The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)

Regulation of transcription initiation is the major determining event employed by the cell to control gene expression and subsequent cellular processes. The weak promoters, with low basal transcription activities, are activated by activators. Bacteriophage Mu mom gene, which encodes a unique DNA modification function, is detrimental to cell when expressed early or in large quantities. Mu has designed a complex, well-controlled and orchestrated regulatory network for mom expression to ensure its synthesis only in late lytic cycle. The phage encoded transcription activator protein C activates the gene by promoter unwinding of the DNA and thereby recruiting of RNAP to the promoter. C protein functions as a dimer for DNA binding and transcription activation. Mutagenesis and chemical crosslinking studies revealed that the leucine zipper motif, and not the coiled coil motif in the N terminal region, is responsible for C dimerization. The DNA binding domain of C is a HTH domain which is preceded by the leucine zipper motif. The C protein is one of the few examples in the bacterial proteins containing both leucine zipper and HTH domain. Most of the transcription activators either influence initial binding of RNAP or conversion of closed to open complex formation. Very few activators act at subsequent steps of promoter-polymerase interaction. Earlier studies showed high level of transcription from a mutant mom promoter, tin7. Addition of C further increased transcription from Ptin7 indicating that C may have a role beyond polymerase recruitment. Each steps of transcription initiation have been dissected using the Ptin7 and a positive control (pc) mutant of C, R105D. The results revealed multi-step transcription activation mechanism for C protein at Pmom. C recruits RNAP at Pmom and subsequently increases the productive RNAP-promoter complex and enhances promoter clearance. To further understand the C mediated transactivation mechanism, interaction between C and RNAP was assessed. C interacts with holo and core RNAP only in presence of DNA. Positive control mutants of C, F95A and R015D, were found to be compromised in RNAP interactions. These mutants were efficient in RNAP recruitment to Pmom but do not enhance promoter clearance. Trypsin cleavage protection experiment indicated that probably C protein interacts with b¢ subunit of RNAP. Interaction between C and RNAP appears to enhance the formation of productive RNAP-promoter complex leading to promoter clearance. The connection between activator-polymerase interaction and transcription activation is well documented where the recruitment of RNAP is influenced. In case of activators acting at post recruitment steps of initiation, the role of polymerase contact is poorly understood. Our study shows that activator-polymerase interaction can lead to increased promoter clearance at Pmom by overcoming abortive initiation.

As células glias de Müller são capazes de gerar novos neurônios retinianos em resposta a lesões, atuando como uma possível fonte para regeneração retiniana. Nesse contexto, as GTPases Rho podem ter um papel interessante, visto que regulam múltiplas vias de sinalização que controlam, por exemplo, a transcrição gênica, sobrevivência e proliferação celular. No presente estudo analisamos a participação de um dos membros dessa família (Rac1) na proliferação de células gliais de Müller da retina de galinhas após lesão excitotóxica com N-Metil-D-Aspartato (NMDA). A injeção intraocular de NMDA promoveu extensa proliferação de células gliais de Müller. A inibição de Rac1 com NSC23766 não alterou a quantidade de células que entraram no ciclo celular, mas, provocou um retardo em sua progressão. Esses resultados sugerem um importante papel para a GTPase Rac1 na regulação da proliferação de células gliais de Müller em resposta a lesões retinianas. / Müller glial cells may generate new neurons in response to retinal injury, acting as a potential source for retinal regeneration. In this context, Rho GTPases may have an interesting role, since they regulate multiple signaling pathways that control, for example, gene transcription, cell proliferation and survival. This study analyzed the involvement of a member of this family (Rac1) in the proliferation of Müller glial cells of chick retina after excitotoxic injury with N-methyl-D-aspartate (NMDA). Intraocular injection of NMDA promoted extensive Müller glia proliferation. Rac1 inhibition with NSC23766 did not affect the cell cycle entry, but a delay in cell cycle progression was observed. These results suggest an important role for Rac1 in the regulation of Müller glial cells proliferation in response to retinal injury.

