some patients resulting in a poorer prognosis. The primary treatment modality is chemotherapy for this group of patients. Drug resistance is a serious problem resulting in the use of different drugs during chemotherapy and knowing the possibility of resistance before initiating first line chemotherapy may save time and money, and most importantly, may increase patient&rsquo / s survival. Therefore in this study, multidrug resistance is studied in locally advanced breast cancer patients. The breast tissues obtained from 25 patients both before and after chemotherapy were examined for drug resistance. Reverse transcriptase polymerase chain reaction was used for the detection of mdr1 and mrp1 gene expression. In addition, immunohistochemistry technique was used for P-glycoprotein and MRP1 detection. JSB-1 and QCRL-1 monoclonal antibodies were utilized to detect P-glycoprotein and MRP1, respectively. Five patients were unresponsive to chemotherapy. In four of these patients mdr1 gene expression was induced by chemotherapy where as the fifth patient initially had mdr1 gene expression. In addition, Pgp positivity was detected in 9 patients after chemotherapy. Both the induction of mdr1 gene expression (p&lt / 0.001) and Pgp positivity (p&lt / 0.001) during chemotherapy were significantly related with clinical response. On the other hand, mrp1 gene expression and MRP1 positivity were detected in 68% of the patients before the therapy. After chemotherapy, mrp1 expression increased to 84%. Although 80% of the clinically unresponsive patients had mrp1 gene expression, the relation between mrp1 expression and clinical drug response was not strong. Thus, it can be concluded that in locally advanced breast cancer mdr1 gene expression during chemotherapy contributed to clinical unresponsiveness. However, mrp1 gene expression did not correlate strongly with the clinical response. When RT-PCR and immunohistochemistry methods are compared in terms of detection of drug resistance, it seems that both methods gave similar and reliable results.

The use of metallo-pharmaceuticals, such as the platinum drugs, for cancer treatment illustrates the utility of metal complexes as therapeutic agents. Platinum group metal complexes therefore offer potential as anti-tumour agents to fight cancer. This study was aimed at synthesizing and evaluating the effects of palladium(II) and platinum(II) complexes as anticancer agents.

