As the worldwide demand for recombinant proteins and valuable metabolites continues to grow, and as the biological toolset at our disposal continues to expand, the development of novel, robust, and effective platforms for the production of these bioproducts represents an area of ever-increasing interest. Although many such bioprocesses are currently economically viable, many more, though holding considerable promise, remain uncompetitive. The development of novel, more productive systems increases the versatility and industrial applications of bioprocesses. The work described in this thesis explores several aspects of bioprocessing, both on the upstream side, concerned with the development of novel recombinant protein expression platforms or the isolation of novel genes with products possessing characteristics of interest, and on the downstream side, through the improvement of fermentation-based bioprocesses. Thirty-six homoplasmic recombinant strains of the microalga Chlamydomonas reinhardtii were developed having integrated genes for phytase or xylanase under the control of psbA and psbD promoters, codon optimized using novel algorithms, at two different genetic loci, in chloroplasts, to be used as novel animal feed additives. Enzyme production was characterized, and results, when compared to other published work in this field, may provide insight into the factors impacting recombinant protein production in microalgae. Using a “bio-prospecting approach”, the microflora of the digestive tract of a Canadian beaver was screened for cellulase-producing microorganisms. Although the screening approach did successfully identify a novel β-glucosidase gene from an isolated strain of Bacillus thuringiensis, the sequence was not significantly different from those already characterized. Two bioprocessing studies were performed to improve recombinant protein production in Pichia pastoris. In the first, the composition of standard Basal Salt Medium (BSM) was systematically optimized for the production of recombinant phytase, and the optimized media produced significantly more enzyme than the standard one, while also containing significantly reduced concentrations of KH2PO4 and MgSO4·7H2O (27.9 g/l and 4.8 g/l respectively), lowering the price of process inputs. The second was based on the screening of unconventional carbon sources for candidates that could sustain the growth and enzyme production using the same P. pastoris strain. Fructose and ethanol have shown to be viable alternatives to glucose or glycerol as sole carbon sources, and provide flexibility in terms of process design.

Motivated by the surging demand of recombinant proteins and biofuels derived from renewable substrates, increasing attention has been paid to the development of novel strains via metabolic engineering strategies. Pichia pastoris is a eukaryotic platform suitable for protein expression and potentially for biofuel production due to its advantageous traits over Escherichia coli or Saccharomyces cerevisiae. In this thesis, we constructed a xylanase-producing P. pastoris strain. The fungal xylanase Xyn11A was successfully overexpressed under the constitutive GAP promoter. Biochemical characterization of the xylanase revealed that Xyn11A is optimally active at 70 °C and pH 7.4. This xylanase was stable over a wide range of pH ranging from pH 2 to pH 11. Excellent thermal stability was observed at temperature 60 °C. Enhanced production of Xyn11A was achieved by investigating the effect of carbon source and feeding strategies. The highest xylanase activity was detected at 15000 U/mL using high cell density cultivation. Production of optically pure (2R, 3R)-2, 3-BD was achieved by engineering P. pastoris with a heterologous pathway. The pathway genes consisting of Bacillus subtilis alsS, alsD and S. cerevisiae BDH1 were assembled and transformed into P. pastoris. Cultivation conditions were optimized and the highest titer of 2, 3-BD obtained using YPD media was 45 g/L in fed-batch cultivation. To enhance the economic viability of 2, 3-BD production in P. pastoris, statistical medium optimization was performed. It was found that 75 g/L of 2, 3-BD was produced using optimized media in fed-batch cultivation.

Mémoire numérisé par la Direction des bibliothèques de l'Université de Montréal.

L-asparaginase (EC 3.5.1.1), a therapeutic enzyme used in the treatment of childhood acute lymphoblastic leukemia (ALL). Hence, the goal of this work is study the expression and evaluation of hydrolysis activity of native sequence (X12746) encoding for L-asparaginase from Erwinia chrysanthemi NCPBB1125 in the popular expression system Pichia pastoris. The sequence of asn encoded for mature protein was expressed in P. pastoris SMD1168 and X33. SDS-PAGE analysis showed recombinant L-asparaginase was secreted efficiently. Stable and high hydrolysis activity of extracellular L-asparaginase in P. pastoris SMD1168 making it a potential candidate to produce recombinant protein. After purification, a specific band whose appearance approximately 45 kDa indicating the glycosylated protein with specific activity by 6.251 Umg-1 and about 3 folds purifications. / L-asparaginase (EC 3.5.1.1), một loại enzyme được sử dụng trong điều trị bệng ung thư bạch cầu mãn tính ở trẻ em. Mục tiêu của nghiên cứu này là biểu hiện và đánh giá hoạt tính thủy phân của L-asparaginase mã hóa bởi đoạn gene (X12746) tương ứng từ Erwinia chrysanthemi NCPBB1125 được biểu hiện trong nấm men Pichia pastoris. Gene đã được cắt signal peptide và biểu hiện trong P. pastoris SMD1168 and X33. Qua phân tích kết quả điện di SDS-PAGE của môi trường sau lên men, L-asparaginase tái tổ hợp được tìm thấy trong dịch ngoại bào của P. pastoris. Với khả năng sản xuất protein có hoạt tính cao hơn so với chủng P. pastoris X33, SMD1168 được lựa chọn để biểu hiện L-asparaginase tái tổ hợp. Sau khi tinh sạch, sự xuất hiện của một băng có kích khối lượng phân tử xấp xỉ 45 kDa trên điện di SDS-PAGE cho thấy protein tái tổ hợp đã bị glycosyl hóa với hoạt tính riêng 6.251 Umg-1 và đạt độ sạch 3.471 lần.

