Thesis (M.S.)--Auburn University, 2008. / Abstract. Vita. Includes bibliographical references.

Infectious disease models can be used to understand mechanisms of the spread of diseases and thus, may effectively guide control policies for potential outbreaks. Deardon et al. (2010) introduced a class of individual-level models (ILMs) which are highly flexible. Parameter estimates for ILMs can be achieved by means of Markov chain Monte Carlo (MCMC) methods within a Bayesian framework. Here, we introduce an extended form of ILM, described by Deardon et al. (2010), and compare this model with the original ILM in the context of a simple spatial system. The two spatial ILMs are fitted to 70 simulated data sets and a real data set on tomato spotted wilt virus (TSWV) in pepper plants (Hughes et al., 1997). We find that the modified ILM is more flexible than the original ILM and may fit some data sets better.

Thesis--Auburn University, 2009. / Abstract. Vita. Includes bibliographical references.

The domesticated tomato Solanum lycopersicum (L.), formerly known as Lycopersicon esculentum is a genetically well-studied crop species with high-density linkage and molecular maps based on crosses done between cultivated tomato and its distant related wild species. Wild tomato species harbor a wealth of resistance to many pathogens that have been introgressed into domesticated tomato for genetic control of diseases and pests and for improvement of many agronomic traits. The wild tomato S. peruvianum (L.) is the source of the Sw-5 gene, characterized and mapped to chromosome 9 of the tomato genome and introgressed into elite tomato germplasm, providing resistance to the tospovirus Tomato spotted wilt virus (TSWV). TSWV has been reported to be a major problem for tomato growers in many parts of the world, which in some cases, has resulted in tomato fields having been abandoned for some time. Additionally, there are reports that new races of TSWV have evolved that overcome Sw-5. TSWV replicates in both, plant cells and in the alimentary canal cells of thrips and then transmitted to plants by this insect acting as a vector. Both, TSWV and thrips have co-evolved to infest and infect more than 1090 plants species in over 100 families, thrips becoming resistant to pesticides and easily escaping by hiding deep in plant parts. World trade has disseminated thrips all over the world and environmental pressures have forced TSWV to recombine its RNA to overcome new resistance.

Tomato spotted wilt virus (TSWV), a Tospovirus, is one of the ten most economically destructive plant viruses worldwide, causing losses exceeding one billion U.S. dollars annually on several crops. In South Africa (SA), TSWV has become an important virus in many economically important crops. The main objective of this research project was to isolate, identify and characterise TSWV isolates occurring in SA. A review of current literature assembled background information on TSWV molecular biology, epidemiology, transmission, detection and control. A TSWV isolate infecting pepper (Capsicum sp.) occurring in KZN was isolated and partially characterised. The virus was positively identified as TSWV using the enzyme-linked immunosorbent assay (ELISA) and the presence of typical necrotic TSWV symptoms on Nicotinia rustica L. Symptomatic leaves were harvested and the virus was partially purified using standard procedures. Under the transmission electron microscope (TEM), typical quasi-spherical and dumbbell-shaped particles of 80-100nm in diameter were observed in negatively stained preparations of both crude and purified virus samples. In negatively stained ultra-thin virus infected leaf sections, an abundance of mature viral particles (100nm) housed in the cisternae of the endoplasmic reticulum (ER) were observed among typical viroplasm inclusions (30nm) and hollow tubules (200-300nm). A viral protein migrating as a 29kDa band, which corresponds to the TSWV nucleocapsid (N) protein, was observed after sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) analysis. Total plant RNA, isolated from N. rustica displaying typical symptoms was subjected to reverse-transcription polymerase chain reaction (RT-PCR) using .primers specific to the nucleocapsid (N) gene. An expected 760bp product was amplified. The results obtained in this study confirm the presence of TSWV in infected pepper plants from KZN. The genetic diversity of TSWV isolates occurring in SA was examined. The nucleocapsid (N) gene sequences of six SA TSWV isolates originating from Gauteng, KwaZulu-Natal, North West, Limpopo and Mpumulanga provinces were determined and used in a phylogenetic tree comparison with TSWV isolates occurring in different geographical locations in the world. Nucleotide sequence comparisons of the N gene revealed high levels of similarity between the SA isolates and TSWV isolates from Asia and Europe. SA isolates showed a high degree of sequence similarity (99-100%) which was reflected in their distinct clustering pattern. The resistance of tomato (Lycopersicon escuJentum Mill.) plants with natural and transgenic resistance against mechanical inoculation with TSWV isolates occurring in SA was evaluated. The Stevens cultivar which has natural resistance conferred by the Sw-5 gene and the transgenic 13-1 line, which expresses the nucleocapsid (N) protein gene of the TSWV-BL isolate, was used as test cultivars. Plants were assessed for TSWV resistance using a disease severity rating scale and measurements of virion accumulation levels (A405nm). There were no significant differences among the reactions produced by the six TSWV isolates on the test plants. Although both plants were susceptible to the SA TSWV isolates by exhibiting similarly high viral accumulation levels, the transgenic tomato line showed milder disease severity compared to the natural resistant cultivar. Results suggest that transgenic resistance is a more effective approach in the control of TSWV in SA. The information generated in this study will be useful in formulating effective control measures using genetic engineering approaches for this economically important virus. Such approaches will be used as a tool to make strategic decisions in an integrated control programme for ISWV. / Thesis (M.Sc.)-University of KwaZulu-Natal, Pietermaritzburg, 2006.

