Las proteínas pequeñas de choque térmico (sHSP) responden a una amplia variedad de estreses ambientales, estabilizando proteínas parcialmente desplegadas y evitando su agregación irreversible, en forma independiente de ATP. En plantas, las sHSPs son especialmente diversas siendo las sHSPs de organelas una característica única de las plantas. La estructura primaria de las sHSP incluye una secuencia N-terminal no conservada de longitud variable, un dominio α-cristalino conservado (ACD) y una secuencia C-terminal corta no conservada. El dominio ACD representa una característica conservada presente en todas las sHSPs, sin embargo, no todas las proteínas que contienen un dominio ACD son sHSP. Las sHSPs pertenecen a una gran superfamilia, siendo su importancia funcional y fisiológica en gran parte desconocida. El objetivo de este trabajo fue dilucidar el rol de sHSPs de localización mitocondrial (sHSPs-M) en Arabidopsis thaliana y Solanum lycopersicum en situaciones de estrés ambiental, y caracterizar probables promotores bidireccionales que regulan la expresión de genes codificantes de proteínas con dominio ACD con orientación cabeza a cabeza en el genoma de Arabidopsis. Este trabajo cubre aspectos desde la organización genómica y la función de sHSPs-M en Arabidopsis hasta el rol de las sHSPs-M en la respuesta al estrés por frío de frutos de tomate. Para ello, se generaron plantas mutantes de Arabidopsis y de tomate utilizando la tecnología de silenciamiento génico por micro ARNs artificiales. Las plantas mutantes fueron analizadas en su proteoma, metaboloma y lipidoma en distintas condiciones de estrés. A continuación, se presenta un resumen de los resultados obtenidos. En la primera parte de este trabajo, se realizó la caracterización funcional de genes con orientación cabeza a cabeza en el genoma de Arabidopsis, que codifican para proteínas con ACD y las regiones intergénicas correspondientes. Se lograron identificar y caracterizar cuatro distintos promotores bidireccionales, entre ellos el promotor del gen At5g51440 que codifica una sHSP de localización mitocondrial (sHSP23.5). Los resultados obtenidos sugieren que el promotor bidireccional contenido en el par At5g51430-At5g51440 es fuertemente inducido por altas temperaturas en una dirección, pero no así en la dirección opuesta. El promotor contenido en el par At1g06460-At1g06470 mostró una actividad alta en ambas direcciones, teniendo por ello, un alto potencial de aplicación en ingeniería genética. Los dos promotores restantes mostraron mayor actividad en una dirección y, por lo tanto, pueden ser considerados como promotores bidireccionales asimétricos. El estudio funcional de los promotores seleccionados reveló el potencial biotecnológico de los mismos ya que pueden ser inducidos específicamente en una determinada condición (como altas temperaturas) en una o en ambas direcciones cuando sea necesario. En la segunda parte, se presenta la caracterización funcional de sHSP mitocondriales en condiciones de estrés y durante el desarrollo de Arabidopsis. Se identificaron tres genes parálogos en el genoma de Arabidopsis (At5g51440, At4g25200, y At1g52560), y se diseñaron microARN artificiales específicos para la obtención de plantas mutantes por silenciamiento (amiR simple, doble y triple). Las plantas amiR simples y dobles (para sHSP23.5 y sHSP23.6) no mostraron un fenotipo evidentemente afectado, probablemente debido a la compensación o redundancia funcional de las sHSP mitocondriales. Por otro lado, las plantas triple mutante amiR23.5/23.6/26.5 muestran un fenotipo alterado en las etapas vegetativa y reproductiva. Estas plantas presentan hojas pequeñas, células epidérmicas con áreas reducidas, pero no reducción en el número de células epidérmicas por hoja. Además, exhiben hojas cloróticas, raíces cortas y menor producción de semillas en comparación con las plantas Col-0. Las plantas triple amiR son considerablemente pequeñas debido a una alteración en el proceso de expansión celular, pero no en la proliferación celular, lo que indica una profunda alteración en el programa de desarrollo de la planta. En el análisis proteómico de las mutantes amiR se observó un aumento significativo de proteínas implicadas en el metabolismo, y alteración en la abundancia de varias proteínas relacionadas con la traducción, y con el funcionamiento y la estructura de los ribosomas. La triple mutante exhibió un mayor número de proteínas con abundancia alterada involucradas en estos procesos en comparación con las mutantes simples y doble amiR23.5/23.6. Estos cambios tan amplios observados en proteínas relacionadas con el funcionamiento de los ribosomas sugieren una posible alteración en la función normal de los mismos. Los resultados presentados en este trabajo proporcionan evidencias sobre el importante rol de las sHSPs-M no sólo en la respuesta a las altas temperaturas, sino también durante el desarrollo de la planta de Arabidopsis. Los resultados indican que una compensación funcional podría ser responsable del fenotipo observado en las plantas mutantes con niveles reducidos de cada sHSPs-M individual. Sin embargo, la reducción simultanea de las tres sHSPs-M causó una profunda alteración en la función normal de mitocondrias y ribosomas, afectando gravemente el metabolismo energético y la homeostasis celular, lo que llevó a alteraciones en el desarrollo correcto de la planta. En la última parte de este trabajo, las