No description available.

In a country with continental dimensions like Brazil, road infrastructure that provides a displacement with comfort and safety is extremely important, once it is from these roads that the majority of supplies and people moves daily to distant regions. Is through appropriate management of corrective floors and measurements taken at the correct times that these highways provides safety and comfort to users in their displacement. One way to perform this management properly is making use of performance prediction models that makes the manager can predict the appearance of defects and the necessity of performing maintenance, providing financial resources required for repairs. Thus, the objective of this research is to monitor three highway stretches implemented in the region of Santa Maria - RS, checking their functional and structural performance in order to assist in the development of performance prediction models. To achieving the study, tests were performed at predetermined periods: Sand Patch, British Pendulum, Roughness, Rutting analysis, Distress identification and Deflections Basin Survey by Benkelman Beam and Falling Weight Deflectometer (FWD) at Roraima Avenue (restoration stretch), Hélvio Basso Avenue and Quartéis Intersection (new highway stretches). In these tests, quantitative and classifying counts of vehicles were made in order to find the number of equivalent demand of standard axis through the FEC calculation by AASHTO and USACE methodology. With that was obtained in all 34 performance prediction models for Avenues Roraima and Hélvio Basso (17 - AASHTO and 17 - USACE). No models have been developed for Quartéis Intersection once it is at the beginning of monitoring. In addition to performance prediction models, performance evaluations were carried out of three sections monitored the mediated that it were requested by the traffic, and found that the Roraima Avenue had the highest deflection values, IGG and cracked area. The Quartéis Intersection had the highest values of rutting. Back Analysis were performed by BAKFAA software to obtain resilient modulus in all layers of pavements studied and, in general, met values coherent with those studied in the literature. It was also made structural analysis by AEMC/SisPAv (2009) software in order to find the estimated durability in the highway stretches. The Roraima Avenue despite being an old stretch and present the highest amount of early distress, was the one that had the highest prediction of durability between the three analysed sections. Furthermore, structural analysis was performed for Roraima Avenue, by standard DNER PRO 011/1979, once it is a restored pavement, it was found that this stretch is expected five years and ten months of durability. Therefore, monitoring and obtaining performance prediction models are extremely important for the proper management of pavements. / Em um país com dimensões continentais como o Brasil, infraestrutura de rodovias que proporcione um deslocamento com conforto e segurança é extremamente importante, uma vez que é a partir destas rodovias que a grande maioria dos insumos e das pessoas se desloca diariamente para regiões distantes. É por meio da gerência adequada dos pavimentos e medidas corretivas realizadas nos tempos corretos, que estas rodovias fornecem aos usuários segurança e conforto nos seus deslocamentos. Uma forma de realizar esta gerência de maneira adequada é fazendo uso de modelos de previsão de desempenho, que fazem com que o gestor possa prever de forma antecipada o aparecimento de defeitos e a necessidade da realização de manutenções, disponibilizando, assim, recursos financeiros necessários para as obras de intervenções. Com isso, o objetivo desta pesquisa é realizar o monitoramento de três trechos implantados na região de Santa Maria RS, verificando seus desempenhos funcionais e estruturais de modo a subsidiar a construção de modelos de previsão de desempenho. Para a concretização do estudo foi realizado, em períodos pré-determinados, ensaios de Mancha de Areia, Pêndulo Britânico, Irregularidade Longitudinal, Afundamento em Trilha de Roda, Levantamento Visual de Defeitos e Levantamento de Bacia de Deflexões através da Viga Benkelman e Falling Weight Deflectometer (FWD) na Avenida Roraima (trecho de restauração), Avenida Hélvio Basso e no Trevo dos Quartéis (trechos novos). Além destes ensaios, foram feitas contagens quantitativas e classificatórias dos veículos que solicitavam os trechos, com a intenção de encontrar o número de solicitações equivalentes do eixo padrão através dos cálculos de FEC pela metodologia AASHTO e USACE. Com isso, obteve-se no total 34 modelos de previsão de desempenho para as Avenidas Roraima e Hélvio Basso (17 AASHTO e 17 USACE). Não foram desenvolvidos modelos para o Trevo dos Quartéis, uma vez que o mesmo está em início de monitoramento. Além dos modelos de previsão de desempenho, foram realizadas avaliações do desempenho dos três trechos monitorados à mediada que o mesmo era solicitado pelo tráfego, sendo verificado que a Avenida Roraima apresentou os maiores valores de deflexão, IGG e Área Trincada. Já o Trevo dos Quartéis apresentou os maiores valores de ATR. Foram realizadas retroanálises pelo software BAKFAA para obtenção de módulo de resiliência em todas as camadas dos pavimentos estudados e, de forma geral, encontrou-se valores coerentes com os estudados na literatura. Fez-se, também, análises estruturais através do software AEMC/SisPAv (2009), a fim de encontrar a estimativa de durabilidade dos trechos. A Avenida Roraima apesar de ser um trecho antigo e apresentar a maior quantidade de defeitos prematuramente, foi a que teve a maior previsão de durabilidade entre os três trechos. Além disso, realizou-se a análise estrutural da Avenida Roraima pela norma DNER PRO 011/1979, uma vez que se trata de uma restauração de um pavimento e constatou-se que este trecho tem previsão de durabilidade de cinco anos e dez meses. Assim, o monitoramento e obtenção de modelos de previsão de desempenho são de suma importância para a boa gerência dos pavimentos.

