Natural killer or NK cells are immunocytes that mediate innate immunity against pathogens and tumors without pre-exposition to the antigen. They are holding rapid antiviral defense during the initial phase of immune response, before starting the production of antibodies and the development of specific cytotoxic T -lymphocytes. On the surface of NK cells is expressed wide range of inhibition and activation receptors. Important family of those receptors are C - type lectin like from which the family of NKR - P1 ("natural killer cell receptor - protein 1") was discovered first. Diploma thesis deals with the preparation/study of mice NK cell activation receptor NKR- P1C and searching for its binding partner. The soluble form of the protein NKR-P1C was prepared by recombinant expression using the transient transfection of HEK293 cell line (human embryonic kidney 293) with wild type or homogenous glycosylation as IgG - Fc fusion protein, from which was it possible to obtain pure dimer of NKR P1C, after process of affinity purification, TEV protease cleavage and HPLC chromatography. The fusion protein was bound to protein A labeled with a fluorescent probe DyLight 488. Mice tissues and cell lines were labeled by this complex for purpose of seeking ligand.

Master of Science / Department of Agronomy / Allan K. Fritz / Fusarium head blight (FHB), caused by Fusarium graminearum, is an important cereal disease in humid and semi-humid wheat growing regions. In recent FHB epidemics in the USA, FHB dramatically reduced wheat yields and grain quality due to mycotoxin contamination. Five types of FHB resistance have been reported, but resistance to disease spread within a spike (Type II) and low deoxynivalenol (DON) accumulation in infected kernels (Type III) have drawn the most attention. A Chinese Spring-Sumai3 chromosome 7A substitution line (CS-SM3-7ADSL) was reported to have a high level of Type II resistance, but quantitative trait locus (QTL) on chromosome 7A has never been mapped. To characterize QTL on chromosome 7A, we developed 191 Chinese Spring-Sumai3-7A chromosome recombinant inbred lines (CRIL) from a cross between Chinese Spring and CS-SM3-7ADSL and evaluated the CRIL in a greenhouse for both types of resistance in three experiments. Two major QTL with Sumai 3 (SM3) origin, conditioning Type II and Type III resistance were mapped in chromosomes 3BS and 7AC. QTL on chromosome 3BS corresponds to Fhb1, previously reported from SM3, whereas 7AC QTL, designated as Fhb5, is a novel QTL identified from SM3 in this study. Fhb5 explains 22% phenotypic variation for Type II resistance and 24% for Type III resistance. Marker Xwmc17 is the closest marker to Fhb5 for both types of resistance. Fhb1 and Fhb5 were additive and together explained 56% variation for Type II and 41% for Type III resistance and resulted in 66% reduction in FHB severity and 84% in DON content. Both QTL showed significant pleiotropy effects on Type II and Type III resistance, suggesting both types of resistance may be controlled by the same gene(s). Haplotype analysis of SM3’s parents revealed that Fhb5 originated from Funo, an Italian cultivar. A survey of worldwide germplasm collection of 400 accessions showed that Fhb5 is present mainly in Chinese cultivars, especially in Funo-related accessions. Further, Fhb5 is the second major QTL from SM3 and have potential to be used in improving wheat cultivars for both types of resistance.

>Magister Scientiae - MSc / Tuberculosis (TB) is a global health problem and rated as the second leading cause of death after HIV/AIDS. Transmission of TB from one person to the next is very rapid in crowded communities. Therefore, it is crucial to identify people who are infected as quickly as possible not only to provide treatment but also to prevent the spread of the disease. Current TB diagnostic tests such as the culture and sputum smear tests are time-consuming, while rapid tests make use of antibodies that are costly and have low sensitivity and stability. Great improvement has been observed when aptamers are used in place of antibodies in rapid diagnostic tests such as lateral flow devices (LFDs). Therefore, the current study aims to synthesize and identify aptamers against serum biomarkers for development of rapid TB diagnostic tests such as a lateral flow assay. Several TB serum biomarkers have been identified and can be used for the diagnosis of TB. TB biomarkers expressed in serum samples were identified through in silico approach. The biomarkers were expressed in bacterial systems using recombinant DNA technology. The recombinant proteins were purified by affinity chromatography and further used as targets for the selection of aptamers using Systemic Evolution of Ligands by EXponential enrichment (SELEX). Aptamers for the selected biomarkers were synthesized based on magnetic-bead based SELEX and characterized by electrophoretic mobility shift assay (EMSA), Surface Plasmon resonance (SPR) and MicroScale Thermophoresis (MST). Six putative TB serum biomarker proteins were selected from literature, namely, Insulin-like Growth Factor Binding Protein 6 (IGFBP6), Interferon-stimulated Gene 15 (ISG15), Calcium Binding Protein (S100A9), Retinol Binding Protein 4 (RBP4), Granzyme A (GrA), and Transgelin-2 (TAGLN2). The biomarkers were recombinantly expressed and purified after which they were used as targets in SELEX for aptamers synthesis. Aptamers were analysed by in silico method and the ones with highly conserved motifs were selected. The selected aptamers were synthesized and later characterized. The aptamers that show high affinity and specificity for the biomarkers will be used for the fabrication of a rapid lateral flow device for TB screening. Such a test would allow for a short diagnostic turnaround time, and hence expedite treatment.