consecuencias de la disminución de la proteína sHSP23.8 de localización mitocondrial en frutos de tomate fueron investigadas. Los frutos fueron analizados en su fenotipo y en la susceptibilidad al daño por frío. Los frutos de las plantas mutantes amiR23.8 que fueron conservados en frío mostraron mayor pérdida de agua y de electrolitos en el tejido pericárpico en comparación con frutos WT. El deterioro observado en los frutos amiR23.8 indica que estos frutos mutantes son mayormente susceptibles al estrés por frío desarrollando síntomas de daño por frío. El lipidoma de los frutos amiR23.8 frigoconservados mostró cantidades alteradas de glicerolípidos, y los niveles de lípidos saturados en amiR23.8 disminuyeron luego del tratamiento con frío, pero no por debajo de los niveles encontrados en frutos WT en condiciones normales. Lo opuesto se encontró en el porcentaje relativo de lípidos insaturados, con niveles significativamente más bajos de insaturaciones en frutos amiR23.8 en condiciones normales y después del enfriamiento. Los resultados presentados indican una degradación diferencial de lípidos extraplastídicos y plastídicos en frutos amiR23.8, y alteraciones en la remodelación del lipidoma luego del estrés por frío, lo que podría conducir a una mayor sensibilidad al daño por frío. Los resultados discutidos aquí indican que la proteína sHSP23.8 podría estar directamente involucrada en los mecanismos de protección contra el estrés por frío en frutos de tomate.

A Mata Atlântica (MA) é um dos ambientes naturais mais ameaçados do Brasil, tendo sua área original atualmente bastante reduzida pelas ações antrópicas. As atividades agrícolas estão incluídas entre os fatores de impacto a este Bioma; e inserida na área de domínio da MA está a região de Apiaí - SP, produtora de tomate (Solanum lycopersicum L.) de mesa, uma cultura caracterizada pela sua importância alimentar, e responsável por significativos impactos socioambientais devido ao uso de agroquímicos, desmatamentos e más condições de trabalho. Devido à infestação por insetos-praga e às ocorrências de doenças agrícolas, esta cultura é considerada uma das mais exigentes em tratos culturais necessitando pulverizações constantes e uso geral de agroquímicos. Este trabalho busca ampliar o conhecimento sobre as funções que a biodiversidade florestal pode ter como um instrumento para auxiliar o manejo agrícola de insetos fitófagos e doenças em cultivos de tomate de mesa. No município de Apiai - SP, entre 2008 e 2010, foram instalados 5 módulos experimentais de cultivo de tomate em manejo agroecológico no modelo de Ilhas de Alta Produtividade (IAPs), em locais onde a biodiversidade florestal é um elemento presente no entorno. Em cada módulo de cultivo, foram analisados: a biodiversidade florestal no entorno até uma distância de 300 m nos sentidos N, S, L, O; a ocorrência de insetos-praga e doenças agrícolas e a viabilidade econômica e socioambiental. Os resultados foram comparados aos mesmos dados coletados de outros 5 cultivos convencionais da mesma região ecológica, que cultivaram variedades semelhantes, no mesmo período, em ambientes com menor biodiversidade florestal nativa em seu entorno. Os módulos experimentais de cultivo agroecológico demonstraram uma área media de cobertura Florestal Atlântica em torno de 43,82%%, com uma ocorrência media de 46 espécies arbóreas nativas com Índice de Biodiversidade Florestal de 3,87; os cultivos comparativos apresentaram áreas médias de cobertura florestal em seu entorno de 31,34 %, com uma ocorrência de 26 espécies arbóreas nativas e índice de biodiversidade florestal de 3,44. Em amostras de 20 plantas de tomate por cultivo, nas áreas experimentais, não foram identificadas a ocorrência de viroses, uma única espécies causadora de doença fúngica e um total de 4 espécies de insetos-praga foram identificadas. Os produtores convencionais comparados tiveram a ocorrência de 11 espécies de doenças fúngicas e bacterianas, com 7% de ocorrência de viroses e 7 espécies de insetos fitófagos. Os dados mostraram que existe relação da biodiversidade florestal com o número de espécies de insetos-praga nos cultivos. Em uma análise de viabilidade socioambiental entre os cultivos experimentais e comparativos, foi identificada uma maior taxa de risco, investimento, produtividade, volume de produção, e prejuízos financeiros, bem como maiores impactos ambientais e sociais entre os cultivos de tomate convencionais comparativos. Os modelos experimentais com biodiversidade florestal em seu entorno se mostraram viáveis social e ambientalmente para utilização prática na agricultura familiar na região de Apiai - SP. / The neotropical Atlantic Rain Forest (MA) is one of the most threatened natural environments of Brazil, with its original area now greatly reduced by human actions. Agricultural activities are included among the impact factors in this biome, and inserted in the area with the MA is the region of Apiaí - SP producer of tomato (Solanum lycopersicum L.) table, a culture characterized by its nutritional importance and also responsible for significant environmental impacts due to the use of agrochemicals, deforestation and poor working conditions. Due to infestation by insect pests and plant diseases this crop is considered one of the most demanding in cultivation requirements such as constant spraying and general use of agrochemicals. This work seeks to expand the knowledge about the