O gene SLC2A4 codifica a proteína GLUT4, fundamental na homeostasia glicêmica. OBJETIVO: Investigar o efeito do diabetes na expressão do GLUT4 pela atividade contrátil. MÉTODOS: Músculos sóleos de ratos não diabéticos (ND) e diabéticos tratados com insulina (DI) ou salina (DS) foram incubados e contraídos. A expressão de GLUT4, pAMPK e CAMKII foram analisados por PCR e Western blotting, e a atividade de MEF2D, GEF, HIF-1<font face=\"Symbol\">a e TR<font face=\"Symbol\">a1 por gel shift. Células C2C12 transfectadas com plasmídeos contendo os sítios de ligação para MEF2, HIF, e TR foram tratadas com AICAR ou cafeína. RESULTADOS: Em animais ND e DI, a contração aumentou o conteúdo de GLUT4, mas não nos DS. Em animais ND, a contração aumentou a atividade da AMPK e dos fatores MEF2D, GEF e TR<font face=\"Symbol\">a1, mas não nos DS. Em animais ND, os inibidores de AMPK e CAMKII aboliram o aumento do GLUT4 e da atividade de MEF2D e GEF. Em células C2C12 a cafeína e a AMPK ativaram os 3 sítios. CONCLUSÃO: O diabetes abole o aumento da expressão do GLUT4 sob a atividade contrátil devido a redução da atividade de MEF2D, GEF e TR<font face=\"Symbol\">a1 e AMPK. / The SLC2A4 gene encodes the GLUT4 protein, which is essential in glucose homeostasis. OBJECTIVE: To investigate the diabetes effect on muscle contraction-induced in SLC2A4 gene expression. METHODS: Soleus muscles of Non diabetic rats (ND) and diabetic treated with insulin (DI) or saline (DS) were incubated and contracted. The GLUT4, pAMPK and CAMKII expressions were analyzed by PCR and Western blotting, and the MEF2D, GEF, HIF-1<font face=\"Symbol\">a and TR<font face=\"Symbol\">a1 activity by gel shift. C2C12 cells transfected with plasmids containing the binding sites for MEF2, HIF, and TR were treated with AICAR or caffeine. RESULTS: Contraction increased the GLUT4 amount in animals ND and DI, but not in DS. In ND animals, contraction increased AMPK, MEF2D, GEF and TR<font face=\"Symbol\">a1 activity, but not in DS. In ND animals, AMPK and CAMKII inhibitors abolished the GLUT4 increase as like MEF2D and GEF activity. In C2C12 cells AMPK and caffeine activated the 3 sites. CONCLUSION: Diabetes abolishes the muscle contraction-induced GLUT4 increase due to reduced of MEF2D, GEF, TR<font face=\"Symbol\">a1 and AMPK activity.

Escherichia coli enteropatogênica atípica (aEPEC) faz parte de um grupo de patógenos capazes de formar um tipo de lesão característica em cultura de tecidos epiteliais, denominada attaching and effacing (A/E). Os genes que são necessários para produção da lesão A/E estão localizados em uma ilha de patogenicidade denominada região LEE (locus of enterocyte effacement). A transcrição de genes da região LEE está sujeita a regulação por vários fatores, entre eles quorum sensing, termo utilizado para designar um mecanismo de regulação gênica dependente da concentração celular. Esse mecanismo é usado por bactérias Gram-positivas e Gram-negativas e em ambos os casos envolve a produção e detecção de moléculas sinalizadoras extracelulares, denominadas autoindutores. Até o momento, pelo menos quatro sistemas de quorum sensing foram descritos, entre eles o sistema de autoindutor AI-3 encontrado em bactérias Gram-positivas e Gram-negativas. Diversos mecanismos celulares, entre eles a expressão de fatores de virulência em amostras de EPEC e EHEC, são regulados por esse fenômeno. O principal objetivo deste estudo foi verificar se existe uma possível regulação por quorum sensing na interação in vitro de uma amostra de E. coli da microbiota intestinal com amostras de aEPEC. Após a confirmação da produção de AI-3 por amostras de E.coli da microbiota intestinal foram realizados ensaios de adesão e quantificação utilizando meio pré-condicionado com esta amostra, epinefrina e bloqueadores que confirmaram que os padrões de adesão de aEPEC obtidos em menor tempo são devidos a presença de AI-3 no meio pré-condicionado, indicando a participação de quorum sensing nessa interação. Além disso, foi observado um fenômeno citotóxico nas células que não é produzido pelo AI-3. / Atypical Enteropathogenic Escherichia coli (aEPEC) are part of a group of pathogens capable of forming a type of lesion characteristic of epithelial tissues in culture, called attaching and effacing (A/E). The genes that are required for production of A/E lesion are located in a pathogenicity island called LEE region (locus of enterocyte effacement). The transcription of LEE genes in the region is subject to regulation by various factors, including quorum sensing, a term used to describe a mechanism of gene regulation dependent on cell concentration. This mechanism is used by Gram-positive and Gram-negative and in both cases involves the production and detection of extracellular signaling molecules, called autoinducers. So far, four systems of quorum sensing have been described, including the system of autoinducers AI-3 found in Gram-positive and Gram-negative bacteria. Several cellular mechanisms, including expression of virulence factors in EPEC and EHEC are regulated by this phenomenon. The main objective of this study was to determine whether there is a possible regulation by quorum sensing in the in vitro interaction of a strains of E. coli of the intestinal microbiota with strains aEPEC. After confirming the production of AI-3 in E. coli of the intestinal microbiota were performed adhesion assays and quantification using means preconditioned with this strains, epinephrine, and blockers who confirmed that patterns of adherence of aEPEC obtained in less time are due to the presence of AI-3 in the preconditioned means, indicating the involvement of quorum sensing in this interaction. Furthermore, we observed a phenomenon that cytotoxic cells is not produced by AI-3.

