Indiana University-Purdue University Indianapolis (IUPUI) / The pathogenesis associated with toxoplasmosis is attributed to repeated rounds of the parasite lytic cycle, which has been shown to be regulated by calcium fluxes. However, little is known about the calcium homeostatic mechanisms utilized by T. gondii. Recently, our lab has identified a novel protein-TgEFP1 (TGGT1_255660), which is predicted to bind Ca2+ through its two EF-hand domains. Interestingly, TgEFP1 showed a unique dual localization at the PLV/ELC and the PV of the parasite. Previous work showed that the PLV/ELC harbors other ion binding and conducting proteins that are important for parasite survival and propagation. However, the function of this compartment in the parasite is unknown. Therefore, I hypothesize that the PLV/ELC, through the function of TgEFP1, plays a key role in calcium homeostasis of T. gondii. To test this hypothesis, we sought to characterize the function of TgEFP1 during the parasite lytic cycle and determine TgEFP1 interacting proteins that also localize to the PLV/ELC. Partial permeabilization and ultrastructure expansion microscopy techniques confirmed the dual localization of TgEFP1 at the PLV/ELC and the PV. TgEFP1 knockout parasites exhibited several phenotypic defects including a faster lytic rate, shorter intracellular cycle, and were more sensitive to calcium ionophore treatment. Signal peptide deletion led to a mislocalization of TgEFP1 as cytosolic puncta, while mutations at key calcium coordinating residues lead to exclusive localization of TgEFP1 at the PV. Lastly, immunoprecipitation assays followed by LC-MS/MS identified a novel lectin-like protein- TgLectin (TGGT1_258950) as a direct interactor of TgEFP1-HA. Collectively, these findings support that through the function of TgEFP1, the PLV/ELC, plays a key role in calcium-dependent processes during the lytic cycle of the parasite.

Toxoplasma gondii is a protozoan parasite that causes life-threatening disease in congenitally infected infants and immunocompromised patients, such as those inflicted with AIDS. Toxoplasmic encephalitis (TE) is a common presenting condition in an AIDS infection. People become infected with T. gondii by ingesting tissue cysts in undercooked meats or by ingesting oocysts excreted by cats. Methylmercury (MeHg) is a well-documented neurotoxicant that accumulates in the brain and causes severe mental and visual dysfunction, including chronic encephalopathy. Consumption of contaminated fish, grains, and seeds are common sources of human exposure to methylmercury. Studies from our laboratory suggest that oral exposure to a single high dose of 20 mg/kg MeHg does not increase the susceptibility to acute toxoplasmosis in CBA/J mice. Therefore, we further investigated endpoints associated with immunotoxicity and neurotoxicity in 6-week old, female CBA/J mice exposed to both MeHg and T. gondii during a chronic T. gondii infection. We examined both single and multiple doses of MeHg exposure in a chronic parasitic infection model. In the single high dose study, four groups of six-week-old, female CBA/J mice were either fed 25 T. gondii tissue cysts of the ME-49 strain or given vehicle. Six weeks later, two out of the four groups (T. gondii and vehicle control) were orally gavaged with a single dose of 20 mg/kg body weight of MeHg and sacrificed seven days post exposure. Experiments from the multiple MeHg dose study were performed under similar conditions with the same number of groups and dosed by oral gavage with 8 mg/kg body weight of MeHg on days 0, 2,4,7,10,13. These mice were sacrificed on day 17 or 18 after initiating MeHg exposure. Flow cytometry following exposure to a single dose of MeHg in mice with a chronic T. gondii infection revealed significant changes (P < 0.05) within the T cell subpopulation percentages caused by exposure to MeHg. For example, the thymic CD4+CD8+ T cell subpopulations were increased (P <0.05). However, MeHg had no significant effect on the CD4+CD8-, CD4-CD8+, or non-T cell subpopulations in the spleen. Furthermore, MeHg increased splenic cellularity and spleen-to-body-weight ratios with or without a concurrent T. gondii infection. MeHg also caused a significant decrease in mouse body weight. There was a significant (P <0.05) increase in brain tissue cyst counts within the group exposed to both MeHg and T. gondii (16 ± 4, mean ± SE, n=7) versus T. gondii alone (4 ± 1, n=8). Histopathological examination demonstrated that the brain was affected, as lesions, gliosis, and meningitis were notable in mice given T. gondii. Exposure of mice to multiple doses of MeHg also resulted in effects on the immune system of CBA/J mice with and without chronic toxoplasmosis. Total cellularity and numbers of CD4+CD8+, CD4+CD8-, CD4-CD8+, and CD4-CD8- T-cell subpopulations show a marked decrease in number in the thymus, while total cellularity was also decreased in the spleen following concurrent exposure to T. gondii and MeHg. Flow cytometric examination of lymphocyte populations (CD4+ and CD8+ lymphocytes) in the spleen and thymus demonstrated differences from control in the groups exposed to T. gondii and MeHg. Histopathological examination did not reveal any significant lesions. The data from experiments in which single or multiple doses of MeHg were given to mice with a chronic T. gondii infection indicate that concurrent exposure, to both MeHg and T. gondii, dependent on dose and time of exposure had notable effects, especially on the immune system (Supported by NIH Grant F36GM20301). / Ph. D.

