No description available.

The Mississippi gopher frog (MGF, Lithobates sevosa) is a critically endangered amphibian which requires the use of assisted reproductive technologies (ART) to successfully reproduce in captivity. Several challenges to successfully breeding MGFs were investigated to improve reproduction in this species. Accurate identification of biological sex is a necessary first step to reproducing species, thus several non-invasive techniques for sex identification were compared in the weakly dimorphic MGF. Reliably obtaining eggs from female MGFs has also proved difficult, therefore, four exogenous hormone therapies were compared for their success to induce ovulation. Ultrasound imaging was used alongside hormone treatments to improve understanding of ovarian response to hormone treatment. Lastly, short-term cold storage of spermic urine was studied to determine the feasibility of this technique for MGF gamete storage. Findings from these research projects are important for the successful conservation of the MGF by aiding in the production offspring for future reintroduction programs.

O melhoramento genético de abelhas Apis mellifera é uma ferramenta essencial e de caráter obrigatório para o sucesso e desenvolvimento do setor apícola. O nosso objetivo principal foi estruturar, estabelecer e fixar um plano de seleção e melhoramento genético com o objetivo de incrementar a produção de própolis por colmeia. Iniciamos este trabalho através da avaliação das características de seleção de comportamento higiênico, taxa de infestação de Varroa, incidência de Nosema em um grupo inicial de 50 colmeias. Neste grupo 40,4% das colmeias apresentaram um comportamento higiênico acima de 90% com valores de 71 ± 28,9 ± 4,22 (média ± DP ± EP); taxa de infestação de Varroa 7,7 ± 4,0 ± 0,57 (média ± DP ± EP) e uma média de incidência de Nosema < 300.000 esporos/abelha. Após estas avaliações, selecionamos três colmeias com os seguintes parâmetros: >90% de comportamento higiênico, <5% de taxa de infestação de Varroa e ausência do esporo de Nosema. Rainhas virgens dessas três linhagens genéticas foram produzidas e introduzidas nos apiários de produção. Na segunda fase analisamos um total de 263 colmeias, das quais 12,9% eram rainhas filhas das colmeias selecionadas na primeira geração. Avaliando esses apiários através do teste estatístico ANOVA encontramos diferenças estatísticas significantes entre as médias de produção de própolis para colmeias com duas, quatro e seis lâminas (F= 25,4301, (p) <0,05). Observamos que 32% das colmeias produziram menos de 50 gramas, 37% entre 50 e 100 gramas e 31% mais de 100 gramas. Embora a troca de rainhas realizada nas colmeias utilizadas somente fosse de 18%, o resultado de produção das 34 rainhas selecionadas que foram aceitas mostrou que a produção destas colmeias, independentemente do apiário no qual estas rainhas foram introduzidas, foi sempre superior a média de produção individual de cada apiário. Do grupo de 263 colmeias selecionamos 60 colmeias segundo os resultados da coleta de própolis. Nestas observamos que o comportamento higiênico apresentou valores de 72,6 ± 25,0 ± 3,9 (média ± DP ± EP); taxa de infestação de Varroa 7,2 ± 3,0 ± 0,5 (média ± DP ± EP) e uma média de incidência de Nosema < 500.000 esporos/abelha. Após estas avaliações selecionamos dez colmeias com os seguintes parâmetros: >95% de comportamento higiênico, <5% de taxa de infestação de Varroa e ausência do esporo de Nosema para formar o grupo de rainhas selecionadas durante a segunda geração. Das dez colmeias selecionadas seis possuíam rainhas filhas da primeira geração, reforçando a importância de trabalhar com material previamente selecionado nas colmeias de produção. Apesar de termos selecionado somente a origem genética materna, pela introdução de rainhas virgens, nossos resultados de produção já mostraram ser promissores. / Genetic improvement of honey bees (Apis mellifera) is an essential and important tool for the success and development of the beekeeping industry. Our main objective was to develop and set in motion a selection and breeding program to increase propolis production. We began by evaluating for hygienic behavior, Varroa infestation, and Nosema incidence in an initial group of 50 colonies. Twenty of these colonies had a hygienic behavior index above 90%; the mean rate was 71 ± 28.9 ± 4.22% (mean ± SD ± SE). The mean rate of infestation with Varroa was 7.7 ± 4.0 ± 0.57 mites per 100 adult bees (mean ± SD ± SE). The mean rate of infection with Nosema was <500,000 spores/bee. Following these evaluations, we selected three colonies with the following parameters: >90% hygienic behavior, <5% Varroa infestation and