Department of Biochemistry, Faculty of Science, Charles University in Prague 2010 Structure and function of C-type lectin NK cell receptors studied by recombinant expression and protein crystallography Abstract of Ph.D. thesis Ondřej Vaněk Supervisor: Prof. RNDr. Karel Bezouška, DSc. Natural killer cells (NK cells) were found out for their ability to spontaneously kill certain allogeneic tumour cell lines, without any previous sensitization. NK cells are part of non- adaptive immune response with very short reaction time against pathogens such as viruses, intracellular bacteria, parasites, and they are responsible for elimination of certain tumour cells and thus they are able to fight against malignancy and formation of metastasis. Activity of NK cells is regulated by the balance between activation and inhibitory signals mediated by the NK cell surface receptors. From the structural point of view, the majority of NK cell surface receptors could be classified as the C-type lectin or immunoglobulin-like receptors. One of many C-type lectin subgroups are type II lymphocyte receptors that are expressed on the NK cell surface. This study had two main aims. The first one was to find suitable expression and purification systems for selected C-type lectin receptors of NK cells and the other one was to perform their...

O Antígeno 1 de Membrana Apical (AMA-1) tem sido sugerido como candidato a compor uma vacina contra estágios assexuados sanguíneos de Plasmodium. Recentemente nosso grupo identificou o domínio II (DII) de AMA-1 de Plasmodium vivax (PvAMA-1) como uma região altamente reconhecida por anticorpos IgG de indivíduos brasileiros infectados por P. vivax. No presente estudo avaliamos as propriedades imunogênicas da proteína recombinante DII, produzida a partir de Escherichia coli. Grupos de 6 camundongos fêmeas BALB/c foram imunizados quatro vezes com 10 µg dessa proteína na presença de diferentes formulações de adjuvantes [Adjuvante Completo/Incompleto de Freund (ACF/AIF), MPL-TDM, TiterMax, Hidróxido de Alumínio (Alum), Quil A, QS-21 e CpG-ODN 1826], individualmente, ou em combinação (Alum + QS-21 ou Alum + CpG-ODN 1826)). Nosso objetivo foi avaliar comparativamente a resposta de anticorpos (IgM, IgG e isotipos de IgG), induzida pelos diferentes esquemas de imunizações, visando futuros estudos pré-clínicos em primatas não humanos. Os títulos de anticorpos IgG contra (o ectodomínio) PvAMA-1 foram determinados por ELISA, duas semanas após cada imunização. A presença de IgM e dos isotipos de IgG também foi avaliada após o final do esquema de imunizações. Nossos resultados demonstraram que a proteína recombinante DII foi altamente imunogênica em camundongos BALB/c quando administrada na presença dos adjuvantes testados. Altos títulos de IgG1, IgG2a e IgG2b foram observados na maioria dos grupos (com exceção do adjuvante Alum), sugerindo uma resposta mista Th1/Th2. Finalmente, demonstramos que anticorpos monoclonais e policlonais anti-DII reconheceram a proteína nativa expressa na superfície de merozoítas de P. vivax, por imunofluorescência. Em conclusão, nossos resultados mostraram que a proteína recombinante o domínio II de PvAMA-1 (DII) foi imunogênico em camundongos BALB/c quando administrado na presença das diferentes formulações de adjuvantes testadas, sugerindo que esse antígeno possa ser utilizado como uma vacina de subunidade contra a malária vivax. / The Apical Membrane Antigen 1 (AMA-1) has been considered a malaria vaccine candidate against asexual blood stages of Plasmodium. Recently, we identified the domain II (DII) of Plasmodium vivax AMA-1 (PvAMA-1) as a region highly recognized by IgG antibodies from Brazilian individuals infected by P. vivax. In the present study, we evaluated the immunogenic properties of a bacterial recombinant PvAMA-1 DII. Groups of 6 female BALB/c were immunized four times with 10 µg of recombinant protein in the presence of different adjuvant formulations [Complete/Incomplete Freunds Adjuvant (CFA/IFA), MPL-TDM, TiterMax, Aluminum hydroxide (Alum), Quil A, QS-21, CpG-ODN 1826] separately or in combination (Alum + QS-21 or Alum + CpG-ODN 1826). Our goal was to compare the antibody response (IgM, IgG and IgG subclass) induced by different protocols of immunization aiming at future pre-clinical studies in non-human primates. The IgG antibody titers against PvAMA-1 were determined by ELISA two weeks after each immunizing dose. The presence of IgM and IgG subclass were evaluated after the end of immunizations schedule. We found that the recombinant DII was highly immunogenic in BALB/c mice when administered in the presence of all adjuvant tested. High titers of IgG1, IgG2a and IgG2b were observed in all groups (except for Alum adjuvant), suggesting a mixed Th1/Th2 response. Finally, we demonstrated that monoclonal and polyclonal antibodies against DII recognized the native protein expressed on the P. vivax merozoite surface parasites by immunofluorescence. Together, our data demonstrated that the recombinant PvAMA-1(DII) was immunogenic in mice when administered in different adjuvant formulations, suggesting that this protein can be used as part of a sub-unit vaccine against malaria vivax.

O avanço no desenvolvimento de uma vacina contra o Plasmodium vivax exige a identificação de antígenos capazes de induzir uma resposta imune protetora contra a malária. O presente estudo avalia o potencial da proteína-3 da superfície de merozoítos de P. vivax (PvMSP-3), como candidata a vacina. As proteínas recombinantes representando a região C-terminal da MSP-3α e diferentes regiões (N e C-terminal e proteína inteira) da MSP-3β de P. vivax foram utilizadas como antígeno. A imunogenicidade destas proteínas recombinantes foi avaliada em camundongos BALB/c, utilizando adjuvantes agonistas de TLR (flagelina FliC de Salmonella Typhimurium e CpG ODN) ou adjuvantes convencionais, tais como hidróxido de alumínio, saponinas, TiterMax Gold e adjuvante incompleto de Freund. Os títulos de anticorpos IgG foram determinados por ELISA utilizando soros de camundongos coletados duas semanas após cada dose de imunização. Nossos resultados demonstraram que a MSP-3α e a MSP-3β foram capazes de induzir altos títulos de anticorpos em camundongos na presença de diferentes adjuvantes, incluindo agonistas de TLR. Dentre as formulações testadas, aquelas contendo os adjuvantes CPG ODN 1826, Quil A, TiterMax e adjuvante incompleto de Freund foram mais imunogênicas e, portanto, mais promissoras para os ensaios pré-clínicos em primatas não-humanos. Usando camundongos TLR-4 KO, nós demonstramos que a proteína MSP-3β tem uma propriedade adjuvante intrínseca que é independente do TLR4 e que a contaminação por LPS na proteína purificada não desempenha qualquer papel no nosso sistema. / The advance in the development of a vaccine against Plasmodium vivax requires the identification of immunodominant antigens able to induce a protective immune response against malaria. The present study evaluates the potential of the Merozoite Surface Protein 3 of P. vivax (PvMSP-3) as vaccine candidate. Recombinant proteins representing the C-terminal region of MSP-3α and different regions of MSP-3β (N and C-terminal and full-length protein) of P. vivax were used as antigen. The immunogenicity of these recombinants was evaluated in BALB/c mice using as adjuvant TLR agonists (FliC flagellin of Salmonella Typhimurium and CpG motif-containing DNA) or conventional adjuvants such as Aluminum hidroxide, Saponins, TiterMax Gold and Incomplete Freund\'s Adjuvant. The IgG antibodies were determined by ELISA in sera from mice two weeks after each immunizing dose. Our results demonstrated that MSP-3α and MSP-3β were able to induce high antibody titres in mice in the presence of different adjuvants, including TLR agonists. Among the tested formulations, the adjuvants CPG ODN 1826, Quil A, TiterMax and Incomplete Freund\'s Adjuvant were more immunogenic, therefore more promising for pre-clinical trials in non-human primates. Using TLR-4 KO mice, we demonstrated that the MSP-3β protein has an intrinsic adjuvant property that is independent of TLR4 and that contaminating LPS in the purified protein did not play any role in our system.