O maior desafio para a produção de bioenergia continua sendo a precisa desconstrução da parede celular de vegetal. Tendo em vista viabilizar a produção de etanol de segunda geração (2G) em larga escala, bem como otimizar o procedimento de produção do etanol de primeira geração (1G), estudos vêm sendo desenvolvidos com foco na produção de enzimas lignocelulósicas, principalmente as de origem fúngica. Esses estudos visam o aperfeiçoamento de coquetéis enzimáticos, compostos principalmente por enzimas que atacam celulose e hemiceluloses. No entanto, sabemos que as paredes celulares vegetais possuem também pectinas e recentemente foi demonstrado que pectinases podem melhorar sensivelmente o processo de hidrólise (até 30%). Após o levantamento de dados referentes a diferentes enzimas pectinolíticas denominadas endopoligalacturonases (EPGs) já caracterizadas e catalogadas no banco de dados CAZy, foi possível verificar que aquelas produzidas por fungos filamentosos contabilizam mais de 65%. A partir disso foi realizada uma análise filogenética de todas as EPGs caracterizadas produzidas por diferentes organismos. O resultado demonstrou que enzimas dessa família produzidas por bactérias também com interesse biotecnológico são mais próximas de plantas do que dos próprios fungos. Além disso, a proporção de enzimas caracterizadas de bactérias e plantas era significativamente menor que o observado para EPGs de fungos. Isso evidenciou uma lacuna no conhecimento sobre enzimas de plantas, ainda pouco exploradas no contexto de biotecnologia e bioenergia. Este trabalho apresenta a clonagem, expressão heteróloga e caracterização da EPG de cana-de-açúcar recombinante. O principal objetivo é obter informações a respeito de uma enzima com atividade chave na degradação de parede celular, haja vista ter sido ela isolada de um processo de ataque endógeno à pectina da própria cana-de-açúcar. Como resultado, a endopoligalacturonase de Saccharum sp. foi eficientemente expressa em sistema de expressão heterólogo com Pichia pastoris X33. O clone produtor selecionado gerou os maiores valores de proteínas totais no sobrenadante de cultivo com 96 horas de indução com metanol. A partir do extrato bruto do sobrenadante coleta, os melhores valores de atividade enzimática foram obtidos quando da incubação por 22 horas a 45 C em tampão acetato de sódio pH 5,0. Sais, detergentes e quelantes atuaram como inibidores da atividade enzimática e, por outro lado, o agente redutor ditiotreitol (DTT) foi responsável pelo incremento de atividade enzimática. Por fim, os parâmetros cinéticos obtidos para a enzima caracterizada indicam a possibilidade de utilizá-la como complemento de coquetéis enzimáticos, conhecidamente pobres em pectinases. / The biggest challenge for bioenergy production remains the disassembly of the extracellular matrix of some plant species. For the large-scale production of second generation ethanol (2G), and optimizing the first generation ethanol (1G) production process, studies have been developed focusing on the production of lignocellulosic enzymes, especially those of produced by fungi. These studies aim at the improvement of enzymatic cocktails, composed mainly of enzymes that are capable of attacking cellulose and hemicelluloses. However, it is a known fact that the plant cell walls also contain pectins and it has been recently demonstrated that pectinases could significantly improve the hydrolysis process (up to 30%). After an analysis of different pectinolytic enzymes known as endopoligalacturonases (EPGs), already characterized and cataloged under the CAZy database, it was possible to verify that fungi enzymes account for more than 65% of all of the characterized EPGs. The result has shown that enzymes from this family produced by bacteria - also with biotechnological interest - are closer to plants than fungi. Besides, the proportion of characterized enzymes from bacteria and plants was significantly lower than that observed for fungal EPGs. This evidenced a gap in knowledge about plant enzymes, still little explored in the context of biotechnology and bioenergy. This work presents the cloning, heterologous expression, and characterization of recombinant sugarcane EPG. The primary objective is to obtain information about an enzyme with key activity in cell wall degradation since it has been isolated from a process of an endogenous attack on sugarcane pectin itself. As a result, the endopoligalacturonase of Saccharum sp. was efficiently expressed through the heterologous expression system with Pichia pastoris X33. The selected clone generated the highest total protein values in the culture supernatant at 96 hours of methanol induction. From the crude extract of the supernatant collected, the best enzyme activity values were obtained upon incubation for 22 hours at 45°C in pH 5.0 sodium acetate buffer. Salts, detergents, and chelators acted as inhibitors of the enzymatic activity and, on the other hand, the reducing agent dithiothreitol (DTT) was responsible for the increase of enzymatic activity. Finally, the kinetic parameters obtained for the enzyme characterized indicate that it can be used as a complement to enzymatic cocktails, which are known to be poor in pectinases.

