A alga marinha Gracilaria tenuistipitata var. liui Zhang et Xia (Gracilariales, Rhodophyta) tem grande importância econômica por ser a principal fonte para a produção de ficocolóides. Esta linhagem tem sido extensivamente cultivada em tanques ou diretamente no mar na China e Taiwan por exibir grande tolerância a variação de fatores ambientais. A maior fonte de nitrogênio no oceano está na forma de nitrato que é o principal fator limitante no crescimento das macroalgas. A assimilação de nitrogênio é um processo que ocorre em duas etapas catalisadas sequencialmente pelas enzimas nitrato redutase (NR) e nitrito redutase (NiR), respectivamente. A NR catalisa a redução de nitrato a nitrito usando NAD(P)H como fonte doadora de elétrons. O nitrito é reduzido a amônio (pela NiR) e é imediatamente assimilado em compostos orgânicos nitrogenados, como aminoácidos e bases nitrogenadas. A NR é considerada o primeiro passo regulador no processo de assimilação de nitrato. Neste trabalho descrevemos a oscilação circadiana da atividade da NR bem como do seu conteúdo protéico em G. tenuistipitata. A atividade da NR e os níveis da proteína NR apresentam um pico no meio do dia em algas mantidas sob regime de claro:escuro (12:12h). A atividade de NR é 30 vezes maior durante o período de claro em algas crescendo sob condições de luz:escuro, e o nível protéico de NR é cerca de 40 vezes maior em extratos do período de claro. A oscilação observada está sob controle do relógio biológico uma vez que a flutuação da atividade da NR persiste após 10 dias sob condições de claro constante. Nenhuma oscilação na atividade de NR foi encontrada quando a alga foi mantida sob escuro constante, demonstrando que a luz é um fator de grande importância no controle desta enzima. Experimentos de absorção de nitrato do meio realizados em culturas de algas crescendo sob condições de claro:escuro mostrou que a absorção de nitrato ocorre preferencialmente no período noturno, ocorrendo o pico máximo de absorção no meio da noite. Daí concluirmos que os processos de assimilação de nitrato e tomada do mesmo do meio estejam ocorrendo de maneira independente. A NR de G. tenuistipitata pertence a classe das NRs específicas para o NADH, com constante de Michaelis-Menten aparente de 95 µM. O KM aparente para o nitrato foi estimado em 197 µM, valor esse razoável com os descritos para outras algas. A focalização isoelétrica revelou que a NR é uma proteína básica com pI de 8,66. A NR desta espécie foi purificada em 4 etapas: cromatografia de troca iônica, precipitação com sulfato de amônio, filtração em gel e cromatografia de afinidade em resina Affigel-blue. A proteína não desnaturada apresenta massa molecular de aproximadamente 420 kDa, e 4 subunidades idênticas de 110 kDa, baseado em SDS-PAGE. A localização intracelular da NR de G. tenuistipitata foi examinada utilizando técnicas de imunofluorescência e \"immuno-gold\" e revelaram que a NR está associada com os cloroplastos. / The marine red alga Gracilaria tenuistipitata var. liui Zhang et Xia) is economically important, being the main source for the production of phycocolloids. This strain is extensively cultivated in ponds in southern China and Taiwan and exhibits a wide tolerance to environmental factors. The major source of nitrogen in the ocean is in the form of nitrate being the main limiting macroalgal production. The nitrogen assimilation process occurs in a two-step reaction catalyzed by 2 enzymes working sequentially, nitrate reductase (NR) and nitrite reductase (NiR). NR catalyzes the reduction of nitrate to nitrite using NAD(P)H as electron donor. Nitrite is reduced to ammonium (by NiR) and it is immediately assimilated in organic nitrogen compounds, such as amino acids and bases. NR is considered the first and regulatory step in this assimilating process. We report the circadian oscillation of NR activity as well as NR protein content in G. tenuistipitata. Both NR activity and NR protein levels peaks at midday in algae maintained under light:dark cycle (12:12h). Toe NR activity is 30 fold higher in light period for alga growing under light-dark conditions, and the NR protein level is about 40 fold higher in extracts from the light period. The oscillation observed is under biological clock control since the fluctuation of NR activity persists after 10 days under constant light conditions. No oscillation in the NR activity is found when the algae were maintained under constant dark condition. The experiments on nitrate uptake carried out in algae growing under light:dark conditions had shown that the absorption peaks at the middle of the dark periods. So we can conclude that the process of nitrate assimilation and nitrate uptake is occurring in such an independent ways. NR from G. tenuistipitata is a NADH specific enzyme with Michaelis-Menten apparent constant of 95 µM. Toe apparent KM for nitrate was estimated to be 197 µM, which is reasonable with the values described to another algae. The isoeletric focusing revealed NR is a basic protein with pi of 8.66. The NR from was purified in four steps: ion exchange chromatography, ammonium sulfate precipitation, gel filtration chromatography, and Affigel-blue affinity column. Non-denaturated protein shows a molecular mass of about 420 kDa, and 4 identical subunits of 110 kDa, based on SDS-PAGE. Toe intracellular localization of NR in G. tenuistipitata was examined by applying both immunofluorescence and immunogold methods revealing NR associated with chloroplasts.