Plasmodium malariae é responsável por uma baixa porcentagem de casos clínicos de malária, mas tem uma distribuição global ampla e fragmentada. Humanos podem abrigar o parasita por anos sem produzir sintomas significantes, o que dificulta o diagnóstico e consequente controle da doença. Por esta razão, a incorporação de antígenos de P. malariae nas estratégias em curso para produção de uma vacina é altamente recomendada. Embora a proteína de superfície do merozoíto1 (MSP1) de P. vivax e P. falciparum sejam amplamente estudadas como candidatos a vacinas, potencializando a resposta imune em camundongos e macacos, a MSP1 de P. malariae tem sido negligenciada. Portanto, este estudo visou caracterizar a imunogenicidade de proteínas recombinantes da MSP1 de P. malariae em camundongos BALB/c. Cinco regiões da PmMSP1 (N-terminal, F1; repetições em tandem, F2; central, F3 e C-terminal, F4 e PmMSP119) foram clonadas em vetor pGEX-3Y e expressas em Escherichia coli em fusão com GST. As proteínas recombinantes foram produzidas por fermentação e purificadas, fornecendo um alto rendimento de antígenos solúveis. Essas proteínas recombinantes e GST sozinha (grupo controle) foram usadas para imunizar, pela via intraperitoneal, seis grupos de camundongos BALB/c em 3 doses com intervalos de 14 dias. A especificidade e as subclasses dos anticorpos foram avaliadas por enzyme-linked immunosorbent assay (ELISA), utilizando as proteínas recombinantes como antígenos. A resposta imune celular foi analisada pelo ensaio de linfoproliferação e os níveis de citocinas Th1/Th2 nos sobrenadantes de culturas de esplenócitos foram detectados por citometria. Nossos resultados demonstraram que as regiões F1, F2, F3, F4 e PmMSP119 são imunogênicas em camundongos com a capacidade de produzir respostas imunes humorais e celulares, como mostrado pelos altos títulos de anticorpos (1/809,000) e pela proliferação de linfócitos. As respostas imunes induzidas alcançaram níveis máximos após três doses imunizantes permanecendo altas por 70 dias. Os anticorpos induzidos após imunização com as regiões F1, F2, F3 e F4 mostraram afinidades similares aos antígenos alvo, mas anticorpos induzidos após imunização com PmMSP119 mostraram uma afinidade mais alta com o antígeno alvo. Análise das subclasses de IgG mostrou que todas as proteínas recombinantes induziram padrões similares de anticorpos onde IgG1, IgG2a e IgG2b foram mais predominantes, caracterizando uma resposta mista de Th1/Th2. Além disso, a imunização dos camundongos com as proteínas recombinantes e estimulação com os mesmos antígenos promoveu produção de IL-4. Os níveis das citocinas Th1/Th2 não mostraram diferenças significativas quando comparados entre os grupos. A proliferação dos linfócitos estimulados com F2, F3 e PmMSP119, foi maior que aquela dos estimulados com F1, F4 e GST. Ainda, todos os soros dos animais imunizados com as cinco proteínas recombinantes de PmMSP1, que foram positivos por ELISA, mostraram reatividade com esquizontes de P. brasilianum nos ensaios de imunofluorescência (IFA). As proteínas recombinantes de PmMSP1 reagiram com anticorpos IgG nas amostras de soro de indivíduos expostos a P. malariae com alta especificidade comparado a amostras de soro de indivíduos com doenças não relacionadas. Entretanto, as regiões F1 e F2 e PmMSP119 foram reconhecidas por soros de pacientes com P. malariae com os títulos mais altos e não apresentaram reconhecimento em soros de pacientes com P. falciparum e P. vivax. Esses dados reforçam a utilidade destas proteínas como marcadores diagnósticos de P. malariae em estudos epidemiológicos ou no diagnóstico diferencial da malária causada por esta espécie. No entanto, a região F4 foi reconhecida igualmente em soros homólogos ou heterólogos e, portanto, poderia ser útil para testes pointof- care para o diagnóstico de malária. A imunização com as diferentes proteínas recombinantes de PmMSP1 promove uma resposta imune humoral significante, com