Os escorpiões estão entre os animais peçonhentos mais antigos da Terra, existindo por mais de 400 milhões de anos. As peçonhas desses animais contêm uma mistura complexa de proteínas e peptídeos capazes de interagir com alta complexidade no organismo de suas vítimas. No Brasil, o principal gênero de escorpião responsável pelos acidentes é o gênero Tityus, no qual estão inseridas as espécies T. serrulatus, T. bahiensis, T. obscurus e T. stigmurus. A peçonha do T. serrulatus é composta em sua maioria de peptídeos com ação em canais para sódio e potássio, mas possuem também enzimas como hialuronidases, proteases e outros compostos como hipotensinas, peptídeos antimicrobianos (PAMs) e peptídeos potenciadores de bradicinina. Muitos dos componentes encontrados nas peçonhas de escorpiões têm sido estudados por possuírem importantes atividades farmacológicas, como propriedades analgésicas, antimicrobianas, antitumorais e anti-inflamatórias. Todavia, sabe-se que há uma grande dificuldade na obtenção dessas substâncias em consequência do baixo rendimento dos componentes isolados a partir da peçonha. Com isso, atualmente, tem sido utilizada a expressão heteróloga de proteínas para viabilizar a obtenção de toxinas em quantidades suficientes para uso biotecnológico. Diante desse panorama, o presente trabalho teve como objetivo a expressão de dois peptídeos presentes na peçonha de Tityus serrulatus, bem como sua comparação com os peptídeos nativos com relação à sua estrutura e atividade funcional. As toxinas escolhidas foram a Ts8 e a Ts8-propeptídeo, também chamada de scorpine-like, que atuam em canais para potássio (KTxs). As sequências e os cDNAs moldes das toxinas expressas foram obtidos da biblioteca de cDNA da glândula de Tityus serrulatus construída em nosso laboratório. Os genes sintéticos contendo as toxinas de interesse foram transformados em células de Pichia pastoris da linhagem KM71H. A expressão das Ts8 e Ts8-propeptídeo recombinantes revelou a presença das toxinas, porém as mesmas sofreram degradação proteolítica por enzimas da P. pastoris. Dessa forma, foram realizadas as avaliações das expressões na presença de substrato como os casaminoácidos, bem como na diminuição do pH, temperatura e adição de inibidores de protease. Além disso, foi possível obter a rTs8, embora clivada, com atividade sobre canais para potássio. Novas etapas de purificação em colunas de troca iônica e fase reversa foram padronizadas para a obtenção das toxinas nativas a partir da peçonha de T. serrulatus. Adicionalmente, foi possível identificar a presença da Ts8 e Ts8-propeptídeo (scorpine-like) nativas por espectrometria de massas em uma das frações obtidas da cromatografia da peçonha. A adição de casaminoácidos foi favorável para a expressão das toxinas, porém não foi suficiente para minimizar a degradação proteolítica. Ensaios funcionais com os fragmentos das toxinas recombinantes e com as toxinas nativas demonstraram a liberação de citocinas como TNF-? e IL1-? em algumas das toxinas testadas. Além disso, as toxinas demonstraram inibir o crescimento da Pichia pastoris em teste antifúngico e não foram tóxicas para células de macrófagos alveolares nas concentrações testadas. Assim, esse trabalho contribuiu para demonstrar a atividade de enzimas proteolíticas na expressão em P.pastoris, avaliar as condições em que são liberadas, bem como demonstrar a atividade da rTs8 em ensaio eletrofisiológico e a atividade antifúngica das toxinas recombinantes e nativas. / Scorpions are among the oldest venomous animals on Earth, existing for over 400 million years. The venoms of these animals contain a complex mixture of proteins and peptides that can interact with high complexity with their victims. In Brazil, the main genus of scorpions responsible for accidents is Tityus genus, in which the species T. serrulatus, T. bahiensis, T. obscurus and T. stigmurus are inserted. T. serrulatus venom (Tsv) is composed mostly of peptides with action on sodium and potassium channels, but also have enzymes such as hyaluronidases, proteases and other compounds such as hypotensins, antimicrobial peptides (AMPs) and bradykinin potentiating peptides. Many of the components found in scorpion venoms have been studied for their important pharmacological activities, such as analgesic, antimicrobial, antitumor and anti-inflammatory properties. However, it is known that there is great difficulty in obtaining