No description available.

Plant reproductive development begins when vegetative shoot apical meristems change their fate to inflorescence meristems which develop floral meristems on the flanks. This process of meristem fate change and organ development involves regulated activation and/or repression of many cell fate determining factors that execute down-stream gene expression cascades. Flowers are formed when floral organs are specified on the floral meristem in four concentric whorls. In the model dicot plant Arabidopsis, the identity and pattern of floral organs is determined by combined actions of MADS-domain containing transcription factors of the classes A, B, C, D and E. Rice florets are produced on a compact higher order branch of the inflorescence and have morphologically distinct non-reproductive organs that are positioned peripheral to the male and female reproductive organs. These unique outer organs are the lemma and palea that create a closed floret internal to which are a pair of lodicules that are asymmetrically positioned fleshy and reduced petal-like organs. The unique morphology of these rice floret organs pose intriguing questions on how evolutionary conserved floral meristem specifying and organ fate determining factors bring about their distinct developmental functions in rice. We have studied the functions for two rice MADS-box proteins, OsMADS2 and OsMADS1, to understand their role as master regulators of gene expression during rice floret meristem specification and organ development. OsMADS2; a transcriptional regulator of genes expression required for lodicule development Arabidopsis B-function genes AP3 and PI are stably expressed in the whorl 2 and 3 organ primordia and they together with other MADS-factors (Class A+E or C+E) regulate the differentiation of petals and stamens (Jack et al, 1992; Goto and Meyerowitz, 1994). Rice has a single AP3 ortholog, SPW1 (OsMADS16) but has duplicated PI-like genes, OsMADS2 and OsMADS4. Prior studies in our lab on one of these rice PI-like genes OsMADS2 showed that it is needed for lodicule development but is dispensable for stamen specification (Kang et al., 1998; Prasad and Vijayraghavan, 2003). Functional divergence between OsMADS2 and OsMADS4 may arise from protein divergence or from differences in their expression patterns within lodicule and stamen whorls. In this study, we have examined the dynamic expression pattern of both rice PI-like genes and have examined the likelihood of their functional redundancy for lodicule development. We show OsMADS2 transcripts occur at high levels in developing lodicules and transcripts are at reduced levels in stamens. In fully differentiated lodicules, OsMADS2 transcripts are more abundant in the distal and peripheral regions of lodicules, which are the tissues that are severely affected in OsMADS2 knock-down florets (Prasad and Vijayraghavan, 2003). The onset of OsMADS4 expression is in very young floret meristems before organ primordia emergence and this is expressed before OsMADS2. In florets undergoing organogenesis, high level OsMADS4 expression occurs in stamens and carpels and transcripts are at low level in lodicules (Yadav, Prasad and Vijayraghvan, 2007). Thus, we show that these paralogous genes differ in the onset of their activation and their stable transcript distribution within lodicules and stamens that are the conserved expression domains for PI-like genes. Since the expression of OsMADS4 in OsMADS2 knock-down florets is normal, our results show OsMADS2 has unique functions in lodicule development. Thus our data show subfunctionalization of these paralogous rice PI-like genes. To identify target genes regulated by OsMADS2 that could contribute to lodicule differentiation, we have adopted whole genome transcript analysis of wild-type and dsRNAiOsMADS2 panicles with developing florets. This analysis has identified potential down-stream targets of OsMADS2 many of which encode transcription factors, components of cell division cycle and signalling factors whose activities likely control lodicule differentiation. The expression levels of few candidate targets of OsMADS2 were examined in various floret organs. Further, the spatial expression pattern for four of these down-stream targets of OsMADS2 was analysed and we find overlap with OsMADS2 expression domains (Yadav, Prasad and Vijayraghvan, 2007). The predicted functions of these OsMADS2 target genes can explain the regulation of growth and unique vascular differentiation of this short fleshy modified petal analog. OsMADS1, a rice E-class gene, is a master regulator of other transcription factors and auxin and cytokinin signalling pathways In Arabidopsis four redundant SEPALLATA factors (E-class) are co-activators of other floral organ fate determining MADS-domain factors (classes ABCD) and thus contribute to floral meristem and floral organ development (Krizek and Fletcher, 2005). Among the grass-specific sub-clade of SEP-like genes, rice OsMADS1 is the best characterized. Prior studies in our lab showed that OsMADS1 is expressed early throughout the floret meristem before organ primordia emergence and later is restricted to the developing lemma and palea primordia with weak expression in carpel (Prasad et al, 2001). Stable expression continues in these floret organs. OsMADS1 plays critical non-redundant functions to specify a determinate floret meristem and also regulates floret organ identities (Jeon et al., 2000; Prasad et al, 2001; 2005; Agarwal et al., 2005; Chen et al., 2006). In the present study, we have adopted two different functional genomic approaches to identify genes down-stream of OsMADS1 in order to understand its mechanism of action during floret development. We have studied global transcript profiles in WT and dsRNAiOsMADS1 panicles and find OsMADS1 is a master regulator of a significant fraction of the genome’s transcription factors and also a number of genes involved in hormone-dependent cell signalling. We have validated few representative genes for transcription factors as targets regulated by OsMADS1. In a complementary approach, we have determined the consequences of induced-ectopic over-expression of a OsMADS1:ΔGR fusion protein in shoot apical meristems of transgenic plants. Transcript levels for candidate target genes were assessed in induced tissues and compared to mock-treated meristems and also with meristems induced for OsMADS1:ΔGR but blocked for new protein synthesis. These analyses show that OsMADS55 expression is directly regulated by OsMADS1. Importantly, OsMADS55 is related to SVP that plays an important role in floral transition and floral meristem identity in Arabidopsis. OsHB3 and OsHB4, homeodomain transcription factors, with a probable role in meristem function, are also directly regulated by OsMADS1. The regulation of such genes by OsMADS1 can explain its role in floret meristem specification. In addition to regulating other transcription factors, OsMADS1 knock-down affects expression of genes encoding proteins in various steps of auxin and cytokinin signalling pathways. Our differential expression profiling showed OsMADS1 positively regulates the auxin signalling pathway and negatively regulates cytokinin mediated signalling events. Through our induced ectopic expression studies of OsMADS1:ΔGR, we show OsMADS1 directly regulates the expression of OsETTIN2, an auxin response transcription factor, during floret development. Overall, we demonstrate that OsMADS1 modulates hormonal pathways to execute its functions during floret development on the spikelet meristems. Functional studies of OsMGH3; an auxin-responsive indirect target of OsMADS1 To better understand the contribution of auxin signalling during floret development, we have functionally characterized OsMGH3, a down-stream indirect target of OsMADS1, which is a member of the auxin-responsive GH3 family. The members of this family are direct targets of auxin response factors (ARF) class of transcription factors. GH3-proteins inactivate cellular auxin by conjugating them with amino acids and thus regulate auxin homeostasis in Arabidopsis (Staswick et al., 2005). OsMGH3 expression in rice florets overlaps with that of OsMADS1 (Prasad et al, 2005). In this study, we have demonstrated the consequences of OsMGH3 over-expression and knock-down. The over-expression of OsMGH3 during vegetative development causes auxin-deficient phenotypes such as dwarfism and loss of apical dominance. Its over-expression in developing panicles that was obtained by driving its expression from tissue-specific promoters created short panicles with reduced branching. The latter is a phenotype similar to that observed upon over-expression of OsMADS1. In contrast, the down-regulation of endogenous OsMGH3 through RNA-interference produced auxin over-production phenotypes such as ectopic rooting from aerial nodes. Knock-down of OsMGH3 expression in florets affected carpel development and pollen viability both of which affect floret fertility. Taken together, this study provides evidence for the importance of auxin homeostasis and its transcriptional regulation during rice panicle branching and floret organ development. Our analysis of various conserved transcription factors during rice floret development suggest that factors like OsMADS2, OsMADS4 and OsMADS1 are master regulators of gene expression during floret meristem specification and organ development. The target genes regulated by these factors contribute to development of morphologically distinct rice florets.