Master of Science / Department of Entomology / David C. Margolies / James R. Nechols / A two-year greenhouse experiment was conducted to compare the relative effectiveness of biological control versus chemical control for western flower thrips, Frankliniella occidentalis, as a means of reducing the spread of Tomato spotted wilt virus (TSWV) on tomatoes. To compare efficacy of different thrips management tactics for reducing TSWV incidence, tomatoes were subjected to one of three treatments: 1) biological control based on weekly releases of the predatory mite, Amblyseius cucumeris, at a commercially-recommended rate, 2) a single chemical treatment with Conserve®, a spinosad formulation, or 3) no treatment. TSWV was introduced into the greenhouse either by starting with 20% of the crop already infected and releasing non-viruliferous thrips, or by making a single release of viruliferous thrips. Analyses were done among thrips management tactics for each virus introduction method to examine the cumulative number of weeks plants were infected, the weekly proportion of infected plants, and total marketable yield. The effects of different virus introduction methods were also compared. A comparison of virus introduction methods showed that, among all plants, the average number of weeks they were infected by TSWV was significantly lower when virus was introduced through infected plants than by infected thrips. In addition, when virus was introduced by infected thrips, a significantly greater proportion of plants were infected in any given week than when virus was introduced on infected plants. Finally, crop yields were significantly lower when virus was introduced via infected thrips than on infected plants. Among thrips management methods, plants were infected for significantly less time, and the proportion infected was lower in any given week, when biological or chemical control was applied compared to no thrips management. Tomato yields were not affected by thrips management tactic. There was no significant difference between biological and chemical control in the length of time that plants showed symptoms. However, the proportion of infected plants was marginally greater with biological control in weeks 4 and 5 than with chemical control; differences were not significant thereafter. My findings suggest that inundative releases of biological control may provide as adequate a level of protection from TSWV as chemical control in commercial greenhouse tomato crops.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

[EN] Tomato spotted wilt virus is one of the most widespread and economically important viruses worldwide. It infects a large number of plant species, being the tomato and pepper the most affected. TSWV is transmitted from one plant to another by various species of thrips in a circulative and propagative manner, being Flankliniella occidentalis the main vector. The best strategy for disease control in tomato and pepper has been breeding resistant cultivars, but only tomato with the gene Sw-5 and pepper with gene Tsw have been effective against a wide spectrum of TSWV isolates, but resistance-breaking isolates often arise. To obtain a more effective and durable control is necessary: A) the genetic and biological characterization of conventional and resistance-breaking isolates of TSWV; B) the understanding the evolutionary and epidemiological factors involved in the emergence and dispersion of resistance-breaking isolates; C) the development of tools for viral detection and quantification; and D) evaluation of new sources of resistance (total or partial, estimated as the difficulty to viral infection or/and accumulation) or tolerance (total or partial, estimated as the difficulty to symptoms development and damage without affecting viral infection). In this work, TSWV isolates from Spanish tomato and pepper crops have been biologically and molecularly characterized. The complete genome of three TSWV isolates with different biotypes were sequenced: N (unable to infect Sw-5 resistant tomato and Tsw resistant pepper), T (tomato Sw-5 resistance-breaking), and P (pepper Tsw resistance-breaking). No correlation between genetic variation and the ability of overcoming resistance was found. These nucleotide sequences and others retrieved from the GenBank database were used to develop RT-qPCR, with high sensitivity and dynamic range. Primers and one TaqMan MGB were designed from conserved sequence stretches with the aim of detecting and quantifying any TSWV isolate. It was not possible to develop a molecular method to differentiate between conventional and resistance-breaking isolates since there is no correlation between genotype and biotype. Instead, two TaqMan MGB probes were designed