these substances because of the low yield of the isolated components from the venom. With this, the heterologous expression of proteins has been used to enable the production of toxins in sufficient amount for biotechnological purpose. In this panorama, the aim of this study is the expression of two peptides present in the venom of Tityus serrulatus, as well as their comparison with the native peptides in relation to their structure and functional activity. The toxins chosen were Ts8 and Ts8-propeptide, also called scorpine-like, acting on potassium channels (KTxs). Sequences and cDNAs templates of the expressed toxins were obtained from the cDNA library of the Tityus serrulatus gland constructed in our laboratory. Synthetic genes containing the toxins of interest were transformed into Pichia pastoris cells of strain KM71H. Expression of the recombinant Ts8 and Ts8-propeptide revealed the presence of the toxins, but they underwent proteolytic degradation by P. pastoris enzymes. Thus, we evaluate the expression in the presence of substrate as the casamino acids, as well as in the decrease of pH, temperature and addition of protease inhibitors. In addition, rTs8, although cleaved, could be obtained with potassium channel activity. New purification steps in ion exchange and reverse phase columns were standardized to obtain the native toxins from the venom of T. serrulatus. In addition, it was possible to identify the presence of native Ts8 and Ts8-propeptide (scorpine-like) by mass spectrometry in one of the fractions obtained from the venom chromatography. The addition of casamino acids was favourable for toxin expression, but was not sufficient to minimize proteolytic degradation. Functional assays with recombinant toxin fragments and native toxins have demonstrated the release of cytokines such as TNF-? and IL-1? in some of the toxins tested. In addition, the toxins were shown to inhibit the growth of Pichia pastoris in the antifungal test and were not toxic to alveolar macrophages cells at the concentrations tested. Thus, this work contributed to demonstrate the activity of proteolytic enzymes in P.pastoris expression, to evaluate the conditions under which they are released, as well as to demonstrate the activity of rTs8 in the electrophysiological assay and the antifungal activity of recombinant and native toxins

O Plasmodium vivax é a espécie causadora de malária de maior distribuição mundial e maior prevalência nas Américas. A complexidade do ciclo de vida do parasito e sua extensa diversidade antigênica têm dificultado a obtenção de uma vacina eficaz e inferem que seja pouco provável que este objetivo seja alcançado utilizando um único antígeno. Neste contexto, a combinação de regiões imunodominantes de antígenos de um ou mais estágios do ciclo de vida do Plasmodium pode ser uma estratégia com melhor prognóstico na indução de resposta imune protetora e duradoura contra a atividade parasitária. Este trabalho avaliou a imunogenicidade, em camundongos, de uma formulação vacinal composta pela mistura dos antígenos CSP, pré-eritrocítico e AMA-1, o qual é expresso em ambos os estágios, préeritrocítico e eritrocítico assexuado. A proteína quimérica yPvCSAllFL, que contém epítopos para células B da região central (repeats) das 3 variantes alélicas PvCSP-VK210, PvCSP-VK247 e PvCSP-P. vivax-like fusionados, e a yPvAMA-1 foram expressas com sucesso em leveduras Pichia pastoris e purificadas por métodos cromatográficos para a imunização de camundongos BALB/c e C57BL/6, na presença do adjuvante Poly(I:C), agonista de TLR3. Por ELISA, foram determinados os títulos de anticorpos, as subclasses de IgG e a avidez destes pelas proteínas indutoras, administradas isoladamente ou em combinação. A resposta de anticorpos anti-yPvCSAllFL mostrou ser linhagem dependente, tendo sido observado altos títulos de anticorpos IgG (106) em C57BL/6, os quais se mantiveram elevados por até 6 meses após a última dose. Os anticorpos anti-yPvCSAllFL, predominantemente IgG1, foram capazes de reconhecer proteínas representando as 3 variantes alélicas. No geral, a coadministração dos antígenos yPvCSAllFL e yPvAMA-1 não comprometeu a resposta de anticorpos individual. Utilizando este protocolo de vacinação não foi possível detectar resposta proliferativa de células TCD3+TCD4+ ou TCD3+TCD8+ específicas após a estimulação com yPvCSAllFL. Os índices de proliferação (8,31%) e o