Neuroblastoma (NB) is the most common solid tumor of early infancy. Despite a significant improvement in the general survival rate for children with cancer, the prognosis of high-risk NB remains low, at about 30%, despite the use of intensive chemo-radiotherapy followed by differentiation therapy with retinoic acid (RA). Relapses in this category of NB are often due to the emergence of multi-drug and RA-resistant minimal residual cancer cells. The use of natural 13-cis RA, as a single chemo-preventive agent, has improved the survival rate to 50% for high-risk NB patients. However, the prevalence of RA-resistance is high in high-risk NB, and in solid cancers, in general. RA-resistance in cancer cells is mediated by a number of factors. Loss of RA-induced expression of the putative tumor suppressor gene, retinoic acid receptor-beta (RARβ), is one of the most common factors that have been reported in RAresistant phenotypes of a wide range of cancer cells. The transcriptional regulation of RAR(β) gene and other retinoid responsive-genes is believed to be regulated by the ligand-dependent transactivation of the homo- or heterodimer complexes of the retinoic acid receptor (RAR) and retinoid X receptor (RXR) subtypes, namely alpha (α), beta (β) and gamma (γ). It is believed that the anti-cancer activities of natural all-trans RA and 13-cis RA are mediated through activation of RAR-complexes. The loss of RA-induced RAR β expression can be caused by aberrant recruitment of chromatin structure modifying enzymes, histone deacetylases (HDACs), which have major roles in the global regulation of gene transcription. However, the mechanism of RA-resistance in NB cells is unclear. This thesis set out to identify the molecular mechanism of RA-resistance and to develop a new therapeutic approach to overcome RA-resistance in NB cells. The data in this thesis demonstrated that deregulation or over-expression of proto-oncogene MYCN caused a total RA-resistance in NB cells in vitro and in vivo, despite the strong induction of RARI3 expression. The data also indicated that the activation of RAR-dependent pathways by aRA or 13RA alone is not sufficient to overcome MYCN-mediated RA-resistance in NB cells. In the light of this observation, this thesis went on to examine whether combined targeting activation of RAR and RXR subtypes with receptor specific ligands could enhance the therapeutic efficacy of the retinoid signaling pathway. NB cells were treated with a panel of receptor-specific retinoids, namely aRA, l3RA, 9RA (RAR-specific), CD 417, CD 2314 (RARβ-specific), CD 666 (RARγ-specific), CD 336 (RARα-specific), CD 3640, CD 2872 (RXR-specific), as a single agent or in combination at a low concentration of 0.1 ??M. The results showed that combined targeting activation of RARα and RXR was not only the most effective combination, but also overcame MYCN-mediated RA-resistance in NB cells in vitro.Collectively, these data demonstrated the combined targeting activation of RAR and RXRs as a new approach to enhance the efficacy of retinoid therapy and overcome RA-resistance in the treatment of high-risk NB, and other cancers. The emerging therapeutic potential of HDAC inhibitors (HDACi) as front line anti-cancer agents, or adjuvants to other agents such as RA, has suggested a new approach in the treatment of cancer. However, the molecular mechanism of the remarkably specific anticancer actions of HDACi is still largely speculation. The data presented in this study was the first to demonstrate a novel sequential order and the dosage-dependent roles of basal p21Wafl expression and G2/M arrest as protective mechanisms against HDACi-induced apoptosis. In addition, this thesis also examined and compared the therapeutic efficacy of HDACi as a single agent and in combination with other anti-cancer agents such as RA, IFNα and chemotherapeutic agents. Evaluation of the therapeutic effects of combinations of aRA, IFN and HDACi showed that combination of HDACi and IFNα exhibited the strongest synergy against NB cells in vitro. Treatment of MYCN transgenic mice, which consistently develop abdominal NB tumors that closely mirror the human disease in both physiological and biological aspects, with hydroxamic acid-based HDACi, trichostatin A (TSA), alone reduced tumor growth by nearly 50%, compared to the solvent control and IFNα alone, which had no effect on NB tumor growth. The most exciting finding was that the combination of HDACi and IFNα synergistically reduced tumor mass and angiogenesis by over 80% without any apparent systemic side-effects. The therapeutic effect of treatment with HDACi correlated with the induction of acetylation of histone 4 protein (H4) in both tumor and organ tissues, indicating a wide therapeutic index for HDACi in vivo. Collectively, the data in this study have demonstrated basal p21 Wafl expression as a potential marker of sensitivity to HDACi-based therapy, and the therapeutic efficacy of a novel combination of HDACi with IFNα in vivo. These preclinical data have provided an evidence-based rationale for a clinical trial of the combination of HDACi and IFNα in the treatment of high risk NB.

Bibliography: leaves 144-163 / xi, 163 leaves : / Title page, contents and abstract only. The complete thesis in print form is available from the University Library. / Thesis (M.D.)--University of Adelaide, 1985

