Η παρούσα διπλωματική διατριβή εντάσσεται ερευνητικά στην περιοχή της Υπολογιστικής Στατιστικής, καθώς ασχολούμαστε με τη μελέτη μεθόδων προσομοίωσης από κάποια κατανομή π (κατανομή στόχο) και τον υπολογισμό σύνθετων ολοκληρωμάτων. Σε πολλά πραγματικά προβλήματα, όπου η μορφή της π είναι ιδιαίτερα πολύπλοκή ή/και η διάσταση του χώρου καταστάσεων μεγάλη, η προσομοίωση από την π δεν μπορεί να γίνει με απλές τεχνικές καθώς επίσης και ο υπολογισμός των ολοκληρωμάτων είναι πάρα πολύ δύσκολο αν όχι αδύνατο να γίνει αναλυτικά. Γι’ αυτό, καταφεύγουμε σε τεχνικές Monte Carlo (MC) και Markov Chain Monte Carlo (MCMC), οι οποίες προσομοιώνουν τιμές τυχαίων μεταβλητών και εκτιμούν τα ολοκληρώματα μέσω κατάλληλων συναρτήσεων των προσομοιωμένων τιμών. Οι τεχνικές MC παράγουν ανεξάρτητες παρατηρήσεις είτε απ’ ευθείας από την κατανομή-στόχο π είτε από κάποια διαφορετική κατανομή-πρότασης g. Οι τεχνικές MCMC προσομοιώνουν αλυσίδες Markov με στάσιμη κατανομή την και επομένως οι παρατηρήσεις είναι εξαρτημένες. Στα πλαίσια αυτής της εργασίας θα ασχοληθούμε κυρίως με τον αλγόριθμο Metropolis-Hastings που είναι ένας από τους σημαντικότερους, αν όχι ο σημαντικότερος, MCMC αλγόριθμους. Πιο συγκεκριμένα, στο Κεφάλαιο 2 γίνεται μια σύντομη αναφορά σε γνωστές τεχνικές MC, όπως η μέθοδος Αποδοχής-Απόρριψης, η μέθοδος Αντιστροφής και η μέθοδος Δειγματοληψίας σπουδαιότητας καθώς επίσης και σε τεχνικές MCMC, όπως ο αλγόριθμός Metropolis-Hastings, o Δειγματολήπτης Gibbs και η μέθοδος Metropolis Within Gibbs. Στο Κεφάλαιο 3 γίνεται αναλυτική αναφορά στον αλγόριθμο Metropolis-Hastings. Αρχικά, παραθέτουμε μια σύντομη ιστορική αναδρομή και στη συνέχεια δίνουμε μια αναλυτική περιγραφή του. Παρουσιάζουμε κάποιες ειδικές μορφές τού καθώς και τις βασικές ιδιότητες που τον χαρακτηρίζουν. Το κεφάλαιο ολοκληρώνεται με την παρουσίαση κάποιων εφαρμογών σε προσομοιωμένα καθώς και σε πραγματικά δεδομένα. Το τέταρτο κεφάλαιο ασχολείται με μεθόδους εκτίμησης της διασποράς του εργοδικού μέσου ο οποίος προκύπτει από τις MCMC τεχνικές. Ιδιαίτερη αναφορά γίνεται στις μεθόδους Batch means και Spectral Variance Estimators. Τέλος, το Κεφάλαιο 5 ασχολείται με την εύρεση μιας κατάλληλης κατανομή πρότασης για τον αλγόριθμό Metropolis-Hastings. Παρόλο που ο αλγόριθμος Metropolis-Hastings μπορεί να συγκλίνει για οποιαδήποτε κατανομή πρότασης αρκεί να ικανοποιεί κάποιες βασικές υποθέσεις, είναι γνωστό ότι μία κατάλληλη επιλογή της κατανομής πρότασης βελτιώνει τη σύγκλιση του αλγόριθμου. Ο προσδιορισμός της βέλτιστής κατανομής πρότασης για μια συγκεκριμένη κατανομή στόχο είναι ένα πολύ σημαντικό αλλά εξίσου δύσκολο πρόβλημα. Το πρόβλημα αυτό έχει προσεγγιστεί με πολύ απλοϊκές τεχνικές (trial-and-error τεχνικές) αλλά και με adaptive αλγόριθμούς που βρίσκουν μια "καλή" κατανομή πρότασης αυτόματα. / This thesis is part of research in Computational Statistics, as we deal with the study of methods of modeling some distribution π (target distribution) and calculate complex integrals. In many real problems, where the form of π is very complex and / or the size of large state space, simulation of π can not be done with simple techniques as well as the calculation of the integrals is very difficult if not impossible to done analytically. So we resort to techniques Monte Carlo (MC) and Markov Chain Monte Carlo (MCMC), which simulate values ​​of random variables and estimate the integrals by appropriate functions of the simulated values. These techniques produce MC independent observations either directly from the distribution n target or a different distribution motion-g. MCMC techniques simulate Markov chains with stationary distribution and therefore the observations are dependent. As part of this work we will deal mainly with the Metropolis-Hastings algorithm is one of the greatest, if not the most important, MCMC algorithms. More specifically, in Chapter 2 is a brief reference to known techniques MC, such as Acceptance-Rejection method, the inversion method and importance sampling methods as well as techniques MCMC, as the algorithm Metropolis-Hastings, o Gibbs sampler and method Metropolis Within Gibbs. Chapter 3 is a detailed report on the algorithm Metropolis-Hastings. First, we present a brief history and then give a detailed description. Present some specific forms as well as the basic properties that characterize them. The chapter concludes with a presentation of some applications on simulated and real data. The fourth chapter deals with methods for estimating the dispersion of ergodic average, derived from the MCMC techniques. Particular reference is made to methods Batch means and Spectral Variance Estimators. Finally, Chapter 5 deals with finding a suitable proposal for the allocation algorithm Metropolis-Hastings. Although the Metropolis-Hastings algorithm can converge on any distribution motion sufficient to satisfy some basic assumptions, it is known that an appropriate selection of the distribution proposal improves the convergence of the algorithm. Determining the optimal allocation proposal for a specific distribution target is a very important but equally difficult problem. This problem has been approached in a very simplistic techniques (trial-and-error techniques) but also with adaptive algorithms that find a "good" allocation proposal automatically.