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior / In front of the current and growing demand for natural resources, especially of the water resources, it seeks to find a way to minimize the impacts caused by the anthropic interference in areas of riparian vegetation. These environments have an important functionality to the ecosystems belonging and surrounding due to the fact of this vegetation possesses intrinsic characteristics and adapted to the hydro and ecological environment. The rivers barring for water use as an energy source (study subject of this work) cause various impacts to the environment, one of the major is the alteration of the natural regime of pulses and often, the reducing the downstream flow of the works. The flow reduction in certain stretches of the waterway, besides requiring an in-depth study about the impacts caused by the reduction of the downstream water level of the utilization section, it becomes essential to the vegetation analysis, soil and local geology. These related factors to the morphophysiological characteristics of the different species found in these locations will determine if the current ecosystem, observed in natural altimetric quotes previously found in the area of riparian vegetation, will be able to adapt to the lower quotes checked after implementation of the barring, in other words, in the stretch of reduced flow (SRF). For determination and differentiation of the vegetation it was necessary the study and development of a methodology of analysis by quotes. This analysis was performed using the points method that consisted of a classification and identification by functional character of the existing plants in three sampling units (SU's) located in the SRF of the hydroelectric unit Passo São João town of Roque Gonzales-RS. Furthermore, were performed the gathering of soil samples in the different quotes of the three SU's for physical and chemical analysis. Thus, it was possible to determine that the soil variable (physical and chemical characteristics), has no significant variation by quotes gap and therefore, are not considered necessary for studies of adaptive variations of the vegetation established there. However, in front of this fact and of the generated results, one can strengthen the hypothesis that the hydrological variable is directly responsible for the adaptive variation of the vegetal species in these areas. / Diante da atual e crescente demanda por recursos naturais, em especial dos recursos hídricos, busca-se uma forma de minimizar os impactos causados pela interferência antrópica em áreas de vegetação ribeirinha. Estes ambientes possuem uma importante funcionalidade aos ecossistemas pertencentes e circundantes devido ao fato desta vegetação possuir características intrínsecas e adaptadas ao meio hidro ecológico. O barramento de rios para utilização da água como fonte energética (objeto de estudo deste trabalho) causa vários impactos ao meio ambiente, um dos principais é a alteração do regime natural de pulsos e, muitas vezes, a redução da vazão a jusante das obras. A redução da vazão em determinados trechos do curso d´agua, além de necessitar um estudo aprofundado a respeito dos impactos causados pela redução do nível de água a jusante da seção de aproveitamento, torna-se indispensável a análise da vegetação, solo e geologia local. Estes fatores relacionados com as características morfofisiológicas das diferentes espécies encontradas nestes locais determinarão se o ecossistema atual, observado nas cotas altimétricas naturais anteriormente encontradas na área de vegetação ribeirinha, terá condições de se adaptar às cotas inferiores verificadas após a implantação do barramento, ou seja, no trecho de vazão reduzida (TVR). Para determinação e diferenciação da vegetação foi necessário o estudo e desenvolvimento de uma metodologia de análise por cotas. Esta análise foi realizada pelo método de pontos que consistiu em uma classificação e identificação por caracteres funcionais das plantas existentes em três unidades amostrais (UA‟s) locadas no TVR da UHE Passo São João, município de Roque Gonzales-RS. Além disso, foram realizadas coletas de amostras de solo nas diferentes cotas das três UA‟s para análise física e química. Desta forma, foi possível determinar que a variável solo (características físicas e químicas), não possuem variação significativa por intervalo de cotas e, portanto, não são consideradas necessárias para estudos de variações adaptativas da vegetação ali estabelecida. Contudo, diante deste fato e dos resultados gerados, pode-se fortalecer a hipótese de que a variável hidrológica é, de forma direta, responsável pela variação adaptativa das espécies vegetais destas áreas.