no Nosema spores. Virgin queens from these three colonies were produced and introduced into production apiaries. In the second phase, we analyzed 263 colonies, of which 12.9% had queens that were daughters of the three colonies selected in the first generation. Evaluating these apiaries through ANOVA, we found significant differences in propolis production for two, four and six pieces of propolis (F = 25.4301, p <0.05). We observed that 32% of the colonies produced less than 50 grams, 37% between 50 and 100 grams, and 31% over 100 grams. Although queens were introduced into only 18% of the colonies, the production of the 34 colonies that had selected queens was always superior to the mean overall production, regardless of the apiary in which these queens were introduced. Among the 263 colonies, we selected 60 based on propolis production. The hygienic behavior values of these colonies was 72.6 ± 25.0 ± 3.9 (mean ± SD ± SE), the rate Varroa infestation was 7.2 ± 3.0 ± 0.5 (mean ± SD ± SE), and the mean rate of Nosema infection was <500,000 spores/bee. Following these evaluations, we selected 10 colonies with the following parameters: >95% hygienic behavior, <5% rate of Varroa infestation, and absence of Nosema spores to form the second generation selection group. Of the 10 selected colonies, six were headed by queens that were daughters of the first selected group, demonstrating the importance of working with previously selected material. Although we selected only the maternal genetic line by introducing virgin queens, the improvement in production has been promising.

O melhoramento genético de abelhas Apis mellifera é uma ferramenta essencial e de caráter obrigatório para o sucesso e desenvolvimento do setor apícola. O nosso objetivo principal foi estruturar, estabelecer e fixar um plano de seleção e melhoramento genético com o objetivo de incrementar a produção de própolis por colmeia. Iniciamos este trabalho através da avaliação das características de seleção de comportamento higiênico, taxa de infestação de Varroa, incidência de Nosema em um grupo inicial de 50 colmeias. Neste grupo 40,4% das colmeias apresentaram um comportamento higiênico acima de 90% com valores de 71 ± 28,9 ± 4,22 (média ± DP ± EP); taxa de infestação de Varroa 7,7 ± 4,0 ± 0,57 (média ± DP ± EP) e uma média de incidência de Nosema < 300.000 esporos/abelha. Após estas avaliações, selecionamos três colmeias com os seguintes parâmetros: >90% de comportamento higiênico, <5% de taxa de infestação de Varroa e ausência do esporo de Nosema. Rainhas virgens dessas três linhagens genéticas foram produzidas e introduzidas nos apiários de produção. Na segunda fase analisamos um total de 263 colmeias, das quais 12,9% eram rainhas filhas das colmeias selecionadas na primeira geração. Avaliando esses apiários através do teste estatístico ANOVA encontramos diferenças estatísticas significantes entre as médias de produção de própolis para colmeias com duas, quatro e seis lâminas (F= 25,4301, (p) <0,05). Observamos que 32% das colmeias produziram menos de 50 gramas, 37% entre 50 e 100 gramas e 31% mais de 100 gramas. Embora a troca de rainhas realizada nas colmeias utilizadas somente fosse de 18%, o resultado de produção das 34 rainhas selecionadas que foram aceitas mostrou que a produção destas colmeias, independentemente do apiário no qual estas rainhas foram introduzidas, foi sempre superior a média de produção individual de cada apiário. Do grupo de 263 colmeias selecionamos 60 colmeias segundo os resultados da coleta de própolis. Nestas observamos que o comportamento higiênico apresentou valores de 72,6 ± 25,0 ± 3,9 (média ± DP ± EP); taxa de infestação de Varroa 7,2 ± 3,0 ± 0,5 (média ± DP ± EP) e uma média de incidência de Nosema < 500.000 esporos/abelha. Após estas avaliações selecionamos dez colmeias com os seguintes parâmetros: >95% de comportamento higiênico, <5% de taxa de infestação de Varroa e ausência do esporo de Nosema para formar o grupo de rainhas selecionadas durante a segunda geração. Das dez colmeias selecionadas seis possuíam rainhas filhas da primeira geração, reforçando a importância de trabalhar com material previamente selecionado nas colmeias de produção. Apesar de termos selecionado somente a origem genética materna, pela introdução de rainhas virgens, nossos resultados de produção já mostraram ser promissores. / Genetic improvement of honey bees (Apis mellifera) is an essential and important tool for the success and development of the beekeeping industry. Our main objective was to develop and set in motion a selection and breeding program to increase propolis production. We began by evaluating for hygienic behavior, Varroa infestation, and