Caractérisation moléculaire et fonctionnelle de la jonction mobile contrôlant l'invasion de la cellule hôte par Toxoplasma gondii. Les apicomplexes sont des parasites eucaryotes responsables d'infections humaines et animales, dont le paludisme et la toxoplasmose. La plupart sont des parasites intracellulaires obligatoires ; l'entrée dans la cellule hôte est donc un évènement crucial dans leur cycle de développement. Ce processus, conservé au sein du phylum, implique la sécrétion séquentielle du contenu de deux organites : les micronèmes et les rhoptries. Lors de l'invasion, le parasite établit un contact étroit entre son extrêmité apicale et la membrane plasmique de la cellule hôte, appelé la jonction mobile (JM). La JM est un point d'ancrage à la cellule hôte qui est initié chez Toxoplasma par la sécrétion de protéines du col des rhoptries appelées TgRON2/RON4/RON5/RON8 (complexe de RONs). Ces protéines sont sécrétées dans la cellule hôte et TgRON2 est insérée dans la membrane de la cellule hôte. TgRON2 peut servir de récepteur à la protéine TgAMA1 (Apical Membrane Antigen 1) qui est une protéine de micronèmes sécrétée à la surface du parasite durant l'invasion. L'interaction AMA1-RON2 est également conservée chez Plasmodium, mais il n'existe pas de réactivité croisée entre espèces d'apicomplexes. La résolution de la structure de la protéine recombinante TgAMA1 en complexe avec un peptide TgRON2 nous a permis de déterminer des résidus critiques à l'interaction entre ces deux protéines in vitro et à l'invasion du parasite in vivo, et de définir les bases structurales de la spécificité intra-espèce de l'interaction AMA1-RON2. Par l'obtention d'une souche dépourvue de TgAMA1, nous montrons qu'AMA1 n'est pas essentielle à la survie du toxoplasme, comme il avait été supposé depuis longtemps. Nous confirmons le rôle clé de cette protéine dans l'invasion et la formation de la JM. Les mutants dépourvus d'AMA1 sont capables d'insérer le complexe de RONs dans la cellule hôte mais se détachent plus fréquemment, entrainant des invasions abortives. L'invasion résiduelle observée en absence d'AMA1 pourrait impliquer des protéines homologues à TgAMA1, TgRON2 et TgRON4, dont nous avons entamé la caractérisation moléculaire et fonctionnelle.Mot-clés : Apicomplexes, Toxoplasma gondii, invasion, jonction mobile, micronèmes, rhoptries / Molecular and functional characterisation of the moving junction controlling host cell invasion by Toxoplasma gondiiAbstract:Apicomplexa are eukaryotic parasites responsible for a variety of human and animal diseases, including malaria or toxoplasmosis. Most of them have an obligatory intracellular stage; thus, the invasive process is a crucial step in their developmental cycle. It implies the sequential secretion of two organelles: micronemes and rhoptries. During invasion, the parasite establishes a structure called the moving junction (MJ), which is a close apposition between the apical end and the plasma membrane of host cell. The MJ is an anchoring point for invasion that is initiated in Toxoplasma by the secretion of rhoptry neck proteins named TgRON2/RON4/RON5/RON8 (the RONs complex). These proteins are exported to the host cell cytoplasm and TgRON2 spans the host cell membrane. There, TgRON2 will function as a receptor to Apical Membrane antigen 1 (TgAMA1), which is a micronemal protein displayed on the surface of the parasite during the invasion process. The AMA1-RON2 interaction is conserved in Plasmodium but there is no interspecies cross-binding.We have determined the structure of a TgAMA1 recombinant protein in complex with a TgRON2 peptide, which allowed us to determine which residues are critical for the interaction between both proteins in vitro and for parasite invasion in vivo. Moreover, the co-structure explains at the structural level the evolutionary constraint of the AMA1-RON2 interaction. By generating an AMA1 null strain in T. gondii, we demonstrate that TgAMA1 is not an essential gene, as claimed before. We confirm the importance of AMA1 in invasion and its key role in MJ formation. AMA1 null parasites insert the RON complex into the host cell but are more frequently detached from it, causing abortive invasions. The residual invasion might involve proteins homologous to TgAMA1, TgRON2 and TgRON4, for which the molecular and functional characterization is undertaken.Keywords: Apicomplexes, Toxoplasma gondii, invasion, moving junction, micronemes, rhoptries