Submitted by Nathália Faria da Silva (nathaliafsilva.ufv@gmail.com) on 2017-07-04T14:00:23Z No. of bitstreams: 1 texto completo.pdf: 313023 bytes, checksum: 6afa22af69d45033d76b3f27d9494328 (MD5) / Made available in DSpace on 2017-07-04T14:00:23Z (GMT). No. of bitstreams: 1 texto completo.pdf: 313023 bytes, checksum: 6afa22af69d45033d76b3f27d9494328 (MD5) Previous issue date: 1999-11-30 / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior / Foram conduzidos três experimentos, em área do Departamento de Zootecnia da Universidade Federal de Viçosa, com o objetivo de avaliar o rendimento forrageiro e o valor nutritivo do capim-tifton 85 (Cynodon spp.), sob diferentes doses de nitrogênio (0, 100, 200, 300 e 400 kg/ha/ano) e idades de rebrota (28, 42 e 56 dias), no primeiro experimento; o fracionamento de proteínas e carboidratos, e as taxas de digestão de suas frações, em fenos de capim-tifton 85 de 28, 35, 42 e 56 dias de rebrota, no segundo experimento; o consumo, as digestibilidades aparentes total e parcial dos nutrientes, a eficiência de síntese microbiana, o fluxo de compostos nitrogenados no abomaso, o balanço de nitrogênio, a taxa de passagem, a concentração de amônia e o pH ruminais, em bovinos recebendo dietas contendo 60% de feno de capim-tifton 85 de diferentes idades de rebrota, no terceiro experimento. Os tratamentos do primeiro experimento foram dispostos em esquema de parcelas subdivididas, com as doses de N nas parcelas e as idades de rebrota nas subparcelas, no DIC, com três repetições. O rendimento forrageiro variou de ix5.751 a 25.239 kg/ha/ano de MS, em função do aumento do adubo nitrogenado e da idade de rebrota, com eficiência de resposta de 36,8 kg MS/kg N. Os teores de PB, com valores entre 5,3 e 13,5%, incrementaram com o aumento das doses de N e decresceram com o avanço da idade da planta. No segundo experimento, obtiveram-se as frações protéicas A, B1, B2, B3 e C, com valores entre 22,10 e 35,53; 0,24 e 4,55; 30,37 e 31,34; 26,55 e 36,62; e 5,75 e 6,76 (%PB), respectivamente, em fenos com idades entre 28 e 56 dias de rebrota. As frações de carboidratos A, B1, B2 e C apresentaram valores entre 2,73 e 5,44; 1,91 e 2,35; 77,49 e 80,59; e 13,59 e 17,87 (%CHOS), respectivamente, em fenos com idades entre 28 e 56 dias de rebrota. No terceiro experimento, quatro animais, fistulados no rúmen e abomaso, foram distribuídos em quadrado latino 4 x 4. Estimaram-se consumos máximos de MS, MO, PB, FDN, CHOS, NDT, MOD e CHOSD de 5,81; 5,51; 0,71; 3,4; 4,69; 4,17; 4,04; e 3,5 kg/dia, respectivamente, com a inclusão de feno de capim-tifton 85 de 40,6; 40,6; 32,6; 41,5; 42,2; 37,6; 37,7; e 39 dias de rebrota. As digestibilidades aparentes totais da FDN e dos CHOS decresceram 0,33 e 0,21 unidades percentuais por dia de aumento na idade do feno na ração. As eficiências de síntese microbiana apresentaram valores médios de 31,32 g Nbact/kg MODR; 30,74 g Nbact/kg CHODR; 337,4 g MSbact/kg CHODR; e 12,5 g PBbact/100 g NDT. Estimaram-se concentração máxima de amônia de 9,7 mg/100 mL e valor mínimo de pH de 6,08, às 1,38 e 6,64 horas após a alimentação, respectivamente. / This work was conducted in the Department of Animal Science of the Federal University of Viçosa, with the objective to evaluate the forage yield and the nutritive value of tifton 85 bermudagrass (Cynodon spp.), as affected by different nitrogen rates (0, 100, 200, 300 e 400 kg/ha/year) and regrowth ages (28, 42 and 56 days), in the first experiment; the protein and carbohidrate fractions, and their degradation rates, in the tifton 85 bermudagrass hay at 28, 35, 42 and 56 regrowth days, in the second experimento; the intake, the total and parcial apparent digestibility of the nutrients, the microbial synthesis, the nitrogenous compounds flow on the abomasum, the nitrogen balance, the passagem rate, the ruminal ammonia concentration and pH, in cattles fed diets with 60% of tifton 85 bermudagrass hay of different regrowth ages, in the third experiment. In the first experiment, the experimental design was completely randomized with a splitplot feature. The main plots referred to N-rates and the split plots being regrowth ages. The forage yield range from 5,751 to 25,239 kg/ha/year of DM, as affected by nitrogen rates and regrowth ages, with xia response efficiency of 36,8 kg DM/kg N. The CP