No description available.

Les acides nucléiques riches en guanines ou en cytosines peuvent se replier sur eux-mêmes et former des systèmes tétramériques tels que les G-quadruplexes (G4) ou les i-motifs. Ces motifs, abondamment représentés dans certaines régions du génome humain semblent contribuer à la régulation cellulaire et suscitent depuis plusieurs années un intérêt grandissant. Ils sont notamment présents dans la région télomérique, mais aussi dans les promoteurs d’oncogènes ou au sein des génomes viraux et sont impliqués dans certaines pathologies humaines. Ils représentent ainsi des cibles thérapeutiques et diagnostiques potentielles. Cependant, les G4 adoptent in-vitro des topologies variées qui compliquent le développement de ligands spécifiques et affins. Dans ce contexte, le laboratoire a développé le concept du TASQ pour ‘‘Template Assembled Synthetic G-Quadruplex’’ dans le but d'accéder à des G4 se structurant en une topologie définie.Le premier chapitre décrit l’assemblage de mimes de motifs G4 contraints en une topologie unique. En utilisant un gabarit cyclodécapeptide rigide et différentes méthodes de conjugaison, nous avons assemblé des motifs G4 ARN parallèle et hybride ADN/ARN dérivant de la séquence télomérique ainsi qu’un motif G4 d’ADN présent dans la séquence promotrice du VIH-1. L’utilisation du concept TASQ nous a également permis de préparer un motif G-triplexe (G3), intermédiaire à la formation des motifs G4. Nous avons montré une forte stabilisation de tous les édifices G4 contraints ainsi préparés.Le second chapitre concerne les études de caractérisation et de sélection de ligands vis-à-vis des motifs G4 et G3 contraints. La caractérisation repose sur l’évaluation de l’affinité et de la sélectivité de différentes familles de ligands pour ces édifices, par résonance plasmonique de surface ou par interférométrie bio-couche. La sélection de ligands a été réalisée par la méthode SELEX dans le but d’obtenir des aptamères affins et spécifiques d’un motif G4 contraint. / Guanines or cytosines rich nucleic acids can fold into tetrameric G-quadruplexes (G4) or i-motifs structures. G4 motifs are found within the human genome and should contribute to cellular regulation. In particular G4 are found at telomeric region and also in promoters of oncogenes or within viral genomes. They are suspected of participating in the regulation of human pathologies and have therefore been envisioned as potential therapeutic and diagnostic targets. However, the intrinsic conformational polymorphism of G4 motifs complicates the development of specific and affine ligands. In this context, the laboratory has developed the TASQ concept for "Template Assembled Synthetic G-Quadruplex" with the aim to obtain a defined G4 topology.The first chapter reports on the assembly on the peptide template of RNA and DNA:RNA hybrid G4 structures that derive from the human telomeric sequence as well as of DNA G4 structure found within the HIV virus promoter. G-triplex (G3) motif which is supposed to be an intermediate during the formation of the G4 motifs has also been prepared. By using appropriate ligations of the oligonucleotide strands on the peptide template we were able to control the folding of G-quadruplex motifs and stabilize them.The second chapter reports the studies for the characterization and the selection of ligands against G4 and G3 motifs. The evaluation of the affinity and selectivity of different families of ligands for these constrain motifs was performed by using surface plasmon resonance or by bio-layer interferometry. The selection of ligands was carried out by the SELEX method in order to obtain affine and specific aptamers of a constrained G4 motif.

No description available.

No description available.

No description available.

No description available.

No description available.

Les G-quadruplexes sont des structures non-canoniques fascinantes de l’ADN et/ou de l’ARN qui surviennent dans les régions riches en Guanines. La surreprésentation de ces structures dans des régions spécifiques comme les promoteurs des oncogènes et les télomères, suggère leur intervention dans les processus cellulaires clés comme la transcription, la réplication ou bien la maturation de l’ARN. De nouveaux outils in silico, in vitro et in cellulo pour la prédiction des G-quadruplexes ont été proposés, reflétant la pertinence croissante de ces structures. Des cibles potentielles de G-quadruplexes ont été décrites dans le génome humain, chez la levure, des bactéries, virus et bien d’autres. Cependant, un des problèmes dans l’étude des G4s dans le génome humain est le grand nombre de séquences susceptibles de former des structures G4s (370,000 PQS selon Quadparser et plus d’un million en utilisant un seuil de 1.5 selon G4Hunter). Il est alors presque impossible de déconvoluer les effets biologiques reliés aux G-quadruplexes dans les cellules humaines. Pour cela, nous avons choisi Dictyostelium discoideum – dont le génome est pauvre en G4s - comme modèle eucaryote pour compléter les études sur le génome humain. Avec une analyse in silico du génome de dicty en utilisant G4Hunter, un algorithme développé dans notre laboratoire, nous avons pu détecter entre 249 (seuil=2) et 1055 (seuil=1.5) séquences pouvant adopter une structure G4. D’une façon intéressante, bien que les promoteurs soient plus pauvres encore en GC que le reste du génome de dicty, la densité des G4s dans ces régions est significativement plus haute. En utilisant une combinaison de différentes méthodes biophysiques et biochimiques, nous avons démontré que parmi les séquences prédites, 14 séquences qui sont présentes dans des gènes susceptibles de jouer des rôles importants dans dicty forment des structures G4 stables. En plus, cinq gènes de dicty contenant des séquences G4s dans leurs promoteurs ont été étudiés pour l’effet d’un nouveau ligand G4 dérivé de Porphyrine sur leur expression. Nous avons démontré que ce nouveau ligand inhibe l’expression de ces gènes significativement. Globalement, nos résultats constituent le premier pas dans le but d’adopter Dictyostelium discoideum comme un nouveau modèle pour l’étude des G-quadruplexes. / G-quadruplexes (G4) are fascinating non-canonical DNA/RNA secondary structures that occur in genomic Guanine-rich regions. The over-representation of such structures in specific regions such as promoters of oncogenes and telomeres, suggests their involvement in key processes such as transcription, replication or RNA maturation. The development of in silico, in vitro and in cellulo tools for G4 prediction is emerging, reflecting the increasing relevance of these structures. Putative G4 forming sequences (PQS) have been reported in Homo sapiens, yeast, bacteria, viruses and many others. However, one of the problems in studying G4 structures in the human genome is indeed the high number of putative G4 forming sequences (370,000 PQS according to Quadparser and over 1 million when using a threshold of 1.5 with G4Hunter). It is therefore difficult to deconvolute G4-related biological effects in human cells. For this, we chose Dictyostelium discoideum - a G4 poor genome - as a eukaryotic model to complement the human studies. By an in silico analysis of dicty genome with G4Hunter a home-made algorithm, we detected 249 (threshold=2) to 1055 (threshold=1.5) G4-prone motifs. Interestingly, despite an even lower GC content in comparison to the whole dicty genome, the density of G4 motifs in dicty promoters is significantly higher than in the rest of the genome. By using a combination of different biophysical and biochemical methods, we demonstrated that 14 dicty sequences located in key genes fold into stable G4 structures. In addition, five dicty genes containing G4-prone motifs in their promoters were studied for the effect of a new Porphyrin derivative on their expression. Our results demonstrated that the new ligand decreased the expression of the several dicty genes significantly. Overall, our results constitute the first step to adopt Dictyostelium discoideum as a model for G4 studies.

