The experimental cancer therapeutic agent gadolinium texaphyrin (MGd) is a cationic paramagnetic expanded porphyrin currently being tested as an X-Ray sensitizing (XRS) agent, and is a compound with demonstrated tumor localization. Additionally MGd shows promise as a chemotherapeutic agent, both as a stand-alone agent, and showing activity in vitro with ascorbate via a novel ROS generating mechanism.3 This dissertation reports the synthesis, characterization, and cell studies of novel MGdfluorophore, and platinum therapeutic conjugates. Also discussed are cationic Pt agents having cytotoxic activity. In this research we set out to answer three questions: i) can fluorescent conjugates of MGd be synthesized, with observable subcellular localization, different from that of MGd, ii) can MGd-Pt conjugates with observable Pt release be synthesized?, and iii) can Pt compounds containing a cationic moiety be tuned to have efficacy comparable to traditional Pt therapeutic agents? Two MGd-xanthene fluorophore conjugates were synthesized with the goal of using them to probe sub-cellular distribution. The anionic (FITC), and cationic (Rhodamine), fluorophore conjugates demonstrated nuclear and mitochondrial localization, respectively. In an ongoing project designed to reduce non-specific agent toxicity, a platinumreleasing MGd therapeutic conjugate was synthesized. The MGd-amidopropylmalonato-Pt conjugate demonstrated efficacy equivalent to carboplatin, a classical “non-selective” agent as inferred from in-vitro studies with A549 lung cancer cells. Aqueous stability studies of this conjugate gave results in agreement with hydrolytic loss of Pt, reversible with added Pt-diaquo. Finally, Pt complexes of amino-1-benzylpyridinium salts were synthesized and found to demonstrate significant cytotoxicity in screening studies. This latter positive development led to the suggestion that complexes of this type could consititute a new class of lipophilic-quaternary-cation Pt therapeutic agents. It is hoped that this series of putative Pt anti-cancer agents will prove useful as both stand-alone therapeutic agents and as the basis for producing conjugate with biolocalizing properties. / text

We present a theoretical study of the electronic structure, surface energies and work functions of orthorhombic Pt monosilicide and germanides of Pt, Ni, Y and Hf within the framework of density functional theory (DFT). Calculated work functions for the (001) surfaces of PtSi, NiGe and PtGe suggest that these metals and their alloys can be used as self-aligned contacts to p-type silicon and germanium. In addition, we also study electronic structure and calculate the Schottky-barrier height at Si(001)/PtSi(001) interface and GaAs(001)/NiPtGe(001) interfaces with different GaAs(001) and NiPtGe (001) terminations. The p-type Schottky barrier height of 0.28 eV at Si/PtSi interface is found in good agreement with predictions of a simple metal induced gap states (MIGS) theory and available experiment. This low barrier suggests PtSi as a low contact resistance junction metal for silicon CMOS technology. We identify the growth conditions necessary to stabilize this orientation. The calculated p-type Schottky barrier heights (SBH) at different GaAs/NiPtGe interfaces vary by as much as 0.18 eV around the average value of 0.5 eV. We further identify and discuss factors responsible for strong Fermi level pinning resulting in small variation in the p-SBH. We also present a theoretical study of magnetic state of [beta]-MaAs and show that it is antiferromagnetic and explain the lack of observed long-range order.

published_or_final_version / abstract / Electrical and Electronic Engineering / Doctoral / Doctor of Philosophy

published_or_final_version / abstract / Chemistry / Doctoral / Doctor of Philosophy

published_or_final_version / abstract / toc / Chemistry / Doctoral / Doctor of Philosophy