content, with values between 5,3 and 13,5%, increased with nitrogen rates and decreased with advance of the regrowth age. In the second experiment, the proteins fractions A, B1, B2, B3 and C, with values between 22.10 and 35.53; 0.24 and 4.55; 30.37 and 31.34; 26.55 and 36.62, and, 5.75 and 6.76 (%CP), respectively, in the hays with ages between 28 and 56 days, were obtained. The carbohidrates fractions A, B1, B2 and C, with values between 2.73 and 5.44; 1.91 and 2.35; 77.49 and 80.59, and, 13.59 and 17.87 (%CHOS), respectively, in the hays with regrowth ages between 28 and 56 days, were obtained. In the third experiment, four rumen and abomasum fistulated cattles were alloted in a 4x4 latim square. The intakes of DM, OM, CP, NDF, carbohidrates, TDN, digestible OM, and digestible carbohidrates were estimated in 5.81; 5.51; 0.71; 3.4; 4.69; 4.17; 4.04 and 3.5 kg/day, respectively, with the inclusion of tifton 85 bermudagrass hay of 40.6; 40.6; 32.6; 41.5; 42.2; 37.6; 37.7 and 39 regrowth days. The total apparent digestibilitiy of NDF and carbohidrates decreased 0.33 and 0.21 percentual unit per day of increase of the hay age in the diet. The microbial synthesis presented means values of 31.32 g Nmic/kg MODR; 30.74 g Nmic/kg CHODR; 337,4 g DM/kg CHODR and 12,5 g CPmic/100 g TDN. The maximum ruminal ammonia concentration of 9.7 mg/100 mL and minimum pH of 6.08, at 1.38 and 6.64 hours after feeding, respectively, were estimated.

Submitted by Nathália Faria da Silva (nathaliafsilva.ufv@gmail.com) on 2017-07-19T14:34:12Z No. of bitstreams: 1 texto completo.PDF: 285585 bytes, checksum: 1f1851b8d7c5a5e6848a5fb7afe1ad9d (MD5) / Made available in DSpace on 2017-07-19T14:34:12Z (GMT). No. of bitstreams: 1 texto completo.PDF: 285585 bytes, checksum: 1f1851b8d7c5a5e6848a5fb7afe1ad9d (MD5) Previous issue date: 2001-03-28 / Conselho Nacional de Desenvolvimento Científico e Tecnológico / O objetivo deste trabalho foi avaliar os efeitos da substituição do feno de capim-Tifton 85 por polpa cítrica sobre o consumo voluntário, desempenho, o desenvolvimento ponderal, a digestibilidade dos nutrientes, a absorção aparente total de cálcio e fósforo, os parâmetros ruminais, o comportamento ingestivo e a economicidade, em dietas para novilhas leiteiras. Vinte e oito novilhas, com idade média de 12 meses e peso médio inicial de 184 kg, foram mantidas em baias individuais, com acesso irrestrito ao alimento e à água durante 84 dias experimentais. As dietas experimentais foram constituídas de quatro níveis de substituição (0, 16,6, 33,3 e 50%) de feno por polpa cítrica. Foram preparadas quatro misturas concentradas, objetivando que as dietas experimentais tivessem o mesmo teor de proteína e de compostos nitrogenados não-protéicos. As novilhas foram distribuídas em delineamento em blocos casualizados, com sete repetições. Os consumos de matéria seca (MS), matéria orgânica (MO), proteína bruta (PB), carboidratos totais (CHO) e nutrientes digestíveis totais (NDT) aumentaram linearmente à medida que o feno foi substituído. O consumo de fibra em detergente neutro (FDN) decresceu com a substituição do feno pela polpa cítrica. O consumo de extrato etéreo variou quadraticamente com aumento dessa substituição, apresentando um mínimo quando 2,27% do feno foi substituído pela polpa cítrica. Os consumos de cálcio e fósforo aumentaram com o aumento nos níveis de substituição do feno. Esta substituição provocou redução linear na ingestibilidade aparente da matéria seca (CDAMS), matéria orgânica (CDAMO), proteína bruta (CDAPB) e fibra em detergente neutro (CDAFDN), porém não influenciou os coeficientes de digestibilidade do extrato etéreo (CDAEE) e dos carboidratos totais (CDCHO). A absorção aparente total de cálcio decresceu linearmente e a de fósforo variou quadraticamente com o aumento da substituição do feno pela polpa cítrica, tendo a absorção aparente total de fósforo sido máxima quando 21,84% do feno foi substituído pela polpa. A relação cálcio:fósforo variou quadraticamente com a substituição do feno pela polpa cítrica, tendo a relação mínima sido observada quando o nível dessa substituição foi de 10,57%. O ganho de peso aumentou linearmente com a substituição do feno pela polpa cítrica. No entanto, o crescimento em cm/dia de altura de cernelha foi menor e o de altura de garupa não foi influenciado pelos