The global re-emergence of TB and other mycobacterial infections have underscored the need for a thorough investigation of the biology of the causative agent, Mycobacterium tuberculosis, at the molecular level. The peculiar features of the bacterium such as slow growth rate, dormancy, unique cell wall composition and resistance towards phagocytosis by macrophages demands a detailed understanding of different essential molecular processes including transcription in this genus. Sequencing of several mycobacterial genomes provided an impetus for understanding the gene function and regulation of this formidable pathogen. Transcriptional regulation is one of the major mechanisms controlling gene expression. While a number of transcription units, promoters, sigma factors, and gene functions were identified and characterized, key features of transcription process are yet to be understood. The current study aims to understand some of the facets of transcription initiation and elongation in mycobacteria. The thesis is divided into five chapters. Chapter 1 introduces the bacterial transcription process. It starts with the description of the central molecule in transcription -the RNA polymerase (RNAP) and its catalytic mechanism. In the next section, each step of the transcription initiation, elongation and termination has been discussed. The mechanistic details as well as the different cellular factors involved in the regulation of the transcription have been discussed. The final part gives an overview of the transcription machinery of the mycobacteria, describing the promoter specificity and regulation of different sigma factors and other transcription factors known till date in mycobacteria. The scope and the objectives of the thesis are presented at the end of this chapter. In Chapter 2, a method of purification of RNAP from mycobacteria for optimized promoter -polymerase interactions is described. In vitro transcription analysis is important to understand the mechanism of transcription. Various assays for the analysis of initiation, elongation and termination form the basis for better understanding of the process. Purified RNAP with high specific activity is necessary to carry out a variety of these specific reactions. The RNAP purified from Mycobacterium smegmatis from exponential phase showed low σA-promoter specificity in promoter -polymerase interaction studies. This is due to the presence of a large number of sigma factors during exponential phase and under-representation of σA required for house - keeping transcription. In vivo reconstitution of RNAP holoenzyme with σA and its purification procedure which resulted in a holoenzyme with stoichiometric σA content is described in this chapter. The reconstituted holoenzyme showed enhanced promoter -specific binding and transcription activity compared to the enzyme isolated using standard procedure. Chapter 3 is aimed at the comparison of promoter - specific events during transcription initiation in mycobacteria. DNA -protein interactions that occur during transcription initiation play an important role in regulating gene expression. To initiate transcription, RNAP binds to promoters in a sequence -specific fashion. This is followed by a series of steps governed by the equilibrium binding and kinetic rate constants, which in turn determine the overall efficiency of the transcription process. The first detailed kinetic analysis of promoter - RNAP interactions during transcription initiation in the σA-dependent promoters PrrnAPCL1, PrrnB and Pgyr of M. smegmatis are presented in this chapter. The promoters show comparable equilibrium binding affinity but differ significantly in open complex formation, kinetics of isomerization and promoter clearance. Furthermore, the two rrn promoters exhibit varied kinetic properties during transcription initiation and appear to be subjected to different modes of regulation. In addition to the distinct kinetic patterns, each one of the house -keeping promoters studied has its own rate-limiting step in the initiation pathway, indicating the differences in their regulation. Moving the focus of the thesis from transcription initiation to elongation, a transcript cleavage factor of M. tuberculosis has been characterized in Chapter 4. After initiation of transcription, a number of proteins participate during elongation and termination by modifying the properties of the RNAP. Gre proteins are one such class of transcription elongation factors which are conserved across bacteria. They regulate transcription by binding near the secondary channel of RNAP, projecting their N-terminal coiled-coil domain into the active center and stimulating hydrolysis of the newly synthesized RNA by RNAP in the backtracked elongation complexes. Rv1080c is a putative gre factor homolog (MtbGre) present in M. tuberculosis.The protein enhanced the efficiency of promoter clearance by lowering the abortive transcription and also rescued the arrested and paused elongation complexes efficiently in the GC rich mycobacterial template. The Gre factor of M. smegmatis encoded by the gene MSMEG_5263 also showed biochemical properties similar to the M. tuberculosis protein. Although the mycobacterial Gre is similar in domain organization and shared the key residues for catalysis and RNAP interaction with Escherichia coli Gre proteins, it could not complement the E. coli strain deficient in Gre factors. Moreover, MtbGre failed to rescue E. coli RNAP stalled elongation complexes, indicating the importance of specific protein - protein interactions for transcript cleavage. Decrease in the level of MtbGre also reduced the bacterial survival by several fold indicating its essential