altos e específicos níveis de IgG, além de uma distribuição de subclasses balanceada, fornecendo evidências de potenciais candidatos a uma vacina contra P. malariae. / Plasmodium malariae is responsible for a low percentage of clinical malaria cases and has a patchy distribution in the world. Humans can host the parasite for years without presenting significant symptoms, which turns its diagnosis and control a difficult task. For this reason, the incorporation of P. malariae antigens in vaccination strategies is highly recommended. Although the merozoite surface protein 1 (MSP1) of P. vivax and P. falciparum are widely studied as vaccine candidates, potentiating the immune response in mice and monkeys, P. malariae MSP1 has been neglected. Herein we invested in the characterization of the immunogenicity of recombinant proteins of P. malariae MSP1 in BALB/c mice. Five regions of PmMSP1 (N-terminus, F1; tandem repeat, F2; central region, F3 and C-terminus, F4 and PmMSP119) were cloned into vector pGEX-3Y and expressed in Escherichia coli in fusion with GST. Recombinant proteins were produced by fermentation and purified, providing a high yield of soluble antigens. These recombinant proteins and GST alone (control group) were used to immunize, via the intra-peritoneal route, six groups of BALB/c mice in three doses at 14-day intervals. The specificity and subtyping of the antibodies were evaluated by enzyme-linked immunosorbent assay (ELISA), using the recombinant proteins as antigens. Cellular immune responses were analyzed by lymphoproliferation assays and the Th1/Th2 cytokine levels in the supernatant of splenocyte cultures were detected by cytometry. Our results demonstrated that F1, F2, F3, F4 regions and PmMSP119 are immunogenic in mice with the capacity to elicit humoral and cellular immune responses, as denoted by high antibody titers (1/809,000) and the proliferation of lymphocytes. The induced immune responses reached maximum levels after three doses remaining high for 70 days. Antibodies induced after immunization with F1, F2, F3 and F4 regions showed similar affinities to the target antigens, but antibodies induced after immunization with PmMSP119 showed a higher affinity to the target antigen. Analysis of IgG subclasses showed that all the recombinant proteins induced similar antibody subclass patterns where IgG1, IgG2a and IgG2b were most predominant, characterizing a Th1/Th2 mixed response. Furthermore, immunization of mice with the recombinant proteins upon stimulation with the same antigen secreted IL-4. The levels of Th1/Th2 cytokines did not show significant differences when compared among groups. The proliferation of the stimulated lymphocytes, with F2, F3 and PmMSP119, was greater than those stimulated with F1, F4 or GST. Additionally, all sera from mice immunized with the five PmMSP1 recombinant proteins, which were positive by ELISA, showed reactivity with P. brasilianum schizonts by immunofluorescence assays (IFA). The PmMSP1 recombinant proteins reacted with IgG antibodies in serum samples from individuals exposed to P. malariae infections with a high specificity compared to serum samples from individuals with unrelated diseases. However, the F1 and F2 regions and PmMSP119 showed the highest titers in addition to no recognition by sera from P. falciparum and P. vivax infections. These data strengthen the usefulness of these proteins as diagnostic markers of P. malariae in epidemiological studies or in the differential diagnosis of malaria caused by this species. Nevertheless, the F4 region was recognized equally in homologous or heterologous sera, and thus, could be useful for point-of-care tests for malaria diagnosis. Immunization with the different PmMSP1 recombinant proteins promotes a significant humoral immune response, with high and specific IgG levels, in addition, a balanced subclass distribution, suggesting them as potential candidates for a vaccine against P. malariae.

A dengue é uma doença infecciosa com grandes taxas de morbimortalidade, causada pelo vírus da dengue (DENV). Segundo a Organização Mundial de Saúde, cerca de 50 a 100 milhões de pessoas são infectadas anualmente em mais de 100 países tropicais e subtropicais de todos os continentes. O espectro clínico da infecção pelo DENV pode incluir formas assintomáticas ou sintomaticas que variam desde uma febre indeterminada e autolimitada, passando pela febre clássica da dengue (FD) até quadros graves denominados febre hemorrágica da dengue/síndrome do choque da dengue (FHD/SCD). Recentemente, ocorreu um dramático aumento do número de casos de FHD/SCD nas Américas, e este aumento coincidiu com a introdução do dengue sorotipo 3, genótipo III. No presente trabalho, objetivou-se a clonagem e a expressão das proteínas NS1 e NS3 do vírus da dengue tipo 3. As proteínas NS1 e NS3 do DENV-3 foram clonadas e expressas com sucesso em sistema procarioto. A amplificação dos genes das proteínas NS1 e NS3 foi realizada por RT-PCR, o qual gerou amplicons de cerca de 1050 e 1850 pb, respectivamente. Em seguida, os genes foram clonados por inserção dos amplicons no vetor plasmidial pCR-XL. Os genes de NS1 e NS3 foram subclonados no vetor de expressão pQE-30 através de sítios de restrição para as enzimas BamHI e HindIII. A expressão proteica foi obtida em sistema procarioto utilizando a cepa BL21(DE3) de E. coli, resultando em proteínas de 45 e 70 kDa as quais foram confirmadas por análises em Western blot utilizando como anticorpo primário fluido ascítico imune de camundongos e soro de pacientes com dengue. Estas proteínas virais podem ser utilizadas para estudos relacionados à patogênese, replicação e mecanismos de escape do sistema imune do DENV, além disso, podem ser potencias antígenos em métodos de diagnóstico. / Dengue is an infectious disease with high morbidity and mortality rates caused by dengue virus (DENV). According to the World Health Organization, about 50 to 100 million people are infected annually in more than 100 tropical and subtropical countries from all continents. The clinical spectrum of DENV infection can includes asymptomatic or symptomatic forms ranging from undetermined and self-limited fever, through dengue fever (DF) to severe disease called dengue hemorrhagic fever/dengue shock syndrome (DHF/DSS). Recently, there has been a dramatic increase in the number of cases of DHF/DSS in the Americas, and this increase coincided with the introduction of dengue virus type 3 (DENV-3), genotype III. The present study aimed to clone and express NS1 and NS3 proteins of DENV-3. The NS1 and NS3 proteins of DENV-3 was successfully cloned and expressed in a prokaryotic system. Amplification of NS1 and NS3 genes was carried out by RT-PCR, which yielded amplicons of approximately 1050 and 1850 bp, respectively. Then, the genes were cloned by inserting the amplicons into the plasmid vector pCR-XL. NS1 and NS3 genes were subcloned into the expression vector pQE-30 through the restriction sites for BamHI and HindIII enzymes. The protein expression was obtained in a prokaryotic system using the strain BL21 (DE3) of E. coli, resulting in 45 and 70 kDa proteins, which were confirmed by Western blot analysis using immune mouse ascitic fluid and serum of patients with dengue as primary antibody. These viral proteins can be used to study the pathogenesis, mechanisms of replication and immune escape of DENV, moreover, can be potential antigens in diagnostic methods.

O Plasmodium vivax é a espécie causadora de malária de maior distribuição mundial e maior prevalência nas Américas. A complexidade do ciclo de vida do parasito e sua extensa diversidade antigênica têm dificultado a obtenção de uma vacina eficaz e inferem que seja pouco provável que este objetivo seja alcançado utilizando um único antígeno. Neste contexto, a combinação de regiões imunodominantes de antígenos de um ou mais estágios do ciclo de vida do Plasmodium pode ser uma estratégia com melhor prognóstico na indução de resposta imune protetora e duradoura contra a atividade parasitária. Este trabalho avaliou a imunogenicidade, em camundongos, de uma formulação vacinal composta pela mistura dos antígenos CSP, pré-eritrocítico e AMA-1, o qual é expresso em ambos os estágios, préeritrocítico e eritrocítico assexuado. A proteína quimérica yPvCSAllFL, que contém epítopos para células B da região central (repeats) das 3 variantes alélicas PvCSP-VK210, PvCSP-VK247 e PvCSP-P. vivax-like fusionados, e a yPvAMA-1 foram expressas com sucesso em leveduras Pichia pastoris e purificadas por métodos cromatográficos para a imunização de camundongos BALB/c e C57BL/6, na presença do adjuvante Poly(I:C), agonista de TLR3. Por ELISA, foram determinados os títulos de anticorpos, as subclasses de IgG e