to quantify the two main genotypes (according to the M segment) in mixed infections. RT-qPCR was used to evaluate TSWV accumulation in non-resistant tomato, non-resistant pepper and Datura stramonium (an important reservoir), as well as in the main vector F. occidentalis, which was considered to evaluate transmission efficiency. The results showed that resistance breakdown was not associated to a fitness cost (tradeoff) in the infectivity of susceptible hosts or transmissibility by thrips and that the resistance-breaking isolates have the same potential for dispersion in field as the conventional isolates. Finally, the information obtained from the previous studies and the RT-qPCR technique were used to evaluate the resistance and tolerance to TSWV of a new accession of Capsicum baccatum. In addition to considering the genetic and biological variation of TSWV, a new approach was used based on analysis of longitudinal data (those measured in the same individuals over time). The resistance level was estimated with two variables: A) absolute fitness, calculated from the variation in time of the viral titer, quantified by RT-qPCR; and B) infectition survival, the median time in which the virus was detected in a plant by ELISA. The tolerance level was estimated as symptom survival, the median time in which a plant developed severe symptoms. This analysis showed that this new accession is partially resistant and totally tolerant to TSWV conventional and resistance-breaking isolates and therefore is a good candidate for a pepper breeding program / [ES] Tomato spotted wilt virus (TSWV) es uno de los virus más extendidos y de mayor importancia económica del mundo. Infecta a un gran número de especies vegetales, siendo los cultivos de tomate y pimiento los más afectados. Este virus se transmite de una planta a otra por trips en una manera propagativa y circulativa, siendo Flankliniella occidentalis el más eficaz. El cultivo de variedades resistentes de tomate y pimiento permitió el control de la enfermedad, ya que estos genes inducen una respuesta hipersensible impidiendo la infección sistémica del virus. Sin embargo, con frecuencia aparecen aislados del virus capaces de superar estas resistencias. Para obtener un control de la enfermedad más eficaz y duradero es necesario: A) la caracterización genética y biológica de los aislados del TSWV que superan y no superan las resistencias; B) el estudio de los factores evolutivos y epidemiológicos implicados en la aparición y establecimiento de los aislados que superan las resistencias; C) el desarrollo de herramientas que permitan la detección y cuantificación de estos aislados virales; y D) la evaluación de nuevas fuentes de resistencia o tolerancia. En este trabajo se han caracterizado biológicamente y molecularmente diferentes aislados del TSWV procedentes de cultivos de tomate y pimiento de España. Se determinó la secuencia nucleotídica del genoma completo de tres aislados españoles correspondientes a tres biotipos: N (incapaz de infectar variedades resistentes de tomate o pimiento); T (supera la resistencia Sw-5 de tomate); y P (supera la resistencia Tsw de pimiento). No se encontró correlación entre la variación genética y la capacidad de superar la resistencia. Estas secuencias nucleotídicas y otras obtenidas de la base de datos Genbank se utilizaron para desarrollar una técnica basada en la RT-PCR cuantitativa (RT-qPCR) que permite detectar el virus con un alto grado de sensibilidad y cuantificar en un amplio rango dinámico. Se diseñaron los iniciadores y una sonda TaqMan MGB a partir de segmentos de secuencia conservados para que fueran válidos para todos los aislados del TSWV. También se desarrollaron dos sondas Taqman que permitían cuantificar diferencialmente variantes genéticas del virus en infecciones mixtas. La RT-qPCR se utilizó para evaluar la acumulación de varios aislados del TSWV en tomate sin Sw-5, pimiento sin Tsw y Datura stramonium, así como, en su principal vector F. occidentalis que se usó para evaluar la eficiencia de la transmisión. Se observó que la superación de la resistencia no suponía un coste en la eficacia biológica (fitness) tanto en la multiplicación del virus en estas plantas como en la transmisión por trips. Por tanto, los aislados que superan las resistencias tienen la misma capacidad de dispersión en campo que los aislados convencionales. Por último, se utilizó la RT-qPCR y la información obtenida para evaluar la capacidad de resistencia y tolerancia al TSWV de una accesión de Capsicum baccatum. El nivel de resistencia se estimó a partir de dos variables: A) la eficacia absoluta, calculada a partir de la variación en el tiempo del título viral, cuantificado por RT-qPCR; y B) la infectividad, como la mediana del