Les G-quadruplexes (G4) sont des structures non canoniques des acides nucléiques qui peuvent être formés dans des régions d’ADN ou d’ARN riches en guanines. Les ligands G4 (LG4), sont des molécules capables d’interagir et de stabiliser les structures G4, qui présentent de nombreuses propriétés anti-cancéreuses. Nous avons travaillé avec le LG4 20A, appartenant à la famille des triarylpyridines, qui stabilise efficacement les structures G4 in vitro. Les objectifs de ce travail ont été de déterminer les mécanismes moléculaires et cellulaires responsables des effets anti-prolifératifs du 20A dans des cellules cancéreuses. Dans cette étude, nous avons montré que le 20A induit un arrêt de la croissance cellulaire de cellules en culture et dans un modèle de xénogreffe tumorale, grâce à l’induction de la sénescence et de la mort cellulaire par apoptose. Ces réponses sont associées à l’activation de la voie des réponses aux dommages à l’ADN (DDR) via la kinase ATM, qui favorise l’autophagie (un processus catabolique) et la sénescence, tout en protégeant les cellules de l’apoptose. De plus, nous avons observé que le 20A induit un échec de la cytokinèse, conduisant à l’accumulation de cellules binucléées qui présentent une résistance à la mort cellulaire. De façon inattendue, nous avons trouvé que le 20A s’accumule dans les lysosomes, induisant une augmentation de la taille de ces derniers. La combinaison du 20A et de l’agent lysomotropique chloroquine, potentialise de façon importante la perméabilisation de la membrane lysosomale (LMP) et la mort cellulaire. En particulier, cette combinaison sensibilise de façon notable ces cellules binucléées à la mort cellulaire. L’ensemble de ces résultats révèle une relation entre les processus de mort cellulaire et de sénescence induits par le LG4 20A, et les voies de DDR et lysosomales. Ces régulations devraient être prises en considération lors de l’utilisation d’agents antiprolifératifs susceptibles d’interférer avec les fonctions lysosomales. / G-quadruplexes (G4) are unusual nucleic acid structures that can be formed by guanine-rich DNA and RNA. Through their ability to stabilize G4 structures, G4 ligands (G4L) have been described to display potent anticancer properties. Here, we studied the G4L 20A belonging to the triarylpyridine family of compounds that have the ability to efficiently bind to and stabilize G4 structures in vitro. The objectives of this work were to determine the molecular and cellular mechanisms responsible for the anti-proliferative effects of 20A in cancer cells. In this study, we showed that 20A causes cancer cell growth arrest in cell culture and a mice tumour xenograft model, through induction of senescence and apoptotic cell death. These cellular responses are associated with the induction of the DNA damage response pathway (DDR), in particular ATM activation, which promotes the induction of both autophagy (a lysosomal catabolic pathway) and senescence, while protecting cells against apoptosis. Furthermore, we found that 20A induces failure of cytokinesis which results in the accumulation of binucleated cells that display marked resistance to 20A-induced cell death. Unexpectedly, we found that 20A accumulates in the lysosomal compartment and causes lysosome enlargement. The combination of a lysosomotropic agent, chloroquine, and 20A promotes a significant induction of lysosomal membrane permeabilization (LMP) and a robust cell death. In particular, this combination significantly sensitizes binucleated cells to cell death. Altogether, our results uncover the relationship of the DDR and lysosomal pathways to cell death and senescence induced by the G4L 20A. Such regulation should also be taken into account when using antiproliferative drugs susceptible to interfere with the lysosomal functions.

The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)