The kinetic substitution reactions of two different sets of mononuclear Platinum(II) complexes with heterocyclic bio-relevant azole nucleophiles, viz. Imidazole (Im), 1-methylimidazole (MIm), 1,2-Dimethylimidazole (DIm), 1,2,4-triazole (Trz) and pyrazole (Pyz). All substitution reactions were studied under pseudo-first order conditions as a function of the incoming nucleophiles concentration and temperature using stopped-flow techniques and UV/Visible spectroscopy. The first set of complexes included the tridentate polypyridine complexes, Pt(II)(2,2:6,2″-terpyridine)Cl]Cl.2H2O, (PtL1) Pt(II)(1,3-di(2-pyridyl)benzene)Cl, (PtL2) Pt(II)(2,6-di-(2’-quinolinyl)pyridine)Cl](Cl), (PtL3) and Pt(II)(1,3-di-(2’-quinolinyl)benzene)Cl (PtL4). The substitution of these complexes with the previously mentioned azoles showed that tuning electronic communication of the Pt(II) centre towards substitution through quinoline moieties has an opposed effect to that obtained through pyridine moieties, and verified that the trans-effect of a phenyl ring is much greater than that of a pyridine ring. The reactivity trend among the complexes was PtL2 > PtL4 > PtL1 > PtL3. Once the nucleophiles were categorised into two groups based on their structural similarities, reactivity trend observed amongst the nucleophiles was generally Im > Pyz > Trz, based on the basicity (electronic effects) and MIm > Im > DIm based on steric effects. The second series of complexes were tridentate [Pt(bis(2-pyridylmethyl)amine)OH2](ClO4)2, Ptdpa and [Pt(bis(2-pyridylmethyl)sulfide)OH2](ClO4)2, Ptdps of which the kinetics were studies in an aqua medium and at constant ionic strength (0.1 M). Ptdps was found to be more reactive (three magnitude higher) than Ptdpa. The rate of substitution of the aqua ligand is dependent on the strength of the σ-donor character and the π-acceptability of the atom situated trans to the leaving group. The observed reactivity for the azoles followed the trend, MIm > Im > DIm > Trz > Pyz. This reactivity trend is in accordance with the basicity, and reflects steric and electrophilic effects of the nucleophiles. This was supported by DFT calculations and the X-ray crystal structure of Ptdps_Cl. For all substitution reactions, the temperature dependent studies showed an associative activation. It is envisaged that the findings of this project will provide useful information for designing new drugs as part of a protracted search of effective anticancer drugs with a wider spectrum. / Thesis (M.Sc.)-University of KwaZulu-Natal, Pietermaritzburg, 2014.