functions that forest biodiversity can perform as a tool to assist the cultivation control in the control of phytophagous insects and diseases in tomato crop. In the district of Apiaí - SP, from 2008 to 2010, five modules have been installed for experimental cultivation of tomato in the agroecologic model called Islands of High Productivity (IAPs), in places where forest biodiversity is an element current around. The biodiversity in the surrounding forest to a distance of 300 m in the directions N, S, E, W, the occurrence of insect pests and diseases and also the economic viability and environmental impact were analyzed in each module of cultivation. The results were compared to the same data collected from five other conventional crops in the same ecological region which cultivated similar varieties in the same period in environments with less native forest biodiversity in their environment. The experimental agroecologic modules showed an average area of Atlantic Forest cover around 43.82%, with an average occurrence of 46 native tree species and forest biodiversity indices of 3.87; the conventional modules had 31.34% of atlantic forest cover, with an occurrence of 26 native tree species and forest biodiversity indices of 3.44. In the experimental areas, with sampling of 20 tomato plants/ cultivation, were not identified any occurrence of viruses but only a single species causing fungal disease and a total of four species of insect pests. The conventional producers had the occurrence of 11 species of fungal and bacterial diseases, with 7% occurrence of viruses and 7 species of phytophagous insects. The data showed that there are relationship of forest biodiversity and number of species of insect pests in crops. In analysis of economic and socio-environmental viabilities between the experimental and comparative cultivations, it was identified a higher rate of risk, investment, productivity, production volume and financial losses, as well as higher environmental and social impacts of the conventional tomato cultivations. The agroecologic experimental models with higher forest biodiversity around have proved being socially and environmentally viable for practical use in family farming in the region of Apiai - SP.

Submitted by (lucia.rodrigues@ufrpe.br) on 2017-02-17T13:39:56Z No. of bitstreams: 1 Camila Cristina Lage de Andrade.pdf: 845467 bytes, checksum: ef8d7e269cd9b79e14fc8dbcd17e8edd (MD5) / Made available in DSpace on 2017-02-17T13:39:56Z (GMT). No. of bitstreams: 1 Camila Cristina Lage de Andrade.pdf: 845467 bytes, checksum: ef8d7e269cd9b79e14fc8dbcd17e8edd (MD5) Previous issue date: 2012-02-16 / Conselho Nacional de Pesquisa e Desenvolvimento Científico e Tecnológico - CNPq / The bacterial speck caused by Pseudomonas syringae pv. tomato (Pst) (Okabe) Young, Dye & Wilkie has economic relevance to the tomato for industry in Brazil. The use of products that potentiate and/or induce plant defenses is an alternative that meets the requirements of integrated disease management. This study aimed to evaluate the effect of silicon (Si) and chemical inducers in some components of tomato resistance to bacterial speck and activity of enzymes involved in plant defense. In the first study, tomato plants were grown in: soil without calcium silicate (control) (T1), soil without calcium silicate and plants sprayed with Supa Silica® (SS) (2 mL/L SS) (T2) and soil with calcium silicate (0.38 g) (T3), being inoculated by spraying with a suspension of the pathogen. Our research evaluated the incubation period (IP), number of lesions (NL) per plant, severity estimated by the software QUANT 1.0 (SEQ) and leaf concentration of Si, as well as the activity of enzymes peroxidases (POX), polyphenoloxidases (PPO) β-1,3-glucanases (GLU), phenylalanine ammonia lyases (PAL), lipoxygenases (LOX) and concentration of malondialdehyde (MDA). It was assessed the effect of SS in the Pst growth in vitro. There was no significant difference between treatments for the IP and the foliar concentration of Si. No significant differences were found for the NL per plant and SEQ between T3 and control. T2 significantly reduced NL in 46.8 and 45.1% and SEQ in 61.5 and 56.2% when compared with control and T3, respectively. There was negative linear response of SS doses on the Pst growth in vitro. The activity of POX, PPO and GLU was significantly higher in T2 and T3. The activity of FAL and LOX was significantly higher in T3. The MDA concentration was significantly higher in T2 compared to control, in non-inoculated plants and at 7 days after inoculation (d.a.i.), being significantly lower at 10 d.a.i. In the second study, three experiments were conducted to evaluate the effect of jasmonic acid (JA; 0.1 mM), ethephon (ET, 0.5 mM) and acibenzolar-S-methyl (Bion®, ASM; 300 mg/L) sprayed 48 h before inoculation with Pst, evaluating the IP and NL per plant, and the activity of enzymes POX, PPO, GLU and LOX. It was also assessed the effect of JA and ET in the growth of Pst in vitro. Only in experiment 3 incubation period increased significantly by one day in the plants sprayed with ASM compared with control. In all experiments, NL per plant was significantly reduced by JA, ET e ASM in relation to the control reaching values of 38.9, 45.3 and 68.1%, respectively, in experiment 2. The growth of Pst in vitro was not significantly influenced. In some evaluation times JA has significantly raised the