[Truncated abstract] The Phase II clinical candidate, [(trans-Pt(NH3)2Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) shows a unique binding profile when compared to the anticancer agent cis-[Pt(NH3)2Cl2] (cisplatin) and dinuclear platinum complexes of the general formula [(trans-Pt(NH3)2Cl)2(H2N(CH2)nNH2)]2+. There is evidence that the increased efficacy of 1,0,1/t,t,t results from the presence of the charged central linker, which can alter the mode of binding to DNA. This alternate binding mode may be due to an electrostatic and hydrogen bonding association of the central platinum moiety in the minor groove that occurs prior to covalent binding (termed “pre-association”) . . . This research shows that 0,0,0/t,t,t is an adequate model to study the pre-association process of 1,0,1/t,t,t and that it binds in the minor groove of DNA. Therefore it is likely that 1,0,1/t,t,t pre-associates in the minor groove of DNA prior to covalent binding. This work supports the conclusions reached in NMR studies of the binding of 1,0,1/t,t,t with the 1,4-GG sequence (Qu et al. JBIC. 8, 19-28 (2003)), which showed simultaneous binding in the major and minor groove. The findings of the current work may also explain the observed binding mode of 1,0,1/t,t,t, which can bind to DNA in both the 3',3' and 5',5' directions (Kasparkova et al. JBC. 277, 48076-48086 (2002)). These unique binding characteristics are thought to be responsible for the increased efficacy of 1,0,1/t,t,t, and in light of the current results the observed binding mode most likely stems from the electrostatic pre-association of the central platinum moiety.

[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,&sup15N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.

Syntheses of Schiff bases were carried out by reacting salicylaldyhde, ortho-vanillin, para-vanillin or vanillin with aniline, 1-aminonaphthalene, 4- and 3-aminopyridine, and also with 2- and 3-aminomethylpyridine. The various Schiff bases obtained from the condensation reaction were reacted with CoCl₂.6H₂0, triethylamine stripped CoCl₂.6H₂0 or Co(CH₃COO)₂ to form cobalt(Il) complexes of ratio 2:1. The complexes obtained from cobalt chloride designated as the "A series" are of the general formulae ML₂X₂.nH₂0 , (L = Schiff base, X = chlorine) while those obtained from cobalt acetate or triethylamine stripped cobalt chloride denoted as "B" and C" are of the general formulae ML₂. nH₂0. The few complexes that do not follow the general formulae highlighted above are: IA [M(HL)₃.Cl₂], (L = N-phenylsalicylaldimine), 4A = (MLCl₂), (L = N-phenylvanaldiminato), 7 A and 21 A (ML₂), (L = N-naphthyl-o-vanaldiminato, and N-methy-2-pyridylsalicylaldiminato respectively), 8A = MLCI, (L = N-naphthylvanaldiminato), 12A = M₂L₃Cl₂, (L = N-4-pyridylvanaldiminato), 15A (MLCI), (L = N-3-pyridyl-o-vanaldiminato). The ligands and their complexes were characterized using elemental analyses and cobalt analysis using ICP, FT-IR spectroscopy (mid and far-IR), NIR-UV/vis (diffuse reflectance), UV/vis in an aprotic and a protic solvents, while mass spectrometry, ¹HNMR and ¹³CNMR, was used to further characterized the ligands. The tautomeric nature of the Schiff bases were determined by examining the behaviour of Schiff bases and their complexes in a protic (e.g. MeOH) and non-protic (e.g. DMF) polar solvents. The effects of solvents on the electronic behaviour of the compounds were also examined. Using CDCl₃, the NMR technique was further used to confirm the structures of the Schiff bases. The tentative geometry of the complexes was determined using the spectra information obtained from the far infrared and the diffuse reflectance spectroscopy. With few exceptions, most of the "A" series are tetrahedral or distorted tetrahedral, while the "B + C" are octahedral or pseudooctahedral. A small number of complexes are assigned square-planar geometry owing to the characteristic spectral behaviour shown. In order to determine their biological activity, two biological assay methods (antimicrobial testing and brine shrimp lethality assay) were used. Using disc method, the bacteriostatic and fungicidal activities of the various Schiff bases and their respective complexes to Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa as well as Aspergillus niger, were measured and the average inhibition zones are tabulated and analysed. Both the Schiff bases and their complexes showed varying bacteriostatic and fungicidal activity against the bacteria and fungus tested. The inhibition activity is concentration dependent and potential antibiotic and fungicides are identified. To determine the toxicity of the ligands and their corresponding cobalt(II) complexes, brine shrimp lethality assay was used. The LD₅₀ of the tested compounds were calculated and the results obtained were tabulated for comparison.