níveis dessa substituição. Observou-se aumento linear no perímetro torácico à medida que a polpa cítrica substituiu o feno. O pH e a concentração de amônia ruminal decresceram linearmente com aumento da substituição do feno pela polpa cítrica e variaram quadraticamente com o tempo de coleta. O valor mínimo de pH e a máxima concentração de amônia ocorreram após 5,3 e 2,1 horas decorridas a alimentação. Foi observado efeito dos níveis de substituição do feno pela polpa cítrica sobre o tempo despendido em alimentação, ruminação e mastigação total. No entanto, o número de mastigações merícicas não foi influenciado por essa substituição. As novilhas apresentaram maior eficiência de alimentação e ruminação em g MS/h à medida que o feno foi substituído pela polpa cítrica. Já a eficiência de alimentação e ruminação em g FDN/h não foi influenciada pelos níveis de substituição do feno pela polpa cítrica. Houve aumento linear na receita bruta e margem bruta e redução linear no custo por kg de ganho de peso das novilhas alimentadas com dietas que continham maiores níveis de substituição do feno pela polpa cítrica. / This work was conducted to evaluate the effects of Tifton hay replacement by citrus pulp in diets for dairy heifers on voluntary intake, performance, nutrients digestibility, total apparent absorption of calcium and phosphorus, ruminal parameters, ingestive behavior and economicity. It was used twenty eight heifers, at approximate age of 12 months and average initial weight of 184 Kg, kept in individual stall, with feed and water available, for eighty four experimental days. The experimental diets consisted on four levels of Tifton hay replacement (0, 16.6, 33.3 and 50 %) by citrus pulp. It was prepared four concentrates with the objective that the experimental diets had the same levels of crude protein and non protein nitrogen. The experimental design was in randomized blocks with four treatments and seven blocks. The intakes of dry matter (DM), organic matter (OM), crude protein (CP), total carbohydrates (TCH) and total digestible nutrients (TDN) increased linearly with hay replacement by citrus pulp. The intake of neutral detergent fiber (NDF) decreased with hay replacement of hay by citrus pulp. The ether extract intake (EE) had a quadratic behavior with hay replacement by citrus pulp, with the minimum value at 2.27 % of hay substituted by citrus pulp. The intake of calcium and phosphorus increased with hay replacement by citrus pulp. The apparent digestibility of dry matter (DM), organic matter (OM), crude protein (CP), neutral detergent fiber (NDF) decreased linearly and the apparent digestibility of (EE) and total carbohydrates (TCH) was not affected by hay replacement by citrus pulp. The total apparent absorption of calcium decreased linearly, while total apparent absorption of phosphorus had a quadratic behavior with the maximum value at 21.84 % of hay substituted by citrus pulp. The calcium-to-phosphorus ratio had a quadratic behavior with the minimum value at 10.57 % of hay replacement by citrus pulp. The average daily weight gain increased linearly with replacement of hay by citrus pulp. Nevertheless, the growth (cm/day) of wither height decreased and hip height was not affected by hay replacement by citrus pulp. It was observed a linear increase of heart girth when the hay was replaced by citrus pulp. The pH and ruminal ammonia concentration decreased linearly with hay replacement by citrus pulp and had a quadratic behavior as a function of the post-feeding time. The minimum value of pH and the maximum value of ruminal ammonia concentration occurred at 5.3 and 2.1 hours post-feeding, respectively. It was observed linear reduction at the time spent feeding, rumination and total mastication as hay replacement by citrus pulp was increased. However, the number of rumination chews was not affected by the hay replacement by citrus pulp. The feeding and rumination efficiency in g DM/h increased linearly, but the feeding and rumination efficiency in g NDF/h was not affected by hay replacement by citrus pulp. It was observed a linear increase at gross revenue and gross margin, and linear reduction at cost per Kg of weight gain on dairy heifers with the increasing levels of hay replacement by citrus pulp.

No description available.

No description available.