activity of POX, PPO and GLU; ASM has elevated the activity of PPO, GLU and LOX, while ET only significantly raised the activity of GLU and LOX compared to the control. The results of these studies suggest that spraying tomato plants with SS and the inducers JA, ET and ASM affected some components of tomato resistance to bacterial speck, and activated the enzymes POX, PPO, GLU, PAL and LOX, involved in defense responses of tomato plants to Pst. / A pinta bacteriana causada por Pseudomonas syringae pv. tomato (Pst) (Okabe) Young, Dye & Wilkie tem importância econômica para a cultura do tomateiro industrial no Brasil. O uso de agentes potencializadores e/ou indutores das defesas das plantas é uma alternativa que atende aos requisitos do manejo integrado de doenças. Este estudo avaliou o efeito do silício (Si) e de indutores químicos em alguns componentes de resistência do tomateiro à pinta bacteriana e na atividade de enzimas envolvidas na defesa das plantas. No primeiro estudo plantas de tomateiro foram cultivadas em: solo sem silicato de cálcio (controle) (T1), solo sem silicato de cálcio e plantas pulverizadas com Supa Sílica® (SS) (2 mL/L de SS) (T2) e solo com silicato de cálcio (0,38 g) (T3), sendo inoculadas por pulverização com suspensão do patógeno. Foram avaliados o período de incubação (PI), número de lesões (NL) por planta, severidade estimada pelo software QUANT 1.0 (SEQ) e concentração foliar de Si, bem como a atividade das enzimas peroxidases (POX), polifenoloxidases (PFO), β-1,3-glucanases (GLU), fenilalanina amônia-liases (FAL), lipoxigenases (LOX) e concentração de aldeído malônico (MDA). Também foi avaliado o efeito do SS no crescimento de Pst in vitro. Não houve diferença significativa entre os tratamentos para o PI e para a concentração foliar de Si. Não houve diferença significativa para o NL por planta e a SEQ entre o tratamento T3 e o controle. O tratamento T2 reduziu significativamente o NL 46,8 e 45,1% e a SEQ 61,5 e 56,2%, em relação ao controle e ao tratamento T3, respectivamente. Houve resposta linear negativa das doses de SS no crescimento da Pst in vitro. A atividade das POX, PFO e GLU foi significativamente maior nos tratamentos T2 e T3. A atividade das FAL e das LOX foi significativamente maior no T3. A concentração de MDA foi significativamente maior no tratamento T2 em relação ao controle, nas plantas não inoculadas com Pst e aos 7 dias após inoculação (d.a.i.); sendo significativamente menor aos 10 d.a.i. No segundo estudo, três experimentos foram realizados para avaliar o efeito dos indutores ácido jasmônico (AJ; 0,1 mM), ethephon (ET; 0,5 mM) e acibenzolar-S-metil (Bion®, ASM; 300 mg/L) pulverizados 48 h antes da inoculação da Pst, avaliando-se o PI e o NL por planta, além da atividade das enzimas POX, PFO, GLU e LOX. Também foi avaliado o efeito do AJ e do ET no crescimento da Pst in vitro. Apenas no experimento 3 o PI aumentou significativamente em 1 dia nas plantas pulverizadas com ASM em relação ao controle. O NL por planta foi significativamente reduzido pelos tratamentos AJ, ET e ASM em relação ao controle para todos os experimentos, atingindo valores de 38,9, 45,3 e 68,1%, respectivamente, no experimento 2. O crescimento da Pst in vitro não foi influenciado significativamente pelo AJ ou ET. Em determinadas épocas de avaliação, o AJ elevou significativamente a atividade das POX, PFO e GLU; ASM elevou a atividade das PFO, GLU e LOX e o ET elevou a atividade das GLU e LOX em relação ao controle. Os resultados desses estudos evidenciam que a pulverização com SS e com indutores AJ, ET e ASM afetaram alguns dos componentes de resistência do tomateiro à pinta bacteriana, além de potencializar as enzimas POX, PFO, GLU, FAL e LOX, relacionadas com a defesa das plantas em resposta à Pst.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

The work in this thesis aimed to demonstrate the contribution of arbuscular mycorrhizal (AM) fungi to the yield and fruit quality of field-grown processing tomatoes, and the potential to increase the sustainability of tomato production through greater fertiliser use efficiency by inoculating tomato seedlings with beneficial AM fungi. Previously, the conclusion that tomato growth is unresponsive to AM colonisation, particularly in high-P soils, has often been based on only a part of the tomato life-cycle. However, there is increasing evidence that that positive AM yield responses can occur in soils with relatively high plant-available P, and that AM responsiveness of tomato during vegetative growth may be a poor predictor of reproductive growth. A preceding industry study found that AM colonisation of field-grown processing tomatoes was very low, mostly less than 5%. The reason for the low colonisation was unclear since previous studies have shown that tomato can become relatively highly colonised by AM fungi. It was not known if farm practices, such as soil cultivation and chemical sterilisation, which have been shown to decrease AM colonisation of tomato and other crops, could have contributed to the low colonisation. Furthermore, it was unclear what contribution AM fungi were making to the yield and fruit quality of tomato in commercial production, and what their potential contribution might be if greater AM colonisation could be achieved through inoculating seedlings. Yield and fruit quality are important to tomato growers as both are used to calculate payment when the fruits