Toxoplasma gondii est un parasite protozoaire intracellulaire obligatoire appartenant à la famille des Apicomplexa. Chez les protozoaires, les protéases possèdent des rôles clés au niveau du cycle parasitaire, et sont ainsi considérées comme des facteurs de virulence. Chez T. gondii, les métallopeptidases pourraient être impliquées dans la traversée des différentes barrières biologiques. A l'heure actuelle, seules cinq métallopeptidases de T. gondii ont été décrites : une aminopeptidase N, deux toxolysines, une leucine aminopeptidase et une FtsH1 peptidase. Lors de l'étude de l'influence de l'invasion de monocytes humains par T. gondii sur le profil d'expression des métalloprotéases matricielles monocytaires, nous avons mis en évidence une protéase parasitaire présentant à la fois des propriétés gélatino- et élastinolytique.Le but de ce travail est de caractériser, purifier et identifier cette gélatinase de T. gondii.Dans un premier temps, nous avons caractérisé la gélatinase d'environ 100 kDa sécrétée par T. gondii comme étant une MMP-9 like (métallo-endopeptidase à zinc) mais ne possédant pas le même processus d'activation que les MMPs humaines.Dans un deuxième temps, après purification partielle par une série de chromatographie chélatrice de zinc, nous avons identifié par spectrométrie de masse la gélatinase comme étant la TGME49_227948 annotée dans ToxoDB. Cette protéase présente les domaines protéiques d'une métalloprotéase à zinc de la sous-famille M16C, et est proche au niveau de sa structure 3D de la chaine A de la 2FGE présente chez Arabidopsis Thaliana. Afin de confirmer l'annotation de ToxoDB, nous avons séquencé l'extrémité 5' de l'ARNm de cette protéase. Cependant, nos résultats expérimentaux ne sont pas en concordance avec l'annotation prédite dans la base de données ToxoDB.La séquence en acides aminés de cette protéase, nous a permis de synthétiser deux anticorps polyclonaux spécifiques afin de mettre en évidence deux formes de 140 kDa et 100 kDa et donc d'émettre l'hypothèse que cette protéase pourrait être clivée afin d'être activée. De plus, cette métalloprotéase a été détectée par western blot dans le cytosol des parasites mais elle est aussi secrétée dans le milieu conditionné. Par immunolocalisation, la protéase est présente au sein du parasite, au niveau du cytosol sans localisation préférentielle dans un organite particulier.Dans ce travail, nous avons montré que la gélatinase parasitaire sécrétée par T. gondii pourrait dégrader des composés de la matrice extracellulaire, d'où son rôle potentiel dans le mécanisme de traversée des barrières biologiques. / Toxoplasma gondii is an intracellular protozoan parasite which belongs to the Apicomplexa phylum. In protozoans, proteases have key roles in the parasitic cycle. They thereby are considered as virulence factors. In T. gondii, metallopeptidases may be involved in the crossing of biological barriers. Currently, only five metallopeptidases from T. gondii are described: an aminopeptidase N, two toxolysins, one leucine aminopeptidase and one FtsH1 peptidase. During the study of the influence of human monocytes invasion by T. gondii on the monocytic matrix metalloproteases expression profile, we brought out a parasitic protease showing gelatino- and elastinolytic properties.The aim of this study is to characterize, purify and identify this gelatinase from T. gondii.First we characterized the 100 kDa-gelatinase secreted by T. gondii as an MMP-9-like (zinc metalloendopeptidase) but its activation process is different from human MMPs.Then, after the partial purification by a series of zinc-chelate chromatographies, we identified by mass spectrometry the gelatinase as the TGME49_227948 annotated in ToxoDB. This protease has M16C subfamily zinc-metalloprotease protein domains and is close to the 3D structure of the A chain of the 2FGE in Arabidopsis thaliana. In order to confirm the ToxoDB annotation, we sequenced the 5' end of the mRNA of this protease. Nevertheless our experimental results are not in the line with the predicted annotation in ToxoDB database.The amino acids sequence of this protease allowed us to synthesize two specific polyclonal antibodies in order to highlight two forms, 140 kDa and 100 kDa, and to emit the hypothesis that this protease could be cleaved to be activated. Moreover this metalloprotease was detected by Western Blot in the cytosol of the parasites but it can also be secreted in the conditioned medium. By immulocalization, the protease is present in the cytosol of the parasite without any preferential localization in a particular organelle.In this study, we showed that the parasitic gelatinase secreted by T. gondii could degrade extracellular matrix compounds, which could explain its potential role in the mechanism involved in the crossing of biological barriers.