As formas tripomastigotas do Trypanosoma cruzi expressam as Tc-85, glicoproteínas de superficie. A Tc85-11, um dos membros da família da Tc-85, foi caracterizado como uma proteína de adesão, com os sítios de ligação a laminina e citoqueratina 18 localizados, respectivamente, nos domínios amino e carboxiterminal. Utilizando-se primers consensos, um produto de cerca de 2000 pb foi amplificado do cDNA de formas tripomastigotas de T cruzi da cepa Y. Uma biblioteca enriquecida em membros da família da Tc-85 foi construída utilizando-se esses primers e o plasmídeo pCR T7/NT Topo Cloning (Invitrogen). O sequenciamento de cerca de 60 clones resultou em 30 ORFs completas. O sequenciamento de DNA foi realizado com o método dideoxi de terminação de cadeia e as seqüências foram analisadas. Por análise comparativa, identidades de 40-90% entres os clones sequenciados e 30-70% com membros da superfamília de proteínas das gp85/trans-sialidases foram encontradas. Os dados foram compilados nas seguintes ferramentas: ORF finder (NCBI), Cap3, Smith-Waterman, ClustalW, BioEdit e BLASTX/BLASTN (NCBI). Para a análise filogenética, foi utilizado o programa Paup empregando máxima parsimônia (MP), \"neighbor joining\" (NJ) e máxima probabilidade (MP). A árvore possuia dois grupos e foi submetida a análise de bootstrapping, com busca heurística completa e com 100 e 500 repetições. Os mesmos dois grupos apareceram quando a comparação de seqüências e análise filogenética foram correlacionadas. Em experimentos utilizando-se elementos de matriz extracelular - laminina e fibronectina- foi testada a ligação de proteínas recombinantes purificadas. A proteína codificada pelo inserto de cDNA Tc85-45 foi capaz de se ligar de maneira saturável a laminina e a fibronectina, mas não a albumina e gelatina. Os dados sugerem fortemente que, apesar da família da Tc-85- e por conseqüência a superfamília das gp85/trans-sialidases- codificarem proteínas com graus variáveis de seqüências similares, as seqüências específicas de peptídeos para a ligação a diferentes moléculas de matriz e receptores celulares variam entre membros da família, constituindo, assim, uma família multiadesiva de glicoproteínas que capacita o parasita a ultrapassar as barreiras impostas pelas membranas celulares, matrizes extracelulares e lâminas basais. / Trypomastigote forms of Trypanosoma cruzi express Tc-85 surface glycoproteins. Tc85-11, one member of the Tc-85 family, was characterized as an adhesion protein, with laminin and cytokeratin-18 binding sites localized, respectively, on the amino and carboxy terminal domains. Using consensus primers, a 2000 bp product was amplified from cDNA of trypomastigote forms of T. cruzi of the Y strain. A library enriched in Tc-85 cDNA was constructed using these primers and pCR T7/NT Topo Cloning (Invitrogen) plasmid. Sequencing of about 60 clones gave 30 complete ORFs. DNA sequencing was performed by the dideoxi-chain termination method and the sequences have been analyzed. By comparative analysis, identity of 40-90% was found among the sequenced clones and 30-70%, with members of the gp85/trans-sialidase superfamily proteins. The data were compiled in the following tools: ORF finder (NCBI), Cap3, Smith-Waterman algorithm, ClustalW, BioEdit and BLASTX/BLASTN (NCBI). For phylogenetic analysis, the Paup program was employed using maximum parsimony (MP), neighbor joining (NJ), and maximum likelihood (ML). The inferred tree had two groups and was submitted to full heuristic bootstrapping with 100 and 500 repetitions. The same two groups appeared when comparative sequence and phylogenetic analyses were correlated. In experiments in which extracellular matrix elements - laminin and fibronectin- were tested for binding to purified recombinant proteins, the protein coded by the cDNA insert Tc85-45 was able to bind in a saturable manner to laminin and fibronectin, but not to albumin and gelatin. The data strongly suggest that although the Tc-85 family, and by extension the gp85/glycoprotein superfamily, encode glycoproteins with variable degrees of similar sequences, the peptide sequences specific for the binding to different matrix molecules and cell receptors varies among the family members, thus, constituting a multi-adhesion family of glycoproteins that enables the parasite to overcome the barriers imposed by cell membranes, extracellular matrices and basal laminae.

Vários laboratórios descreveram moléculas que estão envolvidas na invasão do Trypanosoma cruzi à célula hospedeira. Nosso laboratório foi o primeiro a descrever moléculas de 85 kDa pertencentes a uma família de glicoproteínas (Tc-85) que possuem graus diferentes de homologia de seqüência com os membros da superfamília das gp85/transialidases. Um componente acídico (Tc85-11) da família Tc-85 que se liga à laminina e a receptores da célula hospedeira foi clonado e expresso (Giordano et al., JBC 274, 3461,1999). Nós levantamos a hipótese de que o polimorfismo dos diferentes membros da família Tc-85 poderiam determinar diferentes propriedades da adesão à célula hospedeira. Para provar tal hipótese, uma biblioteca genômica de Tc-85 utilizando o vetor pTEX e os seguintes primers: R-1 (5\') ATGTCCCGGCGTGTGTTTACTTCC e GPI-2(3\') TCACAAAGTCGCAAAGCCCCACAGTCC, foi digerida com enzimas de restrição resultando em fragmentos de tamanho esperado (~2-2,5 kb) em 91% dos clones selecionados. Treze clones foram seqüenciados em suas extremidades 5\' e 3\'. Nenhum era idêntico entre si apesar da variabilidade da homologia de seqüência (40-70%). No entanto, quando comparadas as regiões codantes para o peptídeo sinal foi encontrada uma homologia de 90%. Para assegurar a clonagem de genes funcionais, uma biblioteca de cDNA foi construída com primers degenerados (5\'-ATTTTTGTTCCGCAGAAGACGCAGGTG, 3\'ATTCAGTGGGCGGTTGTACAGAAAGAC) por transcrição reversa de seqüências conservadas da superfamília das gp85/transialidases, excluindo a seqüência codante para o peptídeo sinal e a seqüência codante para âncora de GPI (presença de aminoácidos hidrofóbicos). Os cDNAs foram amplificados e clonados no vetor de expressão pCR®T7/NT-TOPO. Foram selecionados 60 clones que foram submetidos à análise de restrição e 90% deles mostraram fragmentos com tamanho esperado. As proteínas de fusão de 4 destes clones foram reconhecidas em Western blot por um anticorpo policlonal feito contra um fragmento da Tc85-11 (H3.3). As seqüências obtidas da extremidade 5\' revelou que os quatro clones pertencem à superfamília das gp85/transialidase (GenBank). O alinhamento