padrão de secreção das citocinas IFN-γ, IL-2, TNF-α e IL-10, associados à yPvAMA-1, sofreram redução com a coadministração de antígenos (6,33%) e alteração, com elevação de IL-2 em detrimento das demais citocinas. Os dados gerados no estudo das formulações vacinais apresentadas neste trabalho podem ser úteis para o desenvolvimento de uma vacina anti-P. vivax, principalmente por explorarem estratégias de combinação e fusão de antígenos. / Plasmodium vivax is the species of malaria more widely distributed worldwide and with higher prevalence in the Americas. The complexity of the parasite life cycle and its extensive antigenic diversity have hampered the achievement of an effective vaccine and infer that it is unlikely that this goal will be achieved using a single antigen. In this context, the combination of immunodominant regions of antigens of one or more stages of the Plasmodium life cycle can be a strategy with better prognosis at inducing protective and durable immune responses against this parasite. Our study assessed the immunogenicity of vaccine formulations consisting of mixture of antigens CSP, pre-erythrocytic and AMA-1, which is expressed in the both stages, pre-erythrocytic and erythrocytic asexual, in mice. The chimeric protein yPvCSAllFL, which contains B-cell epitopes of the central region (repeats) of the 3 allelic variants PvCSP-VK210, PvCSP-VK247 and PvCSP-P. vivax-like fused, and the yPvAMA-1 were successfully expressed in the yeast Pichia pastoris and purified by chromatographic methods for immunization of BALB/c and C57BL/6 mice in the presence of the adjuvant Poly(I:C), a TLR3 agonist. By ELISA, we determined the titles, IgG subclasses and the avidity of the antibodies to these proteins, administered alone or in combination. The immune response to yPvCSAllFL proved to be dependent on mouse strain, having been observed high titers of IgG antibodies (106) in C57BL/6, which remained high for up to 6 months after the last dose. Anti-yPvCSAllFL antibodies, predominantly IgG1, were able to recognize proteins representing the 3 allelic variants. In general, the co-administration of yPvCSAllFL and yPvAMA-1 antigens did not compromise the individual antibodies response. Using this vaccination protocol, we could not detect cell specific proliferative responses of TCD3+TCD4+ or TCD3+TCD8+ after stimulation with yPvCSAllFL. The proliferation (8.31%) and the pattern of secretion of cytokines IFN-γ, IL-2, TNF-α and IL-10, associated with the yPvAMA-1, were reduced during the co-administration (6.33%) and compensated by the elevation of IL-2. The data generated on the study of vaccine formulations presented in this thesis may be useful for the development of a vaccine anti-P. vivax, mainly by exploiting strategies of combination and fusion of antigens.

No experimento 1, avaliou-se os efeitos da leptina exógena na concentração sérica de leptina e na expressão do gene LEP no tecido adiposo de novilhas zebuínas pré-púberes. Amostras de tecido adiposo (mesentérico, perirenal e subcutâneo) e de sangue foram obtidas de 36 novilhas, distribuídas nos tratamentos: A) dieta de alta energia; B) dieta de baixa energia; BL) dieta de baixa energia + 4,8 g/kg PV de oLeptin subcutânea, duas vezes ao dia, por 56 dias. A concentração de leptina foi determinada com kit comercial ELISA (Cusabio) específico. Amostras de sangue de quatro novilhas por grupo foram coletadas em seis pontos no tempo, sendo um antes e um após o tratamento hormonal. Dois dias após a obtenção da puberdade, oito novilhas por grupo foram abatidas para coleta de tecido. A expressão gênica foi quantificada nos depósitos de gordura por PCR em tempo real. A oLeptina aumentou transitoriamente a concentração de leptina do grupo BL, com pico (11,1 ± 1,4 ng/mL) após 7 dias do início do tratamento. A leptina sérica do grupo A aumentou linearmente no tempo, enquanto no grupo B, manteve-se constante (4,0 ± 2,0 ng/mL). A dieta A aumentou a expressão de leptina no tecido adiposo em 2,4 vezes; e a administração de oLeptina diminuiu a expressão do gene LEP em cerca de 2,5 vezes, comparando com o grupo controle. A redução na expressão do gene LEP explica a redução na leptina sérica do grupo BL após 30 dias de tratamento hormonal. O objetivo do experimento 2 foi clonar a região codificadora da leptina bovina, transformar leveduras Pichia pastoris KM71H e expressar a proteína no meio de cultura. O gene