Thermodynamic and kinetic analysis of the ligand substitution reactions of different heterometallic Ru(II)-Pt(II) complexes with a series of bio-relevant thiourea nucleophiles of different steric demands and ionic nucleophiles have been investigated as a function of concentration and temperature using UV/visible and stopped-flow spectrophotometric techniques. To achieve this, five different sets of complexes involving mono di and multinuclear homo and heterometallic complexes with tridentate N-donor ligands of different linker ligands were synthesized and characterized by various spectroscopic methods. The substitution reactions of the chloride complexes were studied in methanol in the presence of 0.02 M LiCf3SO3 adjusted with LiCl to prevent possible solvolysis. The aqua complexes were studied in acidic aqueous medium at pH 2.0. All reactions were investigated under pseudo first-order conditions. Density functional theory (DFT) calculations were used to aid further interpretations and understandings of the experimental results. Substitution reactivity of heterometallic Ru(II)-Pt(II) and Co(II)-Pt(II) complexes bridged by tetra-2-pyridyl-1,4-pyrazine (tppz) ligand was investigated for the first time. The reactions proceeded via two steps. The pseudo first-order rate constants, kobs(1st and 2nd) for the substitution of the chloride ligand(s) from the Pt(II) complexes and subsequent displacement of the linker. The dechelation step was confirmed by 1H NMR and 195Pt NMR studies. Incorporation of Ru(tppz) moiety increases the substitution reactivity and is ascribed to the increased π-back donation from the tppz ligand which increases the electrophilicity of the metal centre, overall charge and the global electrophilicity index of the complex. However, when changed the second metal centre from a Ru(II) to a Co(II), the rate of substitution decreased by a factor of four due to the weaker π- backbonding from Co(II). The substitution reactivity of another set of heterometallic Ru(II)-Pt(II) complexes with a semi-rigid linker, 4’-pyridyl-2,2’:6’,2”-terpyridine (qpy) showed that replacing the cis pyridyl group by a (tpy)Ru(qpy) moiety lowers the energy of anti-bonding LUMO (π*) orbitals and increases the metal-metal interactions and electronic transition within the complex whereby enhancing the reactivity of Pt(II) centre. However, when two Pt(II) moieties are linked to a (qpy)Ru(qpy), the orthogonal geometry at the Ru(II) metal centre prevents the extended π-electron density to flow through the three metal centres. The kinetic results obtained were supported by pKa and 195Pt NMR studies. Substitution reactions of the mononuclear Pt(II) complexes revealed that the polyethylene glycoxy pendent units act as a σ-donors including the lone pair electrons on the first oxygen atom thereby decreasing the reactivity of the parent Pt(II) terpyridine complex. However, this σ-donation towards the terpyridine moiety was found to be effective only up to one unit of the ethylene glycoxy pendant, beyond which the reactivity was sterically controlled. The dinuclear Pt(II) complexes bridged by polyehtyleneglycol ether units show that the reactivity of the complexes depend on the Pt···Pt distance and the steric hindrance at the Pt(II) centre. The substitution reactivity of heterometallic Ru(II)-Pt(II) complexes bridged by the same polyehtyleneglycol ether units indicate that the presence of Ru(tpy)2 moiety influences the structural geometry of the complex system which in turn controls the reactivity of the Pt(II) centre. This is further driven by the entrapment effect of the nucleophile due to the V-shape geometry adopted by the heterometallic complexes. In all cases the reactivity was also controlled by steric and electronic effects. However, when two metal centres are bridged by a flexible non-aromatic linker, the electronic transitions and the metal-metal interactions were found to be minor, especially for the longer linkers. The 1H and 195Pt NMR spectroscopic techniques were used to further understand the observed substitution kinetics and to confirm the degradation of the bridging ligand from the metal centre(s). In all cases, the negative activation entropies obtained support the associative mode of substitution This investigation reveals that the length and the nature of the bridging linker plays an important role in controlling the reactivity of the heterometallic complexes. It is envisaged that the findings of this project would offer a significant contribution to the pharmacological design of effective anticancer drugs. / Ph.D. University of KwaZulu-Natal, Pietermaritzburg 2013.

[Truncated abstract] The Phase II clinical candidate, [(trans-Pt(NH3)2Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) shows a unique binding profile when compared to the anticancer agent cis-[Pt(NH3)2Cl2] (cisplatin) and dinuclear platinum complexes of the general formula [(trans-Pt(NH3)2Cl)2(H2N(CH2)nNH2)]2+. There is evidence that the increased efficacy of 1,0,1/t,t,t results from the presence of the charged central linker, which can alter the mode of binding to DNA. This alternate binding mode may be due to an electrostatic and hydrogen bonding association of the central platinum moiety in the minor groove that occurs prior to covalent binding (termed “pre-association”) . . . This research shows that 0,0,0/t,t,t is an adequate model to study the pre-association process of 1,0,1/t,t,t and that it binds in the minor groove of DNA. Therefore it is likely that 1,0,1/t,t,t pre-associates in the minor groove of DNA prior to covalent binding. This work supports the conclusions reached in NMR studies of the binding of 1,0,1/t,t,t with the 1,4-GG sequence (Qu et al. JBIC. 8, 19-28 (2003)), which showed simultaneous binding in the major and minor groove. The findings of the current work may also explain the observed binding mode of 1,0,1/t,t,t, which can bind to DNA in both the 3',3' and 5',5' directions (Kasparkova et al. JBC. 277, 48076-48086 (2002)). These unique binding characteristics are thought to be responsible for the increased efficacy of 1,0,1/t,t,t, and in light of the current results the observed binding mode most likely stems from the electrostatic pre-association of the central platinum moiety.

[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,&sup15N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.

Thesis (M.S.)--University of Texas at El Paso, 2007. / Title from title screen. Vita. CD-ROM. Includes bibliographical references. Also available online.