Neste estudo, foram descritos os aspectos clínicos e resultados visuais em indivíduos com evidência sorológica e sinais clínicos de toxoplasmose ocular. Os sujeitos foram examinados com lâmpada de fenda, exame de oftalmoscopia indireta, tendo registros fotográficos com retinografia e tomografia de coerência óptica. Duzentos e sessenta e sete participantes foram incluídos no estudo (n = 350 olhos). A forma de toxoplasmose ocular foi considerada primária em 52 indivíduos (19,5%), recorrente ativa em 89 (33,3%) e inativa em 126 (47,2%). A maioria dos olhos apresentou uma lesão (n=169; 48,3%), enquanto que 149 olhos (42,6%) apresentaram duas a quatro lesões e 32, cinco ou mais lesões (9,1%). As lesões centrais estiveram presentes em 127 olhos (36,3%), periféricas em 178 (50,9%), enquanto que lesões centrais e periféricas em 45 (12,6%). A maioria dos indivíduos apresentou sorologia para toxoplasma gondii (T. gondii) IgG + IgM- (n=245; 91,8%), enquanto que apenas 22 (8,2%) foram T. gondii IgG + IgM +. Do total de olhos afetados em que a acuidade visual foi medida (n=314), a maioria (n=160; 50,9%) apresentou melhor acuidade visual corrigida final >20/40, e 25,8% (n=81) foram considerados cegos (<20/400). Lesões múltiplas, de localização central e com tamanho maior que um diâmetro de disco óptico foram consideradas fator de risco para pior prognóstico visual. A membrana epirretiniana (n=21; 7,1%) e opacidade vítrea (n=20; 6,8%) foram as principais causas de complicações observadas. A taxa de incidência de complicações foi de 0,41 complicações/ano, e foram verificadas 0,13 reativações/ano. O estudo demonstrou altas taxas de déficit visual, devendo ser realizados novos estudos para o desenvolvimento de novas modalidades terapêuticas para diminuir o impacto da doença como causa de cegueira e deficiência visual. / In this study, we describe the clinical aspects clinical aspects and visual outcomes in individuals with serological evidence and clinical signs of ocular toxoplasmosis. The subjects were examined with a slit lamp, indirect ophthalmoscopy examination, having photographic records with retinography and optical coherence tomography. Two hundred and sixty -seven subjects were included in the study (n=350 eyes). The form of ocular toxoplasmosis was considered primary active in 52 subjects (19.5%), recurrent active in 89 subjects (33.3%) and inactive in 126 (47.2%). Most eyes presented only one lesion (n=169; 48.3%), whereas 149 individuals (42,6%) had 2-4 lesions, and 32 had five or more lesions (9.1%). Central lesions only were present in 127 eyes (36,3%), peripheral in 178 (50,9%%), while concomitant central and peripheral were present in 45 (12.6%). Most subjects had T. gondii IgG+ IgMserology (n=245; 91.8%), whereas only 22 (8,2%) were T. gondii IgG+ IgM+. From the total of affected eyes which visual acuity was measured (n=314), most (n=160; 50,9%) had better final corrected visual acuity> 20/40 and 25.8% (n = 81) were considered blind (<20/400). Multiple, centrally located lesions of greater size than an optic disc diameter were considered risk factor for a worse visual prognosis. The epiretinal membrane (n=21; 7.1%) and vitreous opacity (n=20; 6.8%) were the main causes of complications seen. The incidence rate of complications was 0,41 complications/year, and it was verified 0,13 reactivations/year. The study demonstrated a high rate of visual impairment, and studies for the development of novel therapeutic modalities should be performed to reduce the impact of the disease as a cause of blindness and visual impairment.