destas seqüências com a Tc85-11 mostrou uma homologia de 60-80% e uma identidade de 40-70% na seqüência de aminoácidos. Estes dados confirmam a heterogeneidade da família da Tc-85 que é expressa pelo parasita. Ademais, a expressão de elevadas quantidades das proteínas correspondentes permitirá a identificação dos ligantes respectivos para estas proteínas de superfície específicas de tripomastigotas. / Several laboratories described molecules that are involved in Trypanosoma cruzi invasion of host-cells. Our laboratory was the first to describe molecules of 85 kDa belonging to a glycoprotein family (Tc-85) having different degrees of sequence homology with the members of the gp85/trans-sialidase supergene family. An acidic component (Tc85-11) of the Tc-85 family that binds to laminin and to host-cell receptors was cloned and expressed (Giordano et al., JBC 274, 3461, 1999). We raised the hypothesis that the polymorphism of different members of the Tc-85 family could specify different adhesion properties to host proteins. In order to prove the hypothesis, a genomic Iibrary of Tc-85 using the pTEX vector and primers R-1 (5\') ATGTCCCGGCGTGTGTTTACTTCC and GPI-2 (3\') TCACAAAGTCGCAAAGCCCCACAGTCC was cut with restriction enzymes resulting in fragments of the expected size (~2-2.5 kb) in 91% of the clones. Thirteen clones were sequenced from their 5\' and 3\' terminal ends. None were identical in spite of a variable sequence homology (40-70%), as opposed to 90% of homology when the signal peptide coding regions were compared. In order to assure the cloning of functional genes, a cDNA Iibrary was constructed with degenerated primers ((5\') ATTTTTGTTCCGCAGAAGACGCAGGTG / (3\') ATTCAGTGGGCGGTTGTACAGAAAGAC) for reverse transcription of conserved sequences from the gp85/trans-sialidase supergene family excluding the hydrophobic sequences from both extremities. The cDNAs were amplified by PCR and cloned into pCR ®T7/NT-TOPO expression vector. 60 clones were selected and were subjected to restriction analysis and 90% of the clones showed fragments with the expected size. The expressed fusion proteins of 4 of these clones were recognized in Western blots by a polyclonal antibody raised against a fragment of Tc85-11 (H3.3). The sequences obtained from the 5\' termini revealed that all four clones belong to the gp85/trans-sialidase supergene family (GenBank TM). The alignment of these sequences with Tc85-11 showed a homology of 60-80% and an identity of 40-70% in aminoacid sequence. These data confirm the heterogeneity of the Tc-85 family that is expressed by the parasite. Additionally, the expression of high amounts of the corresponding proteins will allow the identification of putative Iigands for these trypomastigote specific surface proteins.

A study was developed simultaneously in Southwestern of Paraná and the Depressão Central of Rio Grande do Sul, to evaluate the production, structural and botanical components, nutritive value and morphogenetic character (exclusively in Paraná) in pastures of Coastcross-1 and Tifton 85 mixed with forage peanut (0, 25, 50 and 75% of implanted area). The experimental design was factorial (three factors), distributed in a randomized block design with three replications, the factors were cultivars (2), the percentage of area located in the legume (4) and evaluation periods. Forage production was higher for cv. Tifton 85, particulary in the second crop year, however, showed no effect of the increase of forage peanut in deployment of pastures. The increasing area implanted with legumes decreased participation of fractions leaf blade, stem and dead material in pastures. In Paraná, the use of 75% of the area planted with forage peanut promoted approximate 30% of total massa forage legume, unlike Rio Grande do Sul, with the same percentage of inclusion did not exceed 15%. The increasing presence of the forage peanut mass in the system increased the nutritive value of the pasture. In Paraná, the cv. Coastcross-1 showed better nutritive value compared to Tifton 85, and, the inclusion of forage peanut positively changed the crude protein in the leaf blades of grasses studied, from the second year of establishment. The number of green leaves, growth and senescence rate were similar among cultivars, but, cv. Coastcross-1 showed a higher number of expanded leaves and leaf appearance rate and lower phyllochron and leaf lifespan. Lower average daily heat accumulation decreases the development of grasses studied, although more pronounced in cv. Tifton 85. / Desenvolveu-se um estudo simultaneamente no Sudoeste do Paraná e na Depressão Central do Rio Grande do Sul, com o objetivo de avaliar a produção, os componentes estruturais e botânicos, o valor nutritivo e as características morfogênicas (exclusivamente no Paraná) de pastagens de Coastcross-1 e Tifton 85 consorciadas com amendoim forrageiro (0, 25, 50 e 75% de área implantada). O delineamento experimental foi o fatorial (três fatores), distribuídos em blocos ao acaso com três repetições, os fatores foram as cultivares (2), o percentual de área implantada com do amendoim forrageiro (4) e os períodos de avaliação. A produção total de forragem foi superior para o cv. Tifton 85 em especial no segundo ano agrícola, no entanto, não apresentou efeito do acréscimo de amendoim forrageiro no plantio das pastagens. A crescente área implantada com a leguminosa diminuiu a participação das frações lâmina foliar, colmo + bainha e material morto nas pastagens. No Paraná, a utilização de 75% da área com plantio com o Arachis pintoi promoveu participação próxima a 30% de leguminosa na massa de forragem total, diferentemente do Rio Grande do Sul, que com mesmo percentual de inclusão não ultrapassou 15%. A crescente presença do amendoim forrageiro na massa de forragem das pastagens consorciadas, elevou o valor nutritivo do pasto. No Paraná a cv. Coastcross-1 apresentou melhor valor nutritivo quando comparado ao Tifton 85, e a inclusão de amendoim forrageiro estolonífero alterou positivamente o teor de PB nas lâminas foliares das gramíneas estudadas, a partir do segundo ano de estabelecimento. O número de folhas verdes, folhas em crescimento e a taxa de senescência foram similares entre as cultivares estudadas, porém, a cv. Coastcross- 1 apresentou maior número de folhas expandidas, maior taxa de aparecimento foliar, mas menor filocrono e tempo de vida de folha. A menor média de acúmulo térmico diário diminuiu o desenvolvimento das gramíneas estudadas, porém de forma mais acentuada na cv. Tifton 85.