are sold. Large amounts of soluble fertilisers, particularly P, are applied during tomato production with the aim of increasing yield and quality. However, fertiliser use efficiency, particularly P, on tomato farms has been identified as being low, and needing to be improved in order to increase the economic and environmental sustainability of tomato farming. Increasing P, and also other nutrients, such as Zn and Ca, in tomatoes could also help to improve agricultural sustainability by alleviating human malnutrition in developing countries and, in the case of Ca, have the potential to reduce blossom end rot, which can severely reduce marketable yield. There is considerable potential for AM fungi to assist in the supply of these nutrients to field-grown tomatoes. AM fungi are widely accepted to increase plant uptake of P. This has mostly been demonstrated in low-P soils, as increases in plant-available P are generally known to be detrimental to AM colonisation and any subsequent growth effects. However, there is increasing evidence of the ability of AM fungi to increase P uptake and yield even in high P soils. There is also good evidence of increased Zn uptake by mycorrhizal supply to plants. Evidence for increased Ca uptake in mycorrhizal plants is in comparison limited and conflicting, but has been demonstrated in some cases. It is possible that AM fungi could allow applications of these nutrients, particularly P, to be reduced while maintaining or increasing fruit yield and quality. However, the ability of indigenous or inoculated AM fungi to do so in the relatively high-P farm soils used in this project was unknown. In order to address these uncertainties a series of pot studies and a field experiment were conducted using field soils from tomato farms and an adjacent nature reserve for comparison. Data on soil characteristics from five farms, collected during the previous industry study, was analysed in conjunction with data from another farm located nearby with contrasting soil properties. Two farm soils and an unfarmed comparison were selected on the basis of their having contrasting levels of P, Zn and Ca, and pH, with the constraint that they were located within 50 km of each other to minimise travel time in the study area. The two farmed soils had a relatively high concentration of plant-available P (103 and 58 mg/kg Colwell), while plant-available P in the unfarmed soil was probably marginal to that required for healthy tomato growth (27 mg/kg Colwell). Samples of the soils were taken soon after commencement of the work and used in pot studies. Firstly, a bioassay was conducted to establish the ability of tomato to become colonised in the three field soils. AM colonisation of tomato and medic, which is known to be highly susceptible to AM colonisation, was compared between three harvests over an approx. 16 week period. Vegetative growth was also measured. The total colonisation of tomato mostly did not differ from that of medic at each harvest in any soil. Furthermore, despite the large differences in plant-available P between the three soils, colonisation and vegetative growth of tomato did not differ between soils at any harvest. In a subsequent pot experiment, the effect of colonisation by AM fungi in the three field soils on the vegetative and reproductive growth, and nutrient status of tomato was determined using the tomato mutant rmc (reduced mycorrhizal colonisation) and its progenitor 76R. A number of non-destructive vegetative and reproductive growth measurements were repeatedly measured over an approx. 24 week period. Destructive measurements were carried out at two harvests, 39 and 164 days after planting. Tomato 76R was again well colonised in all soils. Tomato rmc remained uncolonised, and was therefore an effective non-mycorrhizal control. AM colonisation had little effect on plant growth or nutrient status in any soil at the first harvest, but significant growth and nutrient responses were recorded at the second harvest. In particular, AM colonisation markedly increased vegetative growth in the unfarmed soil. AM colonisation did not affect vegetative growth in either of the farmed soils. However, AM colonisation increased reproductive growth, particularly yield over time, in all soils. AM colonisation increased shoot P concentration and content, but effects on Zn were mixed and largely inconclusive. Shoot Ca concentration and content were mostly reduced by AM colonisation. Similar patterns were observed in fruit nutrient status. The potential of pre-inoculation with AM fungi to increase AM colonisation and/or AM growth and nutrient effects in the field was considered. A commercial AM fungal inoculum was initially proposed for use, but was found to be unreliable and laboratory cultures of Scutellospora calospora and Glomus mosseae were used instead. Tomato seedlings were inoculated by amending a commercial seed-raising medium with an equal mixture of S. calospora and G. mosseae inocula. Seeds of tomato rmc, 76R and the commercial processing tomato cultivar U941 were sown and raised according to the practices followed by a commercial seedling nursery. After 9 weeks a sub-sample of inoculated seedlings of 76R and U941 had become colonised by both AM fungi, although the total colonisation was relatively low (approx. 