No description available.

The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)

Magistro baigiamajame darbe nagrinėjama ES ir NVS kelių eismo saugumo politika, sprendžiant kelių eismo įvykių ir “juodųjų dėmių” problemas. Pasirinkti Lietuvos ir Rusijos atvejai. Pirmoje dalyje aptarta avaringumo problema šiuolaikiniame pasaulyje, pateikti statistiniai duomenys apie kelių eismo įvykiuose žuvusių žmonių skaičių ES ir NVS valstybėse, aptartos prevencinės priemonės, nurodytos kelių eismo įvykių ir „juodųjų dėmių“ atsiradimo priežastys Lietuvos ir Rusijos keliuose, pateiktos „juodųjų dėmių“ sąvokos bei jų nustatymo metodikos. Antroje dalyje nagrinėjami ES kelių transporto ir eismo saugumo reguliavimo teisiniai aspektai, nagrinėjami Lietuvos ir Rusijos svarbiausi kelių eismo saugumą reguliuojantys teisės aktai, analizuojama institucijų veikla bei finansavimas. / The master’s thesis covers the road safety policy of the EU and the CIS countries in solving the problems of road traffic accidents and “accident black spots”. The Lithuanian and Russian cases have been selected. Part One covers the discussion of the accident rate problem in a modern world, presentation of statistical data on the number of people, who died during the road traffic accidents in the EU and the CIS states, discussion of preventive measures, indication of the causes of road traffic accidents and “accident black spots” on Lithuanian and Russian roads, presentation of “accident black spots” terms as well as their identification methods. Part Two covers the analysis of legal aspects of the EU road transport and road safety regulation, fundamental legal acts governing traffic safety of Lithuania and Russia, as well as activities and financing of institutions.

Made available in DSpace on 2016-06-02T19:26:21Z (GMT). No. of bitstreams: 1 PERESSIN_Alexandre_2013.pdf: 3061472 bytes, checksum: c6d89398da14de75e2b51d1412049dd6 (MD5) Previous issue date: 2013-04-05 / Universidade Federal de Minas Gerais / Aquatic ecosystems have suffered strong anthropogenic pressure, through the construction of dams, water exploitation, chemical pollution, destruction of the surrounding environment, especially riparian vegetation, and structural changes such as channeling and siltation. Fish assemblages may respond in different ways to these environmental changes, because species exhibit different constraints, e.g., habitat demands, physiological tolerance. Thus, some species may be favored in detriment of others. Aware of the need to understand and identify the patterns response of fish assemblages and individual organisms to impact factors, this study aimed to investigate how fish biodiversity (i.e., assemblages and population-scale) respond to urbanization. Fish samples were collected in four stretches located in urban areas and six located in non-urban areas of the upper Paranapanema river basin. Chapter I focused on detecting changes in physical habitat variables, structure and composition of the fish assemblage. Multivariate analyses ordered stretches in a urbanized non urbanized gradient. Non urbanized stretches exhibited greater values of shading, vegetated surronding and coarser substrate. Assemblage structure, i.e., Shannon diversity index, Pielou evenness and Margalef richness, did not change in response to urbanization, as well as the relationship between abundance and biomass. In contrast, assemblages composition was different, as well as richness estimates based on rare species, which was lower in urban stretches. The patterns herein obtained illustrate the process of species replacement, already demonstrated in disturbed environments, in which species pre-adapted to the new conditions increase in abundance, while otherspreviously absent establish successfully. Therefore, diversity values maintain, but composition varies. In general, midwater omnivorous species were more abundant in urban areas, while loricarids and benthic invertivores presented higher average abundance in nonurban stretches. Chapter II aimed to identify changes in the trophic structure, substrate composition and its influence on trophic structure and body condition. For this, species diet was quantified according to the Degree of Food Preference (DFP) method, based on six items: plant material, algae, detritus, invertebrates, insects and fish. According to the items consumed, species were classified in trophic groups. Fourteen species were considered invertivorous/detritivorous, seven