da leptina foi amplificado em reação de PCR, a partir de amostra de tecido adiposo subcutâneo de novilha do grupo A. Os primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (senso) e 5\' - ATTGTCGACGCACCCGGGACTGAGGT - 3\' (antisenso), contendo sítios EcoRI e SalI, foram desenhados com base na sequência do mRNA da leptina bovina (NM 173928.2), substituindo a sequência sinal de secreção nativa pela sequência do Fator do Saccharomyces cereviasiae. O inserto foi clonado nos vetores de expressão pPICZαA e pGAPZαA (Invitrogen), sendo as leveduras transformadas por eletroporação. Clones com múltiplas cópias do gene foram selecionados em meio YPD + 500 μg/mL de zeocina, e 22 colônias recombinantes foram selecionadas para análise de expressão em pequena escala. Colônias pPICbLep foram inicialmente cultivadas em meio de crescimento (BMGY), sendo transferidas para meio de indução (BMMY), contendo metanol. A indução durou 144 horas. Alíquotas de 200 μl de sobrenadante foram coletadas diariamente, para análise da presença da bLeptina por SDS-PAGE. As colônias pGAPbLep foram cultivadas em meio YPD por 96 h, com coleta de sobrenadante a cada 24 h. As leveduras foram transformadas com sucesso, com os plasmídeos pPICbLep e pGAPbLep, entretanto, apenas as colônias pGAPbLep expressaram uma proteína de 35 kDa, o dobro do tamanho esperado para a bLeptina (17 kDa), provavelmente por ocorrência de dimerização. Mais estudos são necessários sobre os processos de produção de leptina recombinante bovina em Pichia pastoris. / In experiment 1, the effects of exogenous leptin were evaluated on serum leptin levels and on LEP gene expression in the adipose tissue of prepubertal zebu heifers. Adipose tissue (mesenteric, perirenal and subcutaneous) and blood samples were collected from 36 heifers, distributed among treatments: A) high energy diet; B) low energy diet; BL) low energy diet + 4,8 g/kg BW subcutaneous oLeptin, twice daily, for 56 days. Leptin concentration was determined with specific commercial ELISA kit (Cusabio). Blood from four heifer per group was sampled in six time points, one before and one after the hormonal treatment. Two days after puberty attainment , eight heifers per group were slaughter for tissue sampling. Gene expression was quantified in fat depots by real time PCR. The oLeptin increased transiently leptin concentration in group BL, with a peak (11,1 ± 1,4 ng/mL) after 7 days of treatment. Serum leptin in group A increased linearly in time, while in group B it remained constant (4,0 ± 2,0 ng/mL). Diet A enhanced leptin expression in the adipose tissue 2.4-fold, and oLeptin administration decreased de expression 2.5-fold, comparing to the control group. The decrease in LEP gene expression explains the reduction in serum leptin from group BL after 30 d of hormonal treatment. The objective with experiment 2 was to clone de codifying region of bovine leptin, transform KM71H Pichia pastoris yeasts, and express the protein in culture media. The leptin gene was amplified by PCR, from subcutaneous adipose tissue sample from a heifer in group A. Primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (forward) and 5\' - ATTGTCGACGCACCCGGGACTGAGGT 3 (reverse), containing EcoRI and SalI restriction sites, were designed based in the mRNA sequence from bovine leptin (NM 173928.2), replacing the native secretion signal sequence by the -factor sequence from Saccharomyces cereviasiae. The insert was cloned in the expression vectors pPICZαA and pGAPZαA (Invitrogen), and yeasts were transformed by electroporation. Clones with multiple copies of the gene were selected in YPD + 500 μg/mL zeocina, and 22 recombinant colonies were selected for a small-scale expression analysis. pPICbLep colonies were initially cultivated in growth media (BMGY), and then transferred to the induction media (BMMY), containing methanol. The colonies were inducted for 144 h. Supernatant aliquots (200 μl) were collected daily, for bLeptin analysis in SDS-PAGE. pGAPbLep colonies were cultivated in YPD media for 96 h, collecting supernatant samples each 24 h. Yeasts were successfully transformed with the plasmids pPICbLep and pGAPbLep, however, only pGAPbLep colonies expressed a protein with 35 kDa, twice the size expected for the bovine leptin (17 kDa), probably because of dimerization. More studies are necessary about the recombinant bovine leptin production processes in Pichia pastoris.