Nosema incidence in an initial group of 50 colonies. Twenty of these colonies had a hygienic behavior index above 90%; the mean rate was 71 ± 28.9 ± 4.22% (mean ± SD ± SE). The mean rate of infestation with Varroa was 7.7 ± 4.0 ± 0.57 mites per 100 adult bees (mean ± SD ± SE). The mean rate of infection with Nosema was <500,000 spores/bee. Following these evaluations, we selected three colonies with the following parameters: >90% hygienic behavior, <5% Varroa infestation and no Nosema spores. Virgin queens from these three colonies were produced and introduced into production apiaries. In the second phase, we analyzed 263 colonies, of which 12.9% had queens that were daughters of the three colonies selected in the first generation. Evaluating these apiaries through ANOVA, we found significant differences in propolis production for two, four and six pieces of propolis (F = 25.4301, p <0.05). We observed that 32% of the colonies produced less than 50 grams, 37% between 50 and 100 grams, and 31% over 100 grams. Although queens were introduced into only 18% of the colonies, the production of the 34 colonies that had selected queens was always superior to the mean overall production, regardless of the apiary in which these queens were introduced. Among the 263 colonies, we selected 60 based on propolis production. The hygienic behavior values of these colonies was 72.6 ± 25.0 ± 3.9 (mean ± SD ± SE), the rate Varroa infestation was 7.2 ± 3.0 ± 0.5 (mean ± SD ± SE), and the mean rate of Nosema infection was <500,000 spores/bee. Following these evaluations, we selected 10 colonies with the following parameters: >95% hygienic behavior, <5% rate of Varroa infestation, and absence of Nosema spores to form the second generation selection group. Of the 10 selected colonies, six were headed by queens that were daughters of the first selected group, demonstrating the importance of working with previously selected material. Although we selected only the maternal genetic line by introducing virgin queens, the improvement in production has been promising.

No description available.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5&rsquo; AATTAGGTTCTTGAAGCCCATCT 3&rsquo;; R = 5&rsquo; TTCCGCATCAGCCAATAGTGT 3&rsquo;). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5&rsquo; AATTAGGTTCTTGAAGCCCATCT 3&rsquo;; R = 5&rsquo; TTCCGCATCAGCCAATAGTGT 3&rsquo;). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

Organic agriculture is an important and growing sector of U.S. and world food production. Consumers are increasingly aware of and interested in the production practices and impacts associated with agriculture and as such, are showing a preference for sustainably produced, raised, and harvested foods. In order to continue to meet the growing demand for organic produce, organic growers need cultivars that are optimally adapted to organic and low input conditions. Quality seed is the foundation of any functional and stable farming system. Unfortunately the lack of organically bred and produced seed is hindering the continued growth and success of organic farming. Meeting the needs of the organic sector has been a challenge for the seed industry; it is an industry that often doesn't understand the specific and unique requirements associated with the diversity of environmental and market demands of organic systems. However, organic farmers and the organic food systems they supply, require a robust organic seed system that is appropriately adapted to regional agronomic challenges and market needs, meets standards and regulations, and encompasses the social and ecological values of organic agriculture. One plausible approach to meeting the cultivar and seed needs of organic and low input production systems is through the use of participatory plant breeding (PPB). PPB is a collaborative approach for identifying and developing genetically diverse plant material and varieties involving partnerships among formal sector breeders and researchers, farmers, extension agents, educators, and end users. Participatory plant breeding fundamentally changes the way that formal breeding programs and farmers manage germplasm and plant genetic resources. Typically, formal breeding programs restrict access to germplasm and breeding materials and only supply farmers with finished varieties. In PPB, farmers are involved in the early stages of creation and evaluation of germplasm and breeding material, and stay engaged with the breeding process until new varieties are created. PPB is an excellent model for breeding specifically for organic systems because organic systems in developed countries have many similarities to low-input agricultural systems in the developing