herbivorous/detritivorous, seven omnivorous and one piscivorous. Four invertivores/insectivores were exclusive of nonurban stretches and one species exclusive of urban stretches. Three herbivores/detritivores were exclusive of the nonurban stretches, whereas three omnivores were exclusive to urban stretches. Trophic structure richness, abundance and biomass were compared between urban and nonurban stretches. Abundance was not affected by urbanization, whereas richness and biomass varied between stretch groups. Substrate composition differed according to stretch type, and was positively related to invertivores/insectivores and herbivore/detritivores richness, whereas negatively related to omnivore biomass. These results suggest complex relationships between food availability, trophic plasticity and species foraging habits. It is known that coarser substrates such as rocks, branches and trunks are useful as surface for periphyton algae growth as well as shelters for aquatic macroinvertebrates. Thus, changes in substrate may alter resources availability for certain species. Omnivores, in turn, can find other sources of food items due to its trophic plasticity. In general, almost all species absent from urban stretches exhibit some trophic specialization and often depend on heterogeneous substrate for foraging. Moreover, species exclusive to urban stretches are mid-water foragers that do not depend on substrate and present high trophic plasticity. Our conclusions were supported by Astyanax fasciatus body condition analysis, an omnivorous nektonic species which demonstrated higher mean weight in urban stretches, when discounted length. / Ecossistemas aquáticos têm sofrido forte pressão antropogênica, que se manifesta na construção de barragens, captação de água, poluição química, destruição do ambiente de entorno, principalmente mata ripária, e alterações estruturais como canalizações e aporte de sedimentos. A assembleia de peixes pode responder de diversas formas a estas alterações ambientais, dado que as espécies possuem diferentes exigências fisiológicas e de habitats. Com isso, algumas espécies podem ser eliminadas e outras favorecidas. Cientes da necessidade de compreender e identificar o padrão das respostas da assembleia e organismos aos vetores de impacto, neste trabalho buscamos investigar como a ictiofauna responde à urbanização. Para isso, os peixes foram coletados em quatro trechos localizados em áreas urbanas e cinco localizados em áreas não urbanas, sempre em riachos da parte superior da bacia do alto rio Paranapanema. O capítulo I buscou detectar alterações nas variáveis físicas do hábitat, na estrutura e na composição da assembléia de peixes. Utilizando as variáveis ambientais, os trechos foram ordenados no sentido urbanizado-não urbanizado, sendo que estes últimos apresentaram valores maiores de sombreamento, área, substrato e vegetação de entorno. Verificamos que a estrutura da assembleia, representada pelos índices de diversidade de Shannon, equabilidade de Pielou e riqueza de Margalef, não sofreu alterações em resposta à urbanização, bem como a relação entre abundância e biomassa. No entanto, a composição da assembleia foi diferente e a riqueza estimada com base nas espécies raras foi menor nos trechos urbanos. Simultaneamente, a variação nos componentes ambientais explicou a variação na composição da assembleia. Estes resultados evidenciam um processo de substituição de espécies descrito para ambientes alterados, no qual espécies pré-adaptadas às novas condições aumentam em abundância e outras antes ausentes se estabelecem. Assim, a diversidade é mantida, porém, alterando a composição. Em geral, espécie onívoras forrageadoras de meia água foram mais abundantes em áreas urbanas, ao passo que loricarídeos e invertívoros bentônicos apresentaram maior abundancia média em trechos não urbanos. No Capítulo II, o objetivo foi identificar alterações na estrutura trófica, composição do substratro, influência deste na estrutura trófica e condição corporal. Para isso, a dieta das espécies foi quantificada de acordo com o método do Grau de Preferência Alimentar (GPA) para seis itens: material vegetal, algas, detrito, invertebrados, insetos e peixe. De acordo com os itens consumidos, as espécies foram classificadas em categorias tróficas. Quatorze espécies foram consideradas invertivoras/detritívoras, sete herbívoras/detritívoras, sete onívoras e uma piscívora. Quatro espécies de invertívoros/insetívoros foram exclusivas de