a avidez destes pelas proteínas indutoras, administradas isoladamente ou em combinação. A resposta de anticorpos anti-yPvCSAllFL mostrou ser linhagem dependente, tendo sido observado altos títulos de anticorpos IgG (106) em C57BL/6, os quais se mantiveram elevados por até 6 meses após a última dose. Os anticorpos anti-yPvCSAllFL, predominantemente IgG1, foram capazes de reconhecer proteínas representando as 3 variantes alélicas. No geral, a coadministração dos antígenos yPvCSAllFL e yPvAMA-1 não comprometeu a resposta de anticorpos individual. Utilizando este protocolo de vacinação não foi possível detectar resposta proliferativa de células TCD3+TCD4+ ou TCD3+TCD8+ específicas após a estimulação com yPvCSAllFL. Os índices de proliferação (8,31%) e o padrão de secreção das citocinas IFN-γ, IL-2, TNF-α e IL-10, associados à yPvAMA-1, sofreram redução com a coadministração de antígenos (6,33%) e alteração, com elevação de IL-2 em detrimento das demais citocinas. Os dados gerados no estudo das formulações vacinais apresentadas neste trabalho podem ser úteis para o desenvolvimento de uma vacina anti-P. vivax, principalmente por explorarem estratégias de combinação e fusão de antígenos. / Plasmodium vivax is the species of malaria more widely distributed worldwide and with higher prevalence in the Americas. The complexity of the parasite life cycle and its extensive antigenic diversity have hampered the achievement of an effective vaccine and infer that it is unlikely that this goal will be achieved using a single antigen. In this context, the combination of immunodominant regions of antigens of one or more stages of the Plasmodium life cycle can be a strategy with better prognosis at inducing protective and durable immune responses against this parasite. Our study assessed the immunogenicity of vaccine formulations consisting of mixture of antigens CSP, pre-erythrocytic and AMA-1, which is expressed in the both stages, pre-erythrocytic and erythrocytic asexual, in mice. The chimeric protein yPvCSAllFL, which contains B-cell epitopes of the central region (repeats) of the 3 allelic variants PvCSP-VK210, PvCSP-VK247 and PvCSP-P. vivax-like fused, and the yPvAMA-1 were successfully expressed in the yeast Pichia pastoris and purified by chromatographic methods for immunization of BALB/c and C57BL/6 mice in the presence of the adjuvant Poly(I:C), a TLR3 agonist. By ELISA, we determined the titles, IgG subclasses and the avidity of the antibodies to these proteins, administered alone or in combination. The immune response to yPvCSAllFL proved to be dependent on mouse strain, having been observed high titers of IgG antibodies (106) in C57BL/6, which remained high for up to 6 months after the last dose. Anti-yPvCSAllFL antibodies, predominantly IgG1, were able to recognize proteins representing the 3 allelic variants. In general, the co-administration of yPvCSAllFL and yPvAMA-1 antigens did not compromise the individual antibodies response. Using this vaccination protocol, we could not detect cell specific proliferative responses of TCD3+TCD4+ or TCD3+TCD8+ after stimulation with yPvCSAllFL. The proliferation (8.31%) and the pattern of secretion of cytokines IFN-γ, IL-2, TNF-α and IL-10, associated with the yPvAMA-1, were reduced during the co-administration (6.33%) and compensated by the elevation of IL-2. The data generated on the study of vaccine formulations presented in this thesis may be useful for the development of a vaccine anti-P. vivax, mainly by exploiting strategies of combination and fusion of antigens.

No experimento 1, avaliou-se os efeitos da leptina exógena na concentração sérica de leptina e na expressão do gene LEP no tecido adiposo de novilhas zebuínas pré-púberes. Amostras de tecido adiposo (mesentérico, perirenal e subcutâneo) e de sangue foram obtidas de 36 novilhas, distribuídas nos tratamentos: A) dieta de alta energia; B) dieta de baixa energia; BL) dieta de baixa energia + 4,8 g/kg PV de oLeptin subcutânea, duas vezes ao dia, por 56 dias. A concentração de leptina foi determinada com kit comercial ELISA (Cusabio) específico. Amostras de sangue de quatro novilhas por grupo foram coletadas em seis pontos no tempo, sendo um antes e um após o tratamento hormonal. Dois dias após a obtenção da puberdade, oito novilhas por grupo foram abatidas para coleta de tecido. A expressão gênica foi quantificada nos depósitos de gordura por PCR em tempo real. A oLeptina aumentou transitoriamente a concentração de leptina do grupo BL, com pico (11,1 ± 1,4 ng/mL) após 7 dias do início do tratamento. A leptina sérica do grupo A aumentou linearmente no tempo, enquanto no grupo B, manteve-se constante (4,0 ± 2,0 ng/mL). A dieta A aumentou a expressão de leptina no tecido adiposo em 2,4 vezes; e a administração de oLeptina