world. Some of these parallels include heterogeneous growing environments, a wide range of end uses and marketing strategies, lack of suitably adapted and/or derived varieties, lack of attention from the formal seed sector, and a reduced reliance on synthetic inputs (compared to conventional systems). Breeding for organic systems is a relatively young field and breeders in the formal sector do not have a good handle on what traits are important for robust production under organic conditions. Thus the opportunity to meld farmers' experience and knowledge with breeders' expertise is an effective way to breed for organic production systems. The purpose of this project was to investigate and explore the opportunities and challenges of organic plant breeding using participatory research methods. This research had three goals: 1) to develop an open pollinated broccoli with contemporary quality traits for organic production systems using participatory strategies; 2) to compare broccoli selections made by formally trained plant breeders and farmer breeders; and 3) to capture the stories and experiences of the formal breeders and farmer breeders involved with this broccoli material in order to contribute to the growing wealth of knowledge on collaborative and organic breeding work. The Oregon State University Vegetable Breeding Program made significant progress towards decreasing the variability of the broccoli project material through three successive years of modified half-sibling selections. Evaluations and selections were based more strongly on quality traits rather than soley on production traits such as yield. Although progress was incremental and statistically verified in only three out of the fifteen quality traits, we observed trends in the data indicating progress towards an increasingly uniform, stable, and reliable open pollinated broccoli with specific adaptation for organic production systems. There were very few differences between broccoli materials developed by formally trained plant breeders and farmer breeders. This was especially true for the three cultivars developed in the Pacific Northwest (PNW) (one in Washington and two in Oregon). The 'East Coast' population, which had been collaboratively selected by formal and farmer breeders in New York, expressed significantly distinct differences from the PNW materials. When the farmer breeder and formal breeder materials were pooled together and compared to pooled check cultivars they expressed significant differences for nearly all traits across all years. This demonstrated that all of the collaboratively developed open pollinated materials are distinctly different from the F1 hybrids currently available. Our work has demonstrated a few of the myriad of positive outcomes achievable with the use of participatory plant breeding for organic production systems. The participatory nature of this project resulted in increased confidence and feelings of empowerment for all involved. Both farmers and breeders felt their involvement was socially beneficial and widened their networking and seed community circles. The farmer-bred cultivar 'Solstice' is now available as a result of Jonathan Spero's work, and a cultivar tentatively named 'Benton' is about to be released for sale through Oregon State University. Our results agree with previous study findings that formal and farmer breeder selections are often not distinctly different; thus providing evidence for continuing to support the involvement and education of farmers in plant breeding, especially in reference to organic production systems. This study demonstrates the potential of collaboratively developed and farmer-bred cultivars to become viable and vibrant open pollinated alternatives to the current open pollinated cultivars on the market today. / Graduation date: 2013

The thesis focuses on analysis of Robert Hildprandt's breeding program in Blatná estate in period of Czechoslovakia. The time range is influenced by the character of source-books that contains information from the years 1922-1930, eventually 1907-1935. The main sources include evidence resources, especially studbooks, milk yield tests, register of calves or breeding index and preserved correspondence of the estate. According to these sources is characterized the breeding of black-piabald lowland cattle, performance testing and results of breeding program. The evolution of the breeding herd in Blatná estate is compared with both general rules of breeding in Czechoslovak era and other development of different breeds and other regions. On the basis of studbooks, there is also elaborated historical-antropological analysis of names and describtions of individual animals.