10%). There was no difference in the shoot or root dry weights between inoculated and non-inoculated seedlings. The remaining seedlings were then used in the field experiment. Seedlings were transplanted amongst a commercial processing tomato crop on two farms and grown to maturity. A substitute farm with soil of moderate P (66 mg/kg Colwell) was used as tomatoes were no longer being grown on the initial farm with moderate P. Two P treatments, ‘normal’ and ‘reduced’ P fertilisation, were imposed in order to investigate the effect of P fertilisation on colonisation by indigenous and inoculated AM fungi, and growth and nutrient status of tomato in the field. Non-destructive growth measurements and soil core samples to assess mycorrhizal colonisation were taken mid-season (approx. 10 weeks after transplanting). Destructive growth measurements and core samples to assess colonisation were taken at harvest (approx. 19 weeks after transplanting). Colonisation of rmc was insubstantial and it again served as an effective non-mycorrhizal control to 76R. Colonisation was insubstantial in all treatments on the farm where soil had moderate plant-available P. On the other farm, where soil had relatively high plant-available P, colonisation of all plants was low mid-season, but was mostly substantial (>20%) in 76R and U941 at harvest. Low colonisation on both farms was probably the result of farming practices, particularly soil cultivation. However, a combination of inoculation and reduced P fertilisation increased colonisation. Colonisation by indigenous AM fungi had no effect on the growth or nutrient status of field grown tomatoes. In contrast, pre-inoculation with AM fungi increased fruit yield by a mean of approx. 40% in 76R and U941. This was the result of an 18% increase in the fresh weight of individual fruits and, when inoculation was combined with reduced P fertilisation, a 21% increase in the number of fruits on each plant. The increase in the number of fruits on each plant was associated with an increase in the number of flowers at the most advanced growth stage. Inoculation also increased vegetative growth, and fruit P, Zn and Ca contents. A small (4%) decrease in fruit brix was more than offset by increased yield. This study has shown that while AM fungi indigenous to tomato farm soils have the ability to substantially colonise tomato, they appear to have little effect on tomato growth, yield or nutrition in the field. In contrast, inoculation of tomato seedlings with mutualistic AM fungi during nursery production can substantially increase the growth, yield and fruit nutrient contents of field-grown tomatoes under commercial conditions. This increase could also be enhanced by a reduction in P fertilisation. Increased yield and fruit nutrient contents, and decreased P fertilisation neatly address the aims of increased agricultural sustainability. Incorporating pre-inoculation of tomato into existing farming practices has a potential to increase the productivity and sustainability of processing tomato production worldwide. / http://proxy.library.adelaide.edu.au/login?url= http://library.adelaide.edu.au/cgi-bin/Pwebrecon.cgi?BBID=1292847 / Thesis (Ph.D.) -- University of Adelaide, School of Earth and Environmental Sciences, 2007

Le poids et la teneur en sucres du fruit sont deux caractères complexes, importants pour la qualité de la tomate. L'objectif de cette thèse est de disséquer ces deux caractères par une démarche pluridisciplinaire, impliquant des approches écophysiologiques, génétiques et moléculaires. Une population de 20 lignées d'introgression de Solanum chmielewskii dans le fonds génétique de S. lycopersicum a été cultivée en 2006 et en 2007 sous deux conditions de charges en fruits afin de moduler sa disponibilité en carbone : une forte charge où tous les fruits sont conservés sur les bouquets, et une faible charge constituée par un unique fruit par bouquet. Des indicateurs de processus écophysiologiques impliqués dans le poids et la teneur en sucres du fruit ont été mesurés ou estimés. Ils ont permis de caractériser les principaux processus écophysiologiques sous-jacents aux QTL de qualité, notamment la division et l'expansion cellulaire, la transpiration du fruit, et l'allocation carbonée pour la synthèse de composés structuraux. Un fort effet de la charge en fruits a été mis en évidence sur l'expression des QTL pour la plupart des caractères observés, indiquant l'occurrence d'interactions génotype x charge en fruits. L'utilisation d'un modèle écophysiologique prédisant la teneur en sucres d'un fruit de tomate à maturité, combiné à une détection de QTL, a permis d'identifier des colocalisations entre QTL de qualité et QTL de variables de fonctionnement du fruit telles que la fourniture du fruit en assimilats, la transformation métabolique des sucres en d'autres composés, ou la dilution des composés par l'entrée d'eau dans le fruit. Enfin, une lignée d'introgression portant des QTL de poids frais et de sucres avec des allèles aux effets opposés ainsi que la lignée conférant le fonds génétique ont été étudiées au niveau moléculaire par une analyse du transcriptome en phase d'expansion cellulaire. Des gènes candidats dont le niveau d'expression serait associé aux variations de poids et de teneurs en sucres du fruit, engendrées par une modification de la charge en fruits ont été identifiés. L'analyse en cinétique de l'expression de quelques gènes candidats a permis de mettre en évidence des liens entre variables écophysiologiques et moléculaires.