Toxoplasma gondii vs radiação ionizante: Imunidade humoral e celular em baço e intestino de camundongos isogênicos imunizados com taquizoítos irradiados por Cobalto 60 Andrés Jimenez Galisteo Jr. Estudamos o desenvolvimento de uma vacina para toxoplasmose utilizando a radiação ionizante como ferramenta. Aqui avaliamos o desenvolvimento da imunidade sistêmica e intestinal e a resistência à infecção, em diferentes camundongos imunizados, por via oral e parenteral, com taquizoítos irradiados a 255 Gy e desafiados com cistos da cepa ME49. Camundongos C57Bl/6j, BALB/c e C57Bl/6j IFN--/- foram imunizados com 107 taquizoitos de T. gondii irradiados a 255Gy por diferentes vias. As preparações de taquizoítos irradiados, por via oral e parenteral, induziram produção de imunoglobulinas IgG e IgA no soro de camundongos, sendo predominante a subclasse de IgG2b, determinadas por ELISA. A produção de IgM foi mínima. Os animais imunizados pela via parenteral, apresentaram uma maturação mais rápida da avidez de anticorpos IgG que os animais imunizados por via oral. Houve excreção de IgG, IgA e IgM nas fezes dos animais imunizados, mais intensa nos animais imunizados por via oral. No estudo da imunidade celular induzida por antígeno e detectada for real-time PCR, houve uma grande produção de IFN- por células esplênicas, menor por células das placas de Peyer intestinais, onde houve maior produção de IL-2. Houve proteção em todos os nossos esquemas avaliados, maior nos animais BALB/c. Os animais deficientes de IFN-, não foram afetados pelo processo de imunização e apresentaram produção de IgG e IgA sérico e excreção de S-IgA e S-IgM nas fezes, com menor numero de cistos cerebrais em animais imunizados por via parenteral. Todos nossos dados apontam para a possibilidade do desenvolvimento de uma vacina oral para toxoplasmose, utilizando taquizoítos irradiados, com aplicação prática na imunização de felinos domésticos e selvagens. / We are developing a vaccine for toxoplasmosis, using ionizing radiation as a tool. Here we analyzed the production of sytemic and intestinal immunity, with protection studies, in several strains of inbred mice, by oral or parenteral route, using 255 Gy irradiated tachyzoites of T. gondii RH strain, with challenge with cysts of ME- 49 strain. C57Bl/6j, BALB/c and C57Bl/6j IFN--/- mice were immunized with 107 irradiated tachyzoites, be parenteral or oral route. Those preparations, both by parenteral or oral routes, induced the production of specific IgG, mainly of the IgG2b subclass, and IgA immunoglobulins in serum, , as determined by ELISA. IgM production was negligible. Parenteral immunized mice showed higher IgG avidity maturation, as compared to oral immunized mice. Fecal excretion of IgG, IgA and IgM was detected in stools of immunized animals, more intense in oral immunized mice. In cellular immunity studies, induced by antigen, with detection of cytokine production by quantitative real-time PCR, there are a great production of IFN- by spleen cells, with lower levels in Peyer patches cells, where there are a greater IL-2 production. Challenge studies in immunized mice demonstrated protection to infection in all used schedules, greater in BALB/c mice. C57Bl/6j IFN--/- mice, when immunized, showed no signs of disease and produced similar or greater levels of antibodies than wild type mice. They also excreted S-IgA and S-IgM in stools, but with low numbers of brain cysts in parenteral immunized mice, despite similar mortality. Our data points to a fair possibility of use of those irradiated parasites as an oral vaccine, devised to use for veterinary or wild felines vaccination, reducing the production of oocysts by those hosts and interrupting the chain transmission of human toxoplasmosis.