tiempo que tarda el virus en ser detectado en una planta por ELISA. El nivel de tolerancia se estimó como la mediana del tiempo que tarda una planta en mostrar síntomas graves. Esta nueva accesión es parcialmente resistente y totalmente tolerante tanto para aislados del TSWV convencionales como para aquellos capaces de infectar e inducir síntomas severos en variedades de pimiento con el gen Tsw. Por tanto, esta nueva variedad de C. baccatum es un buen candidato para usarlo en programas de mejora genética de pimiento. / [CAT] Tomato spotted wilt virus (TSWV) és un dels virus més estesos i de major importància econòmica del món. Infecta a un gran nombre d'espècies vegetals i els cultius de tomaca i pebrot són alguns dels més afectats. Aquest virus es transmet d'una planta a una altra, per trips de manera propagativa i circulativa, i Flankliniella occidentalis és el més eficaç. El cultiu de varietats resistents de tomaca i pebrot (en els quals s'han introduït per millora genètica els gens Sw-5 i Tsw, respectivament) va permetre el control de la malaltia, ja que aquests gens indueixen una resposta hipersensible i impedeixen la infecció sistèmica del virus (resistència total). No obstant açò, amb freqüència apareixen aïllats del virus que són capaços de superar aquestes resistències. Per a obtenir un control de la malaltia més eficaç i durador és necessari: A) la caracterització genètica i biològica dels aïllats del TSWV que superen i no superen les resistències; B) l'estudi dels factors evolutius i epidemiològics implicats en l'aparició i establiment dels aïllats que superen les resistències; C) el desenvolupament d'eines que permeten la detecció i quantificació d'aquests aïllats virals; i D) l'avaluació de noves fonts de resistència (total o parcial, que dificulten la infecció i multiplicació viral) o tolerància (total o parcial, que dificulten l'aparició de símptomes i danys encara que no tinguen un efecte en la infecció viral). En aquest treball s'han caracteritzat biològicament i molecularment diferents aïllats del TSWV procedents de cultius de tomaca i pebrot d'Espanya. Es va determinar la seqüència nucleotídica del genoma complet de tres aïllats espanyols corresponents a tres biotips: N (incapaç d'infectar varietats resistents de tomaca o pebrot); T (supera la resistència Sw-5 de tomaca); i P (supera la resistència Tsw de pebrot). Els resultats van mostrar que no hi havia una correlació entre la variació genètica i la capacitat de superar la resistència. Aquestes seqüències nucleotídiques i altres obtingudes de la base de dades Genbank es van utilitzar per a desenvolupar una tècnica basada en la RT-qPCR que permet detectar el virus amb un alt grau de sensibilitat i quantificar en un ampli rang dinàmic. Es van dissenyar els iniciadors i una sonda TaqMan MGB a partir de segments de seqüència conservats perquè foren vàlids per a tots els aïllats del TSWV. Tambe es van desenvolupar dos sondes Taqman que permetien quantificar diferencialment variants genètiques del virus en infeccions mixtes. La RT-qPCR es va utilitzar per a avaluar l'acumulació de diversos aïllats del TSWV en tomaca sense Sw-5, pebrot sense Tsw i Datura stramonium així com, en el seu principal vector F. occidentalis que es va usar per a avaluar l'eficiència de la transmissió. Es va observar que la superació de la resistència no suposava un cost en l'eficàcia biològica (fitness) tant en la multiplicació del virus en aquestes plantes com en la transmissió per trips. Per tant, els aïllats que superen les resistències tenen la mateixa capacitat de dispersió en camp que els aïllats convencionals. Finalment, es va utilitzar la RT-qPCR i la informació obtinguda per a avaluar la capacitat de resistència i tolerància d'una accessió de Capsicum baccatum al TSWV. El nivell de resistència es va estimar a partir de dues variables: A) l'eficàcia absoluta, calculada a partir de la variació en el temps del títol viral, quantificat per RT-qPCR; i B) la infectivitat, com la mitjana del temps que es tarda a detectar el virus en una planta per mitjèr d'ELISA. El nivell de tolerància es va estimar com la mitjana del temps que tarda una planta a mostrar símptomes greus. Aquesta nova accessió és parcialment resistent i totalment tolerant tant per a aïllats del TSWV convencionals com per a aquells capaços d'infectar i induir símptomes severs en varietats amb el gen Tsw. Per tant, aquesta nova varietat d / Debreczeni, DE. (2015). Caracterización de aislados del virus del bronceado del tomate (TSWV) que superan las resistencias de los genes Sw-5 en tomate y Tsw en pimiento. Identificación de una fuente de tolerancia en pimiento [Tesis doctoral no publicada]. Universitat Politècnica de València. https://doi.org/10.4995/Thesis/10251/51460 / TESIS