In tomato (Solanum lycopersicum), race-specific resistance against the fungal wilt pathogen Verticillium dahliae race 1 (Vd1) is established in the stem. However, the molecular factors and mechanisms leading to this resistance response are still unknown. In this study, Craigella resistant (CR) and susceptible (CS) tomato plants were successfully infected with Vd1 and this was verified by fungal quantification and symptom score assays. Previous microarray results showed interesting patterns of defence gene expression that correlated with biological phenomena. Plant defence genes code for proteins that are responsible for or associated with the plant resistance response. Through RT-PCR, this thesis set out to confirm these microarray observations and also to generate expression data for genes in which sensitivity was an issue in the microarray. The standard RT-PCR data confirmed a number of the microarray results, but some conflicts remained. From the defence genes investigated, there was agreement between the microarray data and the RT-PCR data for pre-mRNA processing factor 8, class IV chitinase, cyclin-dependent kinase inhibitor and IMP dehydrogenase/GMP reductase. Partial agreement was observed for genes coding for ethylene response factor 2, phenylalanine ammonia lyase and P6 protein. However, there was total disagreement for 14-3-3, beta-glucanase, P1a, RNA-binding protein, calcium-binding protein and S-Adenosyl-L-methionine: hydroxide adenosyltransferase. Real-time RT-PCR was attempted to clarify the remaining issues but further discrepancies arose, particularly in the Ve resistance genes. To resolve these discrepancies, two approaches were designed: (1) one based on the use of a universal internal control and (2) another based on restriction enzyme digestion. In general, the results were more consistent with standard RT-PCR. Overall, this study showed that standardization of a system involving vascular pathogens, leading to reproducible analysis, was possible but only with proper controls and additional validation. Standard RT-PCR appeared to offer a more accurate picture of the expression of defence genes in the tomato-Verticillium pathosystem. The defence gene expression results confirmed in this study remain as potential insights into the molecular mechanisms for Verticillium resistance in tomato plants.

Submitted by Ronildo Prado (ronisp@ufscar.br) on 2017-08-16T20:20:29Z No. of bitstreams: 1 DissTGM.pdf: 2889804 bytes, checksum: c55eea68163f4e92468140f7d3ced089 (MD5) / Approved for entry into archive by Ronildo Prado (ronisp@ufscar.br) on 2017-08-16T20:20:36Z (GMT) No. of bitstreams: 1 DissTGM.pdf: 2889804 bytes, checksum: c55eea68163f4e92468140f7d3ced089 (MD5) / Approved for entry into archive by Ronildo Prado (ronisp@ufscar.br) on 2017-08-16T20:20:43Z (GMT) No. of bitstreams: 1 DissTGM.pdf: 2889804 bytes, checksum: c55eea68163f4e92468140f7d3ced089 (MD5) / Made available in DSpace on 2017-08-16T20:20:49Z (GMT). No. of bitstreams: 1 DissTGM.pdf: 2889804 bytes, checksum: c55eea68163f4e92468140f7d3ced089 (MD5) Previous issue date: 2017-04-17 / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) / The tomato is a demanding crop in regards to water and is among the most consumed vegetables in Brazil. The search for alternatives to improve tomato productivity, as well as reduce the water use in the crop cycle, is essential for agricultural production and environment. The objectives of this work were to evaluate the contribution of subsurface drip irrigation to yield and fruit quality of Grape tomatoes and to estimate the water use efficiency (EUA). The experiment was carried out in the CCA / UFSCar and consisted of three treatments with four randomized blocks. Irrigation management considered the storage soil water capacity (CAD), the soil moisture being high according to the water content reference of the treatment, 0.33 (T1), 0.29 (T2) and 0.25 m3 m-3 (T3), corresponding to 100 % replacement of CAD, and deficit irrigations of 75 and 50 % of CAD, respectively. Water content was monitored by TDR probes and the roots depth obtained through a root images scanner. The Grape tomatoes were transplanted under drip lines installed at 0.20 m depth. Quantitative and qualitative characteristics of the fruits were evaluated in relation to the proposed treatments, being: fruits number per plant, average fruit mass and productivity, quantitative characteristics and; Diameter, length, soluble solids, fruit pH and dry mass of leaves and stem, qualitative characteristics. The total water applied was 1297 mm in T1, 471 mm in T2 (36 % of water applied in T1) and 234 mm in T3 (18 % of T1). Among the characteristics evaluated, the T2 did not differ from the T1 treatment, except in the diameter and pH. The T3 treatment was equal to T1 only in the fruits number per plant. The average fruit mass was different among all treatments and there was no difference between soluble solids values. The T3 treatment obtained higher EUA, followed by T2 and T1, but did not have higher productivity nor better results in other evaluated attributes. Deficit subsurface irrigation of 75 % of CAD did not interfere in Grape tomato productivity and fruit quality, being the most recommended because of qualitative and quantitative attributes similar to full irrigation and to increase the EUA. It is concluded that deficit subsurface irrigation had productivity and fruit quality of Grape tomatoes like full irrigation when used 75 % of CAD, increased the water use efficiency and contributed with water use reduction in crop cycle. / O tomateiro é uma cultura exigente em água e está entre as hortaliças mais consumidas no Brasil. A busca por alternativas que melhorem sua produtividade, bem como reduzam o uso da água no ciclo da cultura, é essencial para a produção agrícola e para o meio ambiente. Este trabalho teve o objetivo avaliar