La santé du constitue une préoccupation croissante pour les éleveurs, propriétaires, et le grand public, plusieurs rapports ayant récemment souligné les potentiels impacts négatifs des pratiques d'élevage sur la santé des chiens de race (APGAW 2009, Nicholas 2011), au travers de la diffusion d’affections héréditaires par exemple. Ainsi, l’OFA (Orthopedic Foundation for Animals, http://www.offa.org) considère que la dysplasie de la hanche affecte au moins 163 races de chiens, avec des prévalences allant de 1,2 à 72,1%. La mise en œuvre de stratégie d'élevage afin de réduire l'incidence des maladies héréditaires et leur impact sur le bien-être constitue une priorité pour les éleveurs et les organisations d'élevage. L'efficacité de ces stratégies dépend toutefois fortement de facteurs tels que leur déterminisme génétique, la disponibilité de diagnostics cliniques ou génétiques efficaces, ainsi que les conditions spécifiques au contexte (la prévalence, la démographie, l'existence d'autres affections, la coopération des éleveurs ...). Par exemple, il a été montré que pour une maladie monogénique récessive, à fréquence égale, l'impact d’une stratégie sur la variabilité génétique sera extrêmement différent en fonction de la race (Leroy et Rognon 2012). Il est important de souligner également que le contexte et le cadre réglementaire de l'élevage varient beaucoup en fonction des pays. A titre d'exemple, en Suède, la proportion importante d'animaux de compagnie assurés (environ 50%) permet la mise en place d’enquêtes sur la santé des chiens à grande échelle (Bonnett et al., 2005), facilitant l'identification des affections impactant le bien-être. En fonction des pays, des mesures différentes de luttes contre les affections héréditaires ont pu être mises en place, pouvant aller de l’incitation à utiliser des reproducteurs sains, à l’interdiction de reproduction pour des individus atteints d’affection problématiques. Dans le cas de dysplasie de la hanche, un système d'évaluation génétique a été mis en œuvre dans certains pays (Allemagne, Suède, Royaume-Uni) pour quelques races, alors que dans certains autres pays, il est encore en cours de développement. Notons qu’un projet préliminaire à la thèse sera mise en place à l’échelle des kennels clubs nordiques (KNU) pour s’intéresser à la valeur ajoutée des échanges internationaux de données généalogiques et de santé. / Dog health constitutes a major concern for breeders, owners, as well as the general public, all the more since several study and reports have recently underlined potential impacts of breeding practices on dog health and fitness (APGAW 2009, Nicholas 2011). According to Online Mendelian Inheritance in Animals (OMIA, omia.angis.org.au) more than 586 disorders/traits have been reported in dogs, with various prevalence and consequences for canine health (Collins et al. 2011, Nicholas et al. 2011). As an exemple, Orthopedic Foundation for Animals (OFA 2011, http://www.offa.org) consider that Hip Dysplasia, a polygenetic trait affected by environmental factors, with variable impact on welfare, affects at least 163 dog breeds, with prevalence ranging from 1.2 to 72.1%. Implementation of breeding plans in order to reduce incidence of inherited disorders and their impact on welfare should be a priority for breeders and breeding organizations. Efficiency of such strategies is however highly dependant on several factors such as inheritance pattern, availability of efficient clinical/genetic test, and specific context conditions (prevalence, demography, existence of other disorders, cooperation of breeders…). For instance, it has been showed that for a monogenic recessive disorder with the same frequency, impact of a given strategy on genetic diversity will be completely different depending on the breed (Leroy and Rognon 2012). It is also important to underline that breeding context and breeding rules are very different according to countries. As an exemple, in Sweden the large proportion of pets insured (about 50%) allows the settlement of large surveys on dog health (Bonnett et al. 2005), leading to the identification of disorders critical to breed welfare. Depending on countries, the control of inherited disorders is implemented through various measures, from breeding recommandations to mating ban. In the case of hip dysplasia, a genetic evaluation system has been implemented in some countries (Germany, Sweden, UK) for a few breeds, while in some other countries, it is still under development. The fact that for many breeds there is an exchange of breeding animals between several countries with different breeding policies constitutes also a critical point to be taken into account, when settling a breeding strategy. Moreover it has been showed that efficiency of genetic evaluation for a polygenic trait such a hip dysplasia could be improved by joint evaluation between different countries (Fikse et al. 2012). For this purpose, a preliminary project, starting 2013 in Sweden, will investigate the interest of exchanging pedigree and health data within the framework of Nordic Kennel Union. The aim of this project is to provide operational tools to improve breed health in an international context, concerning both genetic evaluation and implementation of breeding policies.