O presente estudo teve como objetivo avaliar a produção de etanol pela levedura Pichia stipitis, a partir do hidrolisado hemicelulósico do bagaço de malte (HHBM). Primeiramente estudou-se o efeito da suplementação nutricional do hidrolisado adicionando-se extrato de farelo de arroz (0 a 20% v/v), uréia (0 a 3 g/L) e extrato de levedura (0 a 3 g/L). Os resultados mostraram que o hidrolisado suplementado apenas com extrato de levedura proporcionou os melhores resultados de conversão (YP/S = 0,44 g/g) e produtividade em etanol (QP = 0,33 g/L.h). Em seguida foi avaliado o nível ótimo deste nutriente sobre a bioconversão, sendo confirmada a suplementação do HHBM com 3,0 g/L de extrato de levedura. Após o estabelecimento das condições nutricionais, a levedura foi cultivada em HHBM após o crescimento de 24 horas em meio semissintético, visando aclimatar as células aos inibidores presentes no hidrolisado. Este estudo resultou no aumento das velocidades do processo, sendo 16% sobre a produtividade volumétrica em etanol (QP) e 10% sobre a velocidade de consumo de substrato (QS), quando comparado ao cultivo das células somente em meio semissintético. Na etapa seguinte utilizou-se um planejamento fatorial 22 com face centrada para otimização das condições de pH e concentração inicial de células (X0) na fermentação em HHBM não destoxificado e após a destoxificação com carvão ativado. Foram obtidos modelos para descrever os valores de YP/S e QP na região estudada, sendo que para o HHBM não destoxificado os valores destes parâmetros foram 0,40 g/g e 0,65 g/L.h, respectivamente, em pH 6,4 e X0 = 5,0 g/L (modelo 1). Em HHBM destoxificado, as condições ótimas foram obtidas em pH 6,0 e 1,36 g/L de células (modelo 2), obtendo-se YP/S de 0,40 g/g e QP de 0,46 g/L.h. Nas condições otimizadas foram então realizados ensaios que confirmaram a validade dos modelos 1 e 2, obtendo-se a máxima concentração de etanol (23,4 g/L), YP/S de 0,41 g/g e QP de 0,65 g/L.h em HHBM não destoxificado. Realizouse ensaios para avaliação do efeito do ácido acético sobre a fermentação em meio semissintético por P. stipitis, empregando-se as condições de pH e X0 otimizadas em HHBM não destoxificado (modelo 1) e destoxificado (modelo 2). Este estudo mostrou que nas condições do modelo 1, o ácido acético favoreceu a bioconversão sendo os melhores resultados obtidos na presença deste ácido (YP/S = 0,47 g/g e QP = 1,08 g/L.h). Por outro lado, nas condições do modelo 2, os valores de YP/S foram similares, enquanto que com a adição de ácido acético ao meio de fermentação, o valor de QP foi reduzido em 53%. Na fermentação em biorreator, o emprego das condições otimizadas em frascos (pH 6,4 e 5,0 g/L de células) resultaram em valores de QP 48% inferiores ao obtido em frascos (0,65 para 0,44 g/L.h), entretanto YP/S foi apenas 10% inferior (0,41 para 0,37 g/g). No presente estudo, conclui-se que a suplementação nutricional do HHBM e a otimização das condições de pH e X0 resultaram em valores promissores para os principais parâmetros da fermentação por P. stipitis, ressaltando o potencial deste hidrolisado em processos biotecnológicos para produção de etanol. / This study aimed to evaluate the ethanol production by Pichia stipitis in brewer\'s spent grain hemicellulosic hydrolysate (BSGHH). Initially, the effect of nutritional supplementation was evaluated by adding rice bran extract, urea and yeast extract. The results showed that supplementation only with yeast extract promoted the highest conversion values (YP/S = 0.44 g/L) and ethanol productivity (QP = 0.33 g/L.h). Additional assays showed that the optimal concentration of this nutrient was 3.0 g/L. To acclimate the cells to inhibitors present in BSGHH the yeast was cultivated in hydrolysate after growth for 24 hours in semisynthetic medium. This study resulted in increased of the process rates, 16% of the ethanol productivity (QP) and 10% on the substrate consumption (QS) when compared to growing cells only in the semisynthetic medium. In the second step a 22 full factorial centeredface design was employed to optimized the conditions of pH and initial cells concentration (X0) in fermentation of hydrolysate undetoxified and after detoxification with activated charcoal. Mathematical models that relate the YP/S and QP were obtained. For non-detoxified BSGHH (model 1) the optimal conditions of pH (6.4) and X0 (5.0 g/L) showed values parameters of 0.41 g/g and 0.65 g/L.h, respectively. In detoxified BSGHH (model 2) the optimum conditions of pH (6.0) and X0 (1.36 g/L), resulted in YP/S and QP values of 0.40 g/g and 0.46 g/L.h, respectively. Under these conditions, the the validity of the models were confirmed. The effect of acetic acid on fermentation by P. stipitis in semisynthetic medium, employing optimized conditions of pH and X0 in model 1 and model 2 was evaluated. The results showed that under the conditions of model 1 and in a concentration of 2,9 g/L, the acetic acid favored the bioconversion by P. stipitis, increasing the YP/S (15 %) and QP (66 %). On the other hand, in the conditions of the model 2 the YP/S values were similar, whereas the QP values were reduced by 53% when the acetic acid was added. By using these optimized conditions in bioreactor fermentation it was obtained the ethanol productivity was approximately 48% lower (0.65 to 0.44 g/L.h), however the ethanol production was similar as compared to fermentation flasks. It is possible conclude that the HHBSG requires nutritional supplementation and that the optimized conditions of pH and initial cells concentration can be used as a strategy in order to raising the fermentation parameters.