Plasmodium falciparum e Toxoplasma gondii são protozoários parasitas pertencentes ao filo Apicomplexa. Apirases são enzimas metabolizadoras de nucleotídeos extracelulares. Nesta tese mostramos pela primeira vez a presença de um membro desta família de enzimas em P. falciparum, o qual foi capaz de degradar ATP extracelular. Análises por RT-qPCR revelaram a expressão da apirase durante todo o ciclo intraeritrocítico. A adição de inibidores desta classe de enzimas foi capaz de prejudicar o desenvolvimento dos parasitas e a invasão de novas hemácias pelos merozoitos, sugerindo assim um papel da apirase nestes processos. A via de sinalização por Ca2+ é universal e vital para todas as células. Para melhor entender a fisiologia celular de P. falciparum construímos uma nova linhagem de parasitas transgênicos, PfGCaMP3, que nos tornam capazes de monitorar a dinâmica de Ca2+ sem o uso de protocolos invasivos de marcação. De modo semelhante utilizamos uma nova linhagem de T. gondii expressando de forma estável o indicador de Ca2+ GCaMP3 para estudar o papel deste íon na saída da célula. T. gondii possui o Ca2+ necessário para promover este processo, entretanto Ca2+ extracelular age como um fator intensificador neste passo essencial do ciclo lítico. / Plasmodium falciparum and Toxoplasma gondii are protozoan parasites that belong to phylum Apicomplexa. Apirases are metabolizing enzymes of extracellular nucleotides. In this work we show for the first time the presence of an apyrase in P. falciparum, which was able to degrade extracellular ATP. RTqPCR analysis revealed the expression of apyrase throughout the intraerythrocytic cycle. Addition of apyrase inhibitors was able to impair the development of the parasites and the invasion of new erythrocytes by merozoites, thus suggesting a role of apyrase in these processes. Calcium signaling is universal and vital to all cells. To better understand the cellular physiology of P. falciparum we construct a new strain of transgenic parasites, PfGCaMP3, which enable us to monitor the Ca2+ dynamics without using invasive protocols. Similarly we use a new strain of T. gondii that stably express the Ca2+ indicator GCaMP3 to study the role Ca2+ in parasite egress. T. gondii has the Ca2+ required to promote this process, however extracellular Ca2+ acts as an enhancer factor in this crucial step of the lytic cycle.

Introdução: A água tem sido considerada um importante veículo para a disseminação de surtos de toxoplasmose em vários países. Os oocistos de Toxoplasma gondii podem persistir no ambiente durante longos períodos, sendo altamente resistentes aos vários processos químicos de inativação, inclusive aos processos comuns de desinfecção utilizados pelos sistemas produtores de água. Pouco se tem registrado no país sobre a real extensão da contaminação dos recursos hídricos por Toxoplasma gondii, sendo que a sua detecção em amostras de águas é muito importante na implantação de ações preventivas. As metodologias existentes no momento para identificação e quantificação deste parasita nestes tipos de amostras não estão universalmente padronizadas e apresentam limitações. Objetivo: O presente estudo teve como objetivo verificar a possível presença do protozoário em águas superficiais de abastecimento público no Estado de São Paulo mediante a implantação de uma metodologia específica para a quantificação de oocistos de Toxoplasma gondii por reação quantitativa de PCR em tempo real nessas amostras. Método: Um total de 39 amostras de águas superficiais provenientes de 10 mananciais do Estado de São Paulo foram analisadas durante o período de maio a dezembro de 2015. Volumes de 20L da amostra foram concentrados por meio de filtração em cápsulas Envirocheck® HV (Pall Gelman Laboratory), sendo a cápsula filtrante tratada com uma solução dispersante, eluída e o eluato concentrado por centrifugação. O sedimento obtido após a centrifugação da amostra foi submetido à extração de DNA, sendo utilizado o kit de extração PowerSoil DNA isolation® (MO BIO Laboratories). A sequência alvo selecionada para detecção e quantificação de oocistos de Toxoplasma gondii através da reação quantitativa de PCR em tempo real foi um fragmento de 62 pares de bases do gene B1, sendo utilizado o seguinte conjunto de iniciadores: 5 CTAGTATCGTGCGGCAATGTG 3 (531-551) e 5GGCAGCGTCTCTTCCTCTTTT 3 (571-592). A sonda utilizada foi: 5 (6-FAM) CCACCTCGCCTCTTGG-(NFQ-MGB) 3. Resultados: Do total das amostras analisadas, 7,7 por cento (3/39) foram positivas para oocistos de Toxoplasma gondii e dentre os 10 mananciais estudados, detectou-se a ocorrência do protozoário em 30 por cento (3/10) dos mesmos. Conclusão: Os dados obtidos no presente estudo demonstram que o protozoário Toxoplasma