a contribuição da irrigação subsuperficial deficitária na produtividade e qualidade dos frutos de tomateiros Grape e estimar a eficiência no uso da água (EUA). O experimento foi realizado no CCA/UFSCar e consistiu de três tratamentos com doze parcelas em blocos casualizados. O manejo da irrigação levou em consideração a capacidade de água disponível no solo (CAD), sendo a umidade do solo elevada de acordo com a umidade de referência do tratamento, 0,33 (T1), 0,29 (T2) e 0,25 m3 m-3 (T3), correspondendo à reposição de 100 % da CAD, e irrigações deficitárias de 75 e 50 % da CAD, respectivamente. A umidade do solo foi monitorada por sondas TDR e o crescimento das raízes por imagens obtidas através de scanner de raízes. As mudas de tomateiro Grape foram transplantadas sob linhas de gotejamento instaladas a 0,20 m de profundidade. Foram avaliados atributos quantitativos e qualitativos dos frutos em relação aos tratamentos propostos, sendo eles: número de frutos por planta, massa média dos frutos e produtividade como atributos quantitativos; diâmetro, comprimento, sólidos solúveis, pH dos frutos e massa seca das folhas e caule como atributos qualitativos. A lâmina total de água aplicada foi 1297 mm em T1, 471 mm em T2 (36 % da lâmina aplicada em T1) e 234 mm em T3 (18 % de T1). Entre os atributos avaliados, o diâmetro e pH dos frutos do tratamento T2 diferiram do T1. Já o tratamento T3 foi igual ao T1 apenas no número de frutos por planta. A massa média dos frutos foi diferente entre todos os tratamentos e não houve diferença no valor de sólidos solúveis. O tratamento T3 obteve maior EUA, seguido por T2 e T1, porém não teve maior produtividade e nem melhores resultados em outros atributos avaliados. A irrigação subsuperficial deficitária de 75 % da CAD não interferiu na produtividade do tomateiro Grape e na qualidade dos frutos, sendo a mais recomendada por apresentar atributos qualitativos e quantitativos similares à irrigação plena e aumentar a EUA. Conclui-se com este trabalho que irrigação subsuperficial deficitária teve produtividade e qualidade de frutos de tomateiro Grape semelhante à irrigação plena quando utilizado 75 % da CAD, aumentou a eficiência no uso da água e contribuiu com a redução no uso da água no ciclo da cultura.

Hormesis is a dose response phenomenon where low doses of a stress bring about a positive response in the organism undergoing treatment. UV-C hormesis has been known for over three decades and has a broad range of benefits on postharvest produce. Benefits include increased nutritional content, delayed chlorophyll degradation and disease resistance. The beneficial effects have been observed on many varieties of fresh produce including climacteric and non-climacteric fruit, tubers, salads and brassicas. The majority of previous studies have used low-intensity (LIUV) UV-C sources. LIUV sources require lengthy treatment times, which are in the region of 6 minutes for tomato fruit. This has, in part, prevented the commercial application of this technique. High-intensity, pulsed polychromatic light (HIPPL) sources, however, have recently been developed. HIPPL sources may have the potential to drastically reduce treatment times and increase their commercial viability. It was shown, here, that the use of HIPPL can control disease (reduce disease progression) caused by Botrytis cinerea and Penicillium expansum and also delay ripening on tomato fruit. Both disease control and delayed ripening were at similar levels for LIUV and HIPPL treatments on mature green fruit. The HIPPL treatments used in these studies can reduce treatment times for tomato fruit by 97.3%. Both HIPPL and LIUV treatments elicit local responses irrespective of the treatment orientation and tomato fruit, therefore, require full surface irradiation. Furthermore, UV-C in the HIPPL source is not required for disease control or delayed ripening. It does, however, contribute approximately 50% towards the total observed effects. Investigations into the mechanisms underpinning postharvest HIPPL and LIUV hormesis, on tomato fruit, identified that the expression of genes involved in plant hormone biosynthesis, defence, secondary metabolism and ripening were affected. This indicates that disease control is achieved through induced resistance. Changes to expression, following treatment, were highly similar for both HIPPL and LIUV treatments and were mediated by salicylic acid, jasmonic acid and ethylene. This may lead to broad range resistance against necrotrophic and biotrophic pathogens as well as abiotic stresses and herbivorous pests. Recently, the exposure of foliage to UV-C has been shown to induce resistance against B. cinerea on Arabidopsis thaliana. The horticultural applications of such treatments, however, have not been explored. Pre-harvest treatments of lettuce in the glasshouse showed variation in damage threshold and optimal treatment to control disease following LIUV and HIPPL treatment. Further sources of variation included the cultivar, pathogen of interest and the point that treatment was applied during the year. Using a controlled environment allowed seasonal variation to be mitigated and both HIPPL and LIUV treatments controlled disease against B. cinerea. For pre-harvest treatments to be a success in the glasshouse, further studies into how both biotic and abiotic factors influence treatment is required. To circumvent the problems associated with pre-harvest treatments and environmental variation in the glasshouse, LIUV seed treatments were performed on tomato. Control of B. cinerea was established with an approximately 10% reduction in incidence and disease progression with a 4 kJ/m2 treatment. When monitoring the effect of treatment on germination and early seedling development it was also identified that an 8 kJ/m2 treatment led to biostimulation of germination and root and shoot growth.