role in mycobacteria and suggesting that a single Gre copes up with the burden of transcription fidelity of the genome. Chapter 5 describes the studies carried out to identify Gre factor homologs in mycobacteria and deciphering their function during transcription. Gre factors are members of a growing family of proteins which regulate RNAP through secondary channel. Apart from the Gre factor, putative members of this class of proteins are identified in both M. smegmatis and M. tuberculosis.The closest homologue of the canonical Gre factor of M. tuberculosis in its genome is Rv3788. The protein has Gre factor like domain organization and possess the key acidic residues required for transcript cleavage activity and the putative hydrophobic RNAP interacting residues in the C-terminus similar to MtbGre. Despite having these common features, Rv3788 did not stimulate transcript cleavage. In contrast, it turns out to be a transcription inhibitor by preventing the binding of NTPs to the enzyme. The transcription inhibition is not promoter specific, and is mediated by its binding to RNAP through the secondary channel with its N-terminus coiled coil domain. Like M. tuberculosis, the fast growing non-pathogenic mycobacteria M. smegmatis also has an ORF (MSMEG_6292) which is homologous to its canonical Gre factor and it interacts with RNAP in a similar manner. However, this protein did not exert any transcript cleavage or inhibitory activities but could compete with the Gre factor for binding to RNAP. The Gre factor homologs in mycobacteria may be involved in regulation by inhibiting transcription or by blocking the RNAP secondary channel from other RNAP active site modulators.

Desde a década de 80, o nucleopoliedrovírus Anticarsia gemmatalis (AgMNPV) tem sido utilizado no Brasil como agente de controle biológico no combate à lagarta-da-soja, resultando para o país significativos benefícios econômicos e ecológicos. Este vírus envelopado, pertencente à família Baculoviridae, possui DNA circular de fita dupla (132.239 pb) contido em um capsídeo protéico, que pode estar ocluído em uma matriz para-cristalina. Neste trabalho, analisamos a expressão temporal de seus genes em duas linhagens celulares (UFL-AG-286 e IPLB-SF-9), por PCR em tempo real. Outro objetivo foi o estudo do efeito da multiplicação viral na malha gênica celular (GRN), visando analisar a expressão gênica celular diferenciada durante a infecção, através da técnica de hibridização subtrativa. Verificamos que todas as ORFs (exceto ORFs 64 e 83, que provavelmente não codificam a genes) foram expressas, com diferenças significativas entre as linhagens, principalmente em relação ao nível de expressão. Apesar disso, o grupo de genes ligados a replicação apresentou perfil de expressão similar nas duas linhagens, possivelmente por este ser um processo essencial à replicação viral. De uma forma geral, todos os genes apresentaram um perfil de expressão mais precoce do que o relatado na literatura, o que poderia ser tanto devido à replicação precoce do DNA do AgMNPV quanto até mesmo consequência da sensitividade do método utilizado. O agrupamento dos genes por k-means seguiu, em sua maioria, a hora pós-infecção (p.i.) onde a expressão de cada gene foi detectada, o que é coerente com a expressão gênica em cascata de baculovírus. Entretanto, por esta classificação não foi possível predizer função gênica para os genes pouco caracterizados. Em relação ao efeito da infecção do AgMNPV na GRN da UFL-AG-286, observamos que em 20h p.i., uma grande diversidade de genes e funções celulares foram hipo-expressas. / Since the 80s, the Anticarsia gemmatalis nucleopolyhedroviruses (AgMNPV) has been used in Brazil as a biological control agent against the Anticarsia gemmatalis caterpillar in soybean fields, resulting in considerable economic and ecological benefits. This enveloped virus belongs to the Baculoviridae family. It has circular double-stranded DNA (132239 bp) enclosed in a capsid, which can be occluded in a crystalline matrix. In this work we elucidated the temporal gene expression profile of the AgMNPV-2D in two cell lines (UFL-AG-286 and IPLB-SF-9), using a real time PCR. Another objective was to study the effect of viral replication on the cellular gene regulatory network (GRN), in order to analyze the differential cellular gene expression during infection, using subtractive hybridization method. We found that most ORFs (except 64 and 83 ORFs that probably do not encode genes) were expressed, with significant differences between cell lines, mainly in expression intensity. However, the group of genes associated with viral DNA replication had similar expression profile in both lineages, possibly because replication is an essential process for viral multiplication. In general, most genes had earlier expression than reported in the literature, probably due to the early DNA replication in AgMNPV. Moreover, this could be a consequence of the method sensitivity used herein. We clustered genes with the k-means algorithm according to the time pos infection (p.i.) in which each gene expression was first detected and found it to be consistent with the typical cascade of gene expression known for baculovirus. Nonetheless, following this classification, it was not possible to predict gene function for poorly characterized genes. When looking at the impact of viral replication on the host GRN using subtractive hybridization, we found considerable inhibition of cellular transcription at 20h p.i. Furthermore at this time, a large and diverse set of cellular genes and functions were found to be hypo-regulated, indicative of an extensive effect of AgMNPV infection on the UFL-AG-286 GRN.