diminuiu a expressão do gene LEP em cerca de 2,5 vezes, comparando com o grupo controle. A redução na expressão do gene LEP explica a redução na leptina sérica do grupo BL após 30 dias de tratamento hormonal. O objetivo do experimento 2 foi clonar a região codificadora da leptina bovina, transformar leveduras Pichia pastoris KM71H e expressar a proteína no meio de cultura. O gene da leptina foi amplificado em reação de PCR, a partir de amostra de tecido adiposo subcutâneo de novilha do grupo A. Os primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (senso) e 5\' - ATTGTCGACGCACCCGGGACTGAGGT - 3\' (antisenso), contendo sítios EcoRI e SalI, foram desenhados com base na sequência do mRNA da leptina bovina (NM 173928.2), substituindo a sequência sinal de secreção nativa pela sequência do Fator do Saccharomyces cereviasiae. O inserto foi clonado nos vetores de expressão pPICZαA e pGAPZαA (Invitrogen), sendo as leveduras transformadas por eletroporação. Clones com múltiplas cópias do gene foram selecionados em meio YPD + 500 μg/mL de zeocina, e 22 colônias recombinantes foram selecionadas para análise de expressão em pequena escala. Colônias pPICbLep foram inicialmente cultivadas em meio de crescimento (BMGY), sendo transferidas para meio de indução (BMMY), contendo metanol. A indução durou 144 horas. Alíquotas de 200 μl de sobrenadante foram coletadas diariamente, para análise da presença da bLeptina por SDS-PAGE. As colônias pGAPbLep foram cultivadas em meio YPD por 96 h, com coleta de sobrenadante a cada 24 h. As leveduras foram transformadas com sucesso, com os plasmídeos pPICbLep e pGAPbLep, entretanto, apenas as colônias pGAPbLep expressaram uma proteína de 35 kDa, o dobro do tamanho esperado para a bLeptina (17 kDa), provavelmente por ocorrência de dimerização. Mais estudos são necessários sobre os processos de produção de leptina recombinante bovina em Pichia pastoris. / In experiment 1, the effects of exogenous leptin were evaluated on serum leptin levels and on LEP gene expression in the adipose tissue of prepubertal zebu heifers. Adipose tissue (mesenteric, perirenal and subcutaneous) and blood samples were collected from 36 heifers, distributed among treatments: A) high energy diet; B) low energy diet; BL) low energy diet + 4,8 g/kg BW subcutaneous oLeptin, twice daily, for 56 days. Leptin concentration was determined with specific commercial ELISA kit (Cusabio). Blood from four heifer per group was sampled in six time points, one before and one after the hormonal treatment. Two days after puberty attainment , eight heifers per group were slaughter for tissue sampling. Gene expression was quantified in fat depots by real time PCR. The oLeptin increased transiently leptin concentration in group BL, with a peak (11,1 ± 1,4 ng/mL) after 7 days of treatment. Serum leptin in group A increased linearly in time, while in group B it remained constant (4,0 ± 2,0 ng/mL). Diet A enhanced leptin expression in the adipose tissue 2.4-fold, and oLeptin administration decreased de expression 2.5-fold, comparing to the control group. The decrease in LEP gene expression explains the reduction in serum leptin from group BL after 30 d of hormonal treatment. The objective with experiment 2 was to clone de codifying region of bovine leptin, transform KM71H Pichia pastoris yeasts, and express the protein in culture media. The leptin gene was amplified by PCR, from subcutaneous adipose tissue sample from a heifer in group A. Primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (forward) and 5\' - ATTGTCGACGCACCCGGGACTGAGGT 3 (reverse), containing EcoRI and SalI restriction sites, were designed based in the mRNA sequence from bovine leptin (NM 173928.2), replacing the native secretion signal sequence by the -factor sequence from Saccharomyces cereviasiae. The insert was cloned in the expression vectors pPICZαA and pGAPZαA (Invitrogen), and yeasts were transformed by electroporation. Clones with multiple copies of the gene were selected in YPD + 500 μg/mL zeocina, and 22 recombinant colonies were selected for a small-scale expression analysis. pPICbLep colonies were initially cultivated in growth media (BMGY), and then transferred to the induction media (BMMY), containing methanol. The colonies were inducted for 144 h. Supernatant aliquots (200 μl) were collected daily, for bLeptin analysis in SDS-PAGE. pGAPbLep colonies were cultivated in YPD media for 96 h, collecting supernatant samples each 24 h. Yeasts were successfully transformed with the plasmids pPICbLep and pGAPbLep, however, only pGAPbLep colonies expressed a protein with 35 kDa, twice the size expected for the bovine leptin (17 kDa), probably because of dimerization. More studies are necessary about the recombinant bovine leptin production processes in Pichia pastoris.