As formas tripomastigotas do Trypanosoma cruzi expressam as Tc-85, glicoproteínas de superficie. A Tc85-11, um dos membros da família da Tc-85, foi caracterizado como uma proteína de adesão, com os sítios de ligação a laminina e citoqueratina 18 localizados, respectivamente, nos domínios amino e carboxiterminal. Utilizando-se primers consensos, um produto de cerca de 2000 pb foi amplificado do cDNA de formas tripomastigotas de T cruzi da cepa Y. Uma biblioteca enriquecida em membros da família da Tc-85 foi construída utilizando-se esses primers e o plasmídeo pCR T7/NT Topo Cloning (Invitrogen). O sequenciamento de cerca de 60 clones resultou em 30 ORFs completas. O sequenciamento de DNA foi realizado com o método dideoxi de terminação de cadeia e as seqüências foram analisadas. Por análise comparativa, identidades de 40-90% entres os clones sequenciados e 30-70% com membros da superfamília de proteínas das gp85/trans-sialidases foram encontradas. Os dados foram compilados nas seguintes ferramentas: ORF finder (NCBI), Cap3, Smith-Waterman, ClustalW, BioEdit e BLASTX/BLASTN (NCBI). Para a análise filogenética, foi utilizado o programa Paup empregando máxima parsimônia (MP), \"neighbor joining\" (NJ) e máxima probabilidade (MP). A árvore possuia dois grupos e foi submetida a análise de bootstrapping, com busca heurística completa e com 100 e 500 repetições. Os mesmos dois grupos apareceram quando a comparação de seqüências e análise filogenética foram correlacionadas. Em experimentos utilizando-se elementos de matriz extracelular - laminina e fibronectina- foi testada a ligação de proteínas recombinantes purificadas. A proteína codificada pelo inserto de cDNA Tc85-45 foi capaz de se ligar de maneira saturável a laminina e a fibronectina, mas não a albumina e gelatina. Os dados sugerem fortemente que, apesar da família da Tc-85- e por conseqüência a superfamília das gp85/trans-sialidases- codificarem proteínas com graus variáveis de seqüências similares, as seqüências específicas de peptídeos para a ligação a diferentes moléculas de matriz e receptores celulares variam entre membros da família, constituindo, assim, uma família multiadesiva de glicoproteínas que capacita o parasita a ultrapassar as barreiras impostas pelas membranas celulares, matrizes extracelulares e lâminas basais. / Trypomastigote forms of Trypanosoma cruzi express Tc-85 surface glycoproteins. Tc85-11, one member of the Tc-85 family, was characterized as an adhesion protein, with laminin and cytokeratin-18 binding sites localized, respectively, on the amino and carboxy terminal domains. Using consensus primers, a 2000 bp product was amplified from cDNA of trypomastigote forms of T. cruzi of the Y strain. A library enriched in Tc-85 cDNA was constructed using these primers and pCR T7/NT Topo Cloning (Invitrogen) plasmid. Sequencing of about 60 clones gave 30 complete ORFs. DNA sequencing was performed by the dideoxi-chain termination method and the sequences have been analyzed. By comparative analysis, identity of 40-90% was found among the sequenced clones and 30-70%, with members of the gp85/trans-sialidase superfamily proteins. The data were compiled in the following tools: ORF finder (NCBI), Cap3, Smith-Waterman algorithm, ClustalW, BioEdit and BLASTX/BLASTN (NCBI). For phylogenetic analysis, the Paup program was employed using maximum parsimony (MP), neighbor joining (NJ), and maximum likelihood (ML). The inferred tree had two groups and was submitted to full heuristic bootstrapping with 100 and 500 repetitions. The same two groups appeared when comparative sequence and phylogenetic analyses were correlated. In experiments in which extracellular matrix elements - laminin and fibronectin- were tested for binding to purified recombinant proteins, the protein coded by the cDNA insert Tc85-45 was able to bind in a saturable manner to laminin and fibronectin, but not to albumin and gelatin. The data strongly suggest that although the Tc-85 family, and by extension the gp85/glycoprotein superfamily, encode glycoproteins with variable degrees of similar sequences, the peptide sequences specific for the binding to different matrix molecules and cell receptors varies among the family members, thus, constituting a multi-adhesion family of glycoproteins that enables the parasite to overcome the barriers imposed by cell membranes, extracellular matrices and basal laminae.