Vários laboratórios descreveram moléculas que estão envolvidas na invasão do Trypanosoma cruzi à célula hospedeira. Nosso laboratório foi o primeiro a descrever moléculas de 85 kDa pertencentes a uma família de glicoproteínas (Tc-85) que possuem graus diferentes de homologia de seqüência com os membros da superfamília das gp85/transialidases. Um componente acídico (Tc85-11) da família Tc-85 que se liga à laminina e a receptores da célula hospedeira foi clonado e expresso (Giordano et al., JBC 274, 3461,1999). Nós levantamos a hipótese de que o polimorfismo dos diferentes membros da família Tc-85 poderiam determinar diferentes propriedades da adesão à célula hospedeira. Para provar tal hipótese, uma biblioteca genômica de Tc-85 utilizando o vetor pTEX e os seguintes primers: R-1 (5\') ATGTCCCGGCGTGTGTTTACTTCC e GPI-2(3\') TCACAAAGTCGCAAAGCCCCACAGTCC, foi digerida com enzimas de restrição resultando em fragmentos de tamanho esperado (~2-2,5 kb) em 91% dos clones selecionados. Treze clones foram seqüenciados em suas extremidades 5\' e 3\'. Nenhum era idêntico entre si apesar da variabilidade da homologia de seqüência (40-70%). No entanto, quando comparadas as regiões codantes para o peptídeo sinal foi encontrada uma homologia de 90%. Para assegurar a clonagem de genes funcionais, uma biblioteca de cDNA foi construída com primers degenerados (5\'-ATTTTTGTTCCGCAGAAGACGCAGGTG, 3\'ATTCAGTGGGCGGTTGTACAGAAAGAC) por transcrição reversa de seqüências conservadas da superfamília das gp85/transialidases, excluindo a seqüência codante para o peptídeo sinal e a seqüência codante para âncora de GPI (presença de aminoácidos hidrofóbicos). Os cDNAs foram amplificados e clonados no vetor de expressão pCR®T7/NT-TOPO. Foram selecionados 60 clones que foram submetidos à análise de restrição e 90% deles mostraram fragmentos com tamanho esperado. As proteínas de fusão de 4 destes clones foram reconhecidas em Western blot por um anticorpo policlonal feito contra um fragmento da Tc85-11 (H3.3). As seqüências obtidas da extremidade 5\' revelou que os quatro clones pertencem à superfamília das gp85/transialidase (GenBank). O alinhamento destas seqüências com a Tc85-11 mostrou uma homologia de 60-80% e uma identidade de 40-70% na seqüência de aminoácidos. Estes dados confirmam a heterogeneidade da família da Tc-85 que é expressa pelo parasita. Ademais, a expressão de elevadas quantidades das proteínas correspondentes permitirá a identificação dos ligantes respectivos para estas proteínas de superfície específicas de tripomastigotas. / Several laboratories described molecules that are involved in Trypanosoma cruzi invasion of host-cells. Our laboratory was the first to describe molecules of 85 kDa belonging to a glycoprotein family (Tc-85) having different degrees of sequence homology with the members of the gp85/trans-sialidase supergene family. An acidic component (Tc85-11) of the Tc-85 family that binds to laminin and to host-cell receptors was cloned and expressed (Giordano et al., JBC 274, 3461, 1999). We raised the hypothesis that the polymorphism of different members of the Tc-85 family could specify different adhesion properties to host proteins. In order to prove the hypothesis, a genomic Iibrary of Tc-85 using the pTEX vector and primers R-1 (5\') ATGTCCCGGCGTGTGTTTACTTCC and GPI-2 (3\') TCACAAAGTCGCAAAGCCCCACAGTCC was cut with restriction enzymes resulting in fragments of the expected size (~2-2.5 kb) in 91% of the clones. Thirteen clones were sequenced from their 5\' and 3\' terminal ends. None were identical in spite of a variable sequence homology (40-70%), as opposed to 90% of homology when the signal peptide coding regions were compared. In order to assure the cloning of functional genes, a cDNA Iibrary was constructed with degenerated primers ((5\') ATTTTTGTTCCGCAGAAGACGCAGGTG / (3\') ATTCAGTGGGCGGTTGTACAGAAAGAC) for reverse transcription of conserved sequences from the gp85/trans-sialidase supergene family excluding the hydrophobic sequences from both extremities. The cDNAs were amplified by PCR and cloned into pCR ®T7/NT-TOPO expression vector