trechos não urbanos e uma dos urbanos. Três espécies herbívoras/detritívoras foram exclusivas de riachos do tipo não urbano, o inverso dos onívoros, com 3 espécies exclusivas de riachos do tipo urbano. A partir da classificação trófica, os trechos urbanos e não urbanos foram comparados quanto à estrutura trófica em relação à riqueza, abundância e biomassa. A abundância não foi alterada pela urbanização, no entanto a riqueza e a biomassa diferiram entre os tipos de riacho. A composição do substrato, que foi diferente entre os tipos de riacho, esteve positivamente relacionada com a riqueza de invertívoros/insetívoros, de herbívoros/detritívoros e negativamente relacionada com a biomassa de onívoros. Estes resultados ilustram um processo intrincado de relações entre a disponibilidade de alimentos, plasticidade trófica e hábitos de forrageamento das espécies. Sabe-se que substratos como rochas, galhos e troncos são úteis como superfície de crescimento de algas do perifíton e também como abrigos para macroinvertebrados aquáticos. Desse modo, alterações na composição do substrato podem modificar a disponibilidade de recursos para determinadas espécies, dependentes de algas e invertebrados aquáticos, especialmente insetos imaturos. Os onívoros, por sua vez, podem encontrar outras fontes de recurso devido a sua conhecida plasticidade trófica. De maneira geral, praticamente todas as espécies ausentes dos trechos urbanos possuem alguma especialização trófica e costumam ser dependentes do substrato para o forrageamento. Por outro lado, as espécies que ocorreram apenas nos trechos urbanos são forrageadoras de meia água, não depedentes do substrato e com alta plasticidade na dieta. Esta conclusão foi amparada pela análise da condição corporal de Astyanax fasciatus, um onívoro nectônico que, quando teve descontado o comprimento do corpo, apresentou maior peso médio nos trechos urbanos.

Η “καθιερωμένη θεώρηση για την πράξη”, όντας δεσμευμένη σε ένα ευρύτερο νατουραλιστικό μοντέλο, κατανοεί την πράξη ως “επιμέρους συμβάν”, το οποίο προκαλείται αιτιακά από συγκεκριμένες νοητικές καταστάσεις. Σ’ αυτό το πλαίσιο, η αιτιακή επίδραση της πρόθεσης υπάγεται στο σύνηθες χιουμιανό μοντέλο της αιτιότητας μεταξύ συμβάντων. Ωστόσο, η εν λόγω θεώρηση αποτυγχάνει ουσιωδώς να ερμηνεύσει τις πράξεις στην εξέλιξή τους, πριν δηλαδή να διαμορφωθεί το απαιτούμενο (από το χιουμιανό μοντέλο) εξατομικευμένο συμβάν. Το γεγονός αυτό έχει ευρύτερες επιπτώσεις για τον τρόπο με τον οποίο αντιλαμβάνεται η εν λόγω προσέγγιση τόσο την έννοια της πρόθεσης, όσο και κατ’ επέκταση το ρόλο του δρώντος. Στην παρούσα εργασία και με αφορμή κυρίως πρόσφατες εργασίες από τους Hornsby και Crowther, επιχειρηματολογώ σχετικά με το ότι μπορούμε να υιοθετήσουμε μια εναλλακτική προσέγγιση, τόσο για την οντολογία της πράξης, όσο και για την πρόθεση, η οποία δίνει ικανοποιητικότερες απαντήσεις στις ανωτέρω προκλήσεις. Κεντρική θέση στα πλαίσια αυτής της προσέγγισης είναι η αναγνώριση της “δραστηριότητας” ως συγκροτησιακού στοιχείου της πράξης, κατά τη διάρκεια της οποίας η αιτιακή συμβολή του δρώντος παραμένει συνεχής, σε συμφωνία με μια αριστοτελικού τύπου προσέγγιση της αιτιότητας. Όι παραδοχές αυτές οδηγούν σε μια θεώρηση της πρόθεσης ως καθοδηγητικής της πράξης καθόλη τη διάρκεια εξέλιξής της. / The “standard story of action” being committed to a broader naturalistic model, understands action as a “particular event”, which is caused by certain mental states. In this context, the causal efficacy of intention is covered by the standard humean model of causality between events. Nevertheless, the story in question substantially fails to give an account for actions as they develop, that is, before the required (by the humean model) individuated event has been formed. That fact has broader effects on the way that the approach in question understands the concept of intention, and ultimately the role of the agent. In this thesis, following mainly on recent papers by Hornsby and Crowther, I argue that we can endorse an alternate approach regarding the ontology of action, as well as intention, that gives more adequate answers to the challenges mentioned above. The main thesis in this context is to recognize “activity” as a constitutional element of action, during which the causal efficacy of the agent remains ongoing, in accordance with an aristotelian type of approach to causality. These commitments result in recognizing intention as guiding action throughout the whole of its development.