Vários laboratórios descreveram moléculas que estão envolvidas na invasão do Trypanosoma cruzi à célula hospedeira. Nosso laboratório foi o primeiro a descrever moléculas de 85 kDa pertencentes a uma família de glicoproteínas (Tc-85) que possuem graus diferentes de homologia de seqüência com os membros da superfamília das gp85/transialidases. Um componente acídico (Tc85-11) da família Tc-85 que se liga à laminina e a receptores da célula hospedeira foi clonado e expresso (Giordano et al., JBC 274, 3461,1999). Nós levantamos a hipótese de que o polimorfismo dos diferentes membros da família Tc-85 poderiam determinar diferentes propriedades da adesão à célula hospedeira. Para provar tal hipótese, uma biblioteca genômica de Tc-85 utilizando o vetor pTEX e os seguintes primers: R-1 (5\') ATGTCCCGGCGTGTGTTTACTTCC e GPI-2(3\') TCACAAAGTCGCAAAGCCCCACAGTCC, foi digerida com enzimas de restrição resultando em fragmentos de tamanho esperado (~2-2,5 kb) em 91% dos clones selecionados. Treze clones foram seqüenciados em suas extremidades 5\' e 3\'. Nenhum era idêntico entre si apesar da variabilidade da homologia de seqüência (40-70%). No entanto, quando comparadas as regiões codantes para o peptídeo sinal foi encontrada uma homologia de 90%. Para assegurar a clonagem de genes funcionais, uma biblioteca de cDNA foi construída com primers degenerados (5\'-ATTTTTGTTCCGCAGAAGACGCAGGTG, 3\'ATTCAGTGGGCGGTTGTACAGAAAGAC) por transcrição reversa de seqüências conservadas da superfamília das gp85/transialidases, excluindo a seqüência codante para o peptídeo sinal e a seqüência codante para âncora de GPI (presença de aminoácidos hidrofóbicos). Os cDNAs foram amplificados e clonados no vetor de expressão pCR®T7/NT-TOPO. Foram selecionados 60 clones que foram submetidos à análise de restrição e 90% deles mostraram fragmentos com tamanho esperado. As proteínas de fusão de 4 destes clones foram reconhecidas em Western blot por um anticorpo policlonal feito contra um fragmento da Tc85-11 (H3.3). As seqüências obtidas da extremidade 5\' revelou que os quatro clones pertencem à superfamília das gp85/transialidase (GenBank). O alinhamento destas seqüências com a Tc85-11 mostrou uma homologia de 60-80% e uma identidade de 40-70% na seqüência de aminoácidos. Estes dados confirmam a heterogeneidade da família da Tc-85 que é expressa pelo parasita. Ademais, a expressão de elevadas quantidades das proteínas correspondentes permitirá a identificação dos ligantes respectivos para estas proteínas de superfície específicas de tripomastigotas. / Several laboratories described molecules that are involved in Trypanosoma cruzi invasion of host-cells. Our laboratory was the first to describe molecules of 85 kDa belonging to a glycoprotein family (Tc-85) having different degrees of sequence homology with the members of the gp85/trans-sialidase supergene family. An acidic component (Tc85-11) of the Tc-85 family that binds to laminin and to host-cell receptors was cloned and expressed (Giordano et al., JBC 274, 3461, 1999). We raised the hypothesis that the polymorphism of different members of the Tc-85 family could specify different adhesion properties to host proteins. In order to prove the hypothesis, a genomic Iibrary of Tc-85 using the pTEX vector and primers R-1 (5\') ATGTCCCGGCGTGTGTTTACTTCC and GPI-2 (3\') TCACAAAGTCGCAAAGCCCCACAGTCC was cut with restriction enzymes resulting in fragments of the expected size (~2-2.5 kb) in 91% of the clones. Thirteen clones were sequenced from their 5\' and 3\' terminal ends. None were identical in spite of a variable sequence homology (40-70%), as opposed to 90% of homology when the signal peptide coding regions were compared. In order to assure the cloning of functional genes, a cDNA Iibrary was constructed with degenerated primers ((5\') ATTTTTGTTCCGCAGAAGACGCAGGTG / (3\') ATTCAGTGGGCGGTTGTACAGAAAGAC) for reverse transcription of conserved sequences from the gp85/trans-sialidase supergene family excluding the hydrophobic sequences from both extremities. The cDNAs were amplified by PCR and cloned into pCR ®T7/NT-TOPO expression vector. 60 clones were selected and were subjected to restriction analysis and 90% of the clones showed fragments with the expected size. The expressed fusion proteins of 4 of these clones were recognized in Western blots by a polyclonal antibody raised against a fragment of Tc85-11 (H3.3). The sequences obtained from the 5\' termini revealed that all four clones belong to the gp85/trans-sialidase supergene family (GenBank TM). The alignment of these sequences with Tc85-11 showed a homology of 60-80% and an identity of 40-70% in aminoacid sequence. These data confirm the heterogeneity of the Tc-85 family that is expressed by the parasite. Additionally, the expression of high amounts of the corresponding proteins will allow the identification of putative Iigands for these trypomastigote specific surface proteins.