Escherichia coli enteropatogênica atípica (aEPEC) faz parte de um grupo de patógenos capazes de formar um tipo de lesão característica em cultura de tecidos epiteliais, denominada attaching and effacing (A/E). Os genes que são necessários para produção da lesão A/E estão localizados em uma ilha de patogenicidade denominada região LEE (locus of enterocyte effacement). A transcrição de genes da região LEE está sujeita a regulação por vários fatores, entre eles quorum sensing, termo utilizado para designar um mecanismo de regulação gênica dependente da concentração celular. Esse mecanismo é usado por bactérias Gram-positivas e Gram-negativas e em ambos os casos envolve a produção e detecção de moléculas sinalizadoras extracelulares, denominadas autoindutores. Até o momento, pelo menos quatro sistemas de quorum sensing foram descritos, entre eles o sistema de autoindutor AI-3 encontrado em bactérias Gram-positivas e Gram-negativas. Diversos mecanismos celulares, entre eles a expressão de fatores de virulência em amostras de EPEC e EHEC, são regulados por esse fenômeno. O principal objetivo deste estudo foi verificar se existe uma possível regulação por quorum sensing na interação in vitro de uma amostra de E. coli da microbiota intestinal com amostras de aEPEC. Após a confirmação da produção de AI-3 por amostras de E.coli da microbiota intestinal foram realizados ensaios de adesão e quantificação utilizando meio pré-condicionado com esta amostra, epinefrina e bloqueadores que confirmaram que os padrões de adesão de aEPEC obtidos em menor tempo são devidos a presença de AI-3 no meio pré-condicionado, indicando a participação de quorum sensing nessa interação. Além disso, foi observado um fenômeno citotóxico nas células que não é produzido pelo AI-3. / Atypical Enteropathogenic Escherichia coli (aEPEC) are part of a group of pathogens capable of forming a type of lesion characteristic of epithelial tissues in culture, called attaching and effacing (A/E). The genes that are required for production of A/E lesion are located in a pathogenicity island called LEE region (locus of enterocyte effacement). The transcription of LEE genes in the region is subject to regulation by various factors, including quorum sensing, a term used to describe a mechanism of gene regulation dependent on cell concentration. This mechanism is used by Gram-positive and Gram-negative and in both cases involves the production and detection of extracellular signaling molecules, called autoinducers. So far, four systems of quorum sensing have been described, including the system of autoinducers AI-3 found in Gram-positive and Gram-negative bacteria. Several cellular mechanisms, including expression of virulence factors in EPEC and EHEC are regulated by this phenomenon. The main objective of this study was to determine whether there is a possible regulation by quorum sensing in the in vitro interaction of a strains of E. coli of the intestinal microbiota with strains aEPEC. After confirming the production of AI-3 in E. coli of the intestinal microbiota were performed adhesion assays and quantification using means preconditioned with this strains, epinephrine, and blockers who confirmed that patterns of adherence of aEPEC obtained in less time are due to the presence of AI-3 in the preconditioned means, indicating the involvement of quorum sensing in this interaction. Furthermore, we observed a phenomenon that cytotoxic cells is not produced by AI-3.