gondii está circulando em águas superficiais de abastecimento público no Estado de São Paulo. / Introduction: Water is an important vehicle for the spread of toxoplasmosis outbreaks in several countries. Toxoplasma gondii oocysts may remain for a long period in the environment and are highly resistant to chemical inactivation, including the routine classical disinfection procedures in water treatment facilities. Few reports have been published in Brazil about the real extent of the contamination of water resources by Toxoplasma gondii, which is of major importance to implement preventive actions. Methods for the identification and quantification of the parasite in water bodies are not standardized and have limitations. Objective: This study aimed to verify the presence of these protozoa in surface waters used as source for drinking water production in the State of São Paulo by implementing a specific methodology to quantify Toxoplasma gondii oocysts with quantitative real-time PCR. Method: Thirty nine samples of surface waters from 10 different sites in the State of São Paulo were analized from May to December 2015. Volumes of 20L of each sample were concentrated by filtration with capsule Envirocheck® HV (Pall Gelman Laboratory).The filter capsule was treated with a dispersant solution, eluted, and the eluate concentrated by centrifugation. DNA was extracted from the resulting pellet with PowerSoil DNA isolation® (MO BIO Laboratories) extraction kit. A fragment of 62 base pairs of the B1 gene was selected as target sequence for detection and quantitation the Toxoplasma gondii oocysts by the quantitative real-time PCR reaction, and the following primers: 5\' TAGTATCGTGCGGCAATGTG 3\' (531-551) and 5\'GGCAGCGTCTCTTCCTCTTTT 3\' (571-592) were used. The probe employed was 5 \'(6-FAM) CCACCTCGCCTCTTGG- (NFQ-MGB) 3\'. Results: Toxoplasma gondii oocysts were detected in 30 per cent (3/10) of the sites evaluated and 7.7 per cent (3/39) of all samples analyzed were positive. Conclusion: The results of the present study show that the protozoan Toxoplasma gondii is circulating in surface waters used as drinking water supply in the State of São Paulo.

Foi realizada a pesquisa de anticorpos anti-Toxoplasma gondii, através do teste de aglutinação modificado (MAT), em 68 amostras de soros de capivaras de seis municípios no estado de São Paulo. Anticorpos (MAT?25) foram encontrados em 51 (75%) capivaras examinadas. Dentre estas realizou-se o bioensaio em camundongos, com tecidos do cérebro, coração e língua, de 40 capivaras, sendo obtidos 36 isolados (90%). Não houve associação entre o número de isolados e idade das capivaras (p=0,21), sexo (p=0,58) ou tipo de criação (p=0,62), isto é, criadouros e vida livre, bem como a freqüência de isolamentos e os títulos de anticorpos (p=0,99). A análise de polimorfismo de comprimento dos fragmentos de DNA gerados por enzimas de restrição (RFLP) sobre produtos do locus SAG2 amplificados pela reação em cadeia pela polimerase (PCR) revelou que 20 isolados (55,5%) pertenciam ao genótipo I, 14 (38,9%) ao genótipo III e dois (5,6%) que apresentaram genótipo misto (tipos I e III). Não foi encontrado isolado tipo II. A proporção de isolados tipo I entre as capivaras de vida livre foi maior (p=0,049) do que entre as capivaras provenientes de criadouros. Por outro lado, entre as capivaras de criadouros, a proporção de isolados tipo III foi maior (p=0,041). A maioria dos isolados tipo I (12/20) causou óbito em todos os camundongos infectados e, em nenhum grupo com este isolado, 100% dos camundongos sobreviveram. A maioria dos isolados tipo III (8/14) não matou nenhum camundongo infectado. A freqüência de óbitos em camundongos com genótipo I (86%) foi maior do que o tipo III (44,9%) (p<0,001), enquanto a sobrevida dos camundongos com genótipo III foi significativamente maior que a dos camundongos com genótipo I (p<0,001). Foram encontrados cistos nos cérebros dos camundongos infectados em todos os 36 isolados. A análise genotípica também foi realizada diretamente dos tecidos de 35 das 36 capivaras (homogeneizados de tecidos) das quais houve isolamento pelo bioensaio, usando nestedPCR-RFLP no locus SAG2. Foram caracterizadas 22 amostras (62,8%), 21 delas idênticas aos dos isolados correspondentes. Em uma amostra genótipo misto foi obtido dos tecidos primários e tipo I no isolado. Os genótipos mistos foram confirmados pelo seqüenciamento de DNA dos produtos da nestedPCR obtidos das amostras primárias das capivaras. / Antibodies to Toxoplasma gondii were assayed by the modified agglutination test (MAT) in serum samples of 68 capybaras from six counties in São Paulo state, Brazil. Antibodies (MAT?25) were found in 51 (75%) capybaras examined. Tissues (brain, heart