O papilomavirus humano (HPV) é o agente etiológico da infecção sexualmente transmissível mais comum na população mundial. A prevalência da infecção por HPV é estimada em 660 milhões de pessoas e mais de 50% das mulheres serão acometidas pela infecção ao menos uma vez na vida. O HPV é responsável por virtualmente todos os casos de câncer de colo de útero (99%), além de causar muitos outros tipos de câncer de mucosa. O câncer cervical afeta aproximadamente 1.4 milhões de mulheres e 500 mil novos casos surgem anualmente, resultando em 250 mil mortes por ano. Os maiores índices de incidência são observados na América Latina e na África. Duas vacinas contra o HPV são comercializadas desde 2006 por empresas estrangeiras. Entretanto, o custo mínimo da vacinação é superior a 600 reais. Este preço torna sua incorporação pelo sistema de saúde um processo economicamente inviável. Dessa forma, devem ser buscadas alternativas para a produção de uma vacina eficaz, de qualidade e de baixo custo no Brasil. A proteína L1, principal proteína do capsídeo do HPV, tem a propriedade de se auto agregar em partículas semelhantes às virais (VLPs), que são o principal componente das vacinas atuais e possuem muita semelhança com os vírions nativos, introduzindo inclusive, uma imunização predominantemente tipo-específica. Este projeto se propôs a construir e avaliar vetores de expressão visando à produção em larga escala da proteína L1 do HPV 16, o tipo de HPV de maior risco e incidência na população mundial. Foram construídos cinco plasmídeos para Pichia pastoris, uma das principais plataformas industriais de expressão. Eles se diferenciam pelos marcadores de seleção e pelas sequências de manutenção do vetor, mas têm exatamente o mesmo objetivo: gerar sistemas que possuam múltiplas cópias do gene da L1 e que não necessitem da utilização de antibióticos. Essa estratégia foi escolhida porque a produtividade de muitas das proteínas heterólogas tem grande dependência da dosagem gênica e porque o uso de antibióticos encarece muito o custo da produção. Na primeira etapa do projeto foi avaliado um sistema de expressão epissomal auxotrófico, mas ele não se manteve estável ao longo de 60 gerações. Na segunda parte, dois vetores de integração ao sítio do DNA ribossomal foram testados. O sistema mais estável e produtivo foi caracterizado quanto ao número de cópias integradas ao genoma da P. pastoris e ao nível de expressão. O sistema é capaz de produzir clones com mais de 30 cópias do gene da L1 e dois clones expressaram cerca de 20 a 30 miligramas/litro de L1. Adicionalmente outros dois vetores integrativos que utilizam sequências teloméricas para integração foram construídos. Ainda são necessários estudos conjuntos de fermentação em larga escala e purificação da proteína para verificar a viabilidade do sistema / The human papillomavirus (HPV) is the etiologic agent of the sexually transmitted infection most common worldwide. The prevalence of HPV infection is estimated at 660 million people and over 50% of women will be affected by the infection at least once in their lifetime. HPV is responsible for virtually all cervical cancers cases (99%), and causes many other types of mucosal cancer. Cervical cancer affects approximately 1.4 million women, and 500.000 new cases occur annually, resulting in 250.000 deaths per year. The highest incidence rates are seen in Latin America and Africa. Two HPV vaccines are marketed since 2006 by foreign companies. However, the minimum cost of vaccination is higher than 360 dollar. This price makes its incorporation by the Brazilian Health System economically unfeasible. Thus, alternatives must be found to produce an effective vaccine, with low cost and high-quality in Brazil. The L1 protein, the major capsid protein of HPV, has the ability to self aggregate into virus-like particles (VLPs) which are the main component of current vaccines. The VLPs are very similar to the native virions and can introduce an immunization predominantly type-specific. This project aimed to construct and evaluate expression vectors to produce, at large scale, the L1 protein of HPV 16, which is the HPV type at greater risk and incidence in the world. Five plasmids were constructed for Pichia pastoris, one of the major industrial expression platforms. They differ in the selection markers and the vector maintenance sequences, but they have exactly the same goal: to create systems with multiple copies of the L1 gene and that don\'t require the use of antibiotics. This strategy was chosen because the productivity of many heterologous proteins have heavy dependence on gene dosage and because the use of antibiotics is extremely expensive for its production. In the first stage of the project, it was rated an episomal auxotrophic expression system, but it was unstable after a period of 60 generations. In the second part, two vectors for integration in the ribosomal DNA locus were tested. The most stable and productive system was featured on the number of copies integrated into the P. pastoris genome and on the expression level. It was proved that the system is able to produce clones with more than 30 copies of the L1 gene and two clones expressed approximately 20-30 milligrams/liter of L1. Additionally, two other integrative vectors for integration in telomeric sequences were constructed for future testing. More studies on large-scale fermentation and protein purification will be necessary to determine the feasibility of the system.