and tongue) of 40 of the seropositive capybaras were bioassayed in mice and 36 (90%) isolates were obtained. There was no statistical association between number of isolates and age (p=0.21), gender (p=0.58) and type of rearing (p=0.62), as well as no association with frequency of isolations and antibody titer distribution (p=0.99). Restriction fragment length polymorphism (RFLP) analysis in PCR-amplified SAG2 locus products revealed that 20 isolates (55.5%) were genotype I, 14 (38.9%) were genotype III and two (5.6%) were mixed genotypes (types I and III). Type II isolate was not found. The proportion of type I isolates in the group of wildlife capybaras was higher (p=0.049) than in the captive rearing group. On the other hand, the proportion of type III isolates was significantly higher in the captive rearing group (p=0.041). Most of the type I isolates (12/20) killed all infected mice and none of those groups had 100% of surviving mice. Most of the mice infected with genotype III isolate survived. The mortality rate in mice infected with genotype I (86%) was higher than the type III (44.9%) (p<0.001) and mice infected with type III isolates survived for longer periods than type I isolates (p<0.001). Tissue cysts were found in mice infected with all 36 isolates. Genotyping was also done directly from the tissue homogenates from the 35 of 36 capybaras using nested-PCR-RFLP analysis on the SAG2 locus. Twenty?two samples (62.8%) were characterized and in 21 the genotypes found were the same as those from the corresponding isolates. In one sample, mixed genotype was detected directly from the primary sample and type I from the mice isolate. The mixed genotype was confirmed by direct DNA sequencing of the nestedPCR products from the capybaras primary samples.

Com o objetivo de identificar Toxoplasma gondii e Neospora caninum em roedores urbanos da Grande São Paulo (SP) 217 roedores (quatro camundongos -Mus musculus, 20 ratazanas - Rattus norvegicus e 193 ratos de telhado - Rattus rattus) foram capturados entre abril de 2005 e fevereiro de 2008, para realização do diagnóstico biológico e molecular. Das 20 ratazanas (Rattus norvegicus) capturadas apenas uma foi positiva para T. gondii pelo bioensaio, correspondendo a 5% de positividade entre as ratazanas e 0,46% entre todos os roedores capturados. O isolado obtido dessa ratazana foi caracterizado como genótipo recombinante I, III e u-1 por PCR-RFLP, similar ao isolado previamente descrito e obtido de duas ovelhas e um gato, todos do Estado de São Paulo. Quatro amostras de roedores negativos ao bioensaio resultaram como positivas ao T. gondii pela nested PCR B1. Entretanto, quando submetidas à nested PCR ITS1 e à restrição enzimática (RFLP) não houve confirmação desse resultado em três delas. Em relação ao N. caninum, amostras de tecido cerebral e cardíaco de 121 roedores foram examinadas por nested PCR Nc5, tendo sido encontradas 12 amostras positivas, provenientes de 10 roedores. Quando submetidas à nested PCR ITS1 e à restrição enzimática (RFLP) N. caninum não foi confirmado em nenhuma das amostras. Este estudo conclui que a ocorrência de T. gondii e N. caninum em roedores urbanos da Grande São Paulo (SP) é baixa, sugerindo que estes animais não possuem papel importante na cadeia epidemiológica como reservatórios desses agentes para predadores como os cães e gatos urbanos. / In order to identify Toxoplasma gondii and Neospora caninum in urban rodents from the Great São Paulo (SP) 217 rodents (four Mus musculus, 20 Rattus norvegicus and 193 Rattus rattus) were captured between April 2005 and February 2008 to biological and molecular diagnosis. One out of the 20 Rattus norvegicus was considered positive by bioassay in mice, corresponding to a 5% positivity among Rattus norvegicus and a 0.46% positivity considering all captured rodents. The isolate from this rat was characterized as a recombinant I, III and u-1 genotype by RFLP-PCR. This characterization had been previously described from isolates obtained from two sheep and one cat also from São Paulo state. Four samples from rodents with negative results by bioassay were positive to T. gondii by nested PCR B1. However, when tested with nested PCR ITS1 and RFLP these results were not confirmed in three of these samples. Regarding N. caninum, brain and heart samples of 121 rodents were examined by nested PCR Nc5 and 12 samples from 10 rodents were positive. When tested with nested PCR ITS1 and RFLP all of these samples turned out to be negative. This study concludes that T. gondii and N. caninum have low occurrence in urban rodents in the Great São Paulo area, and they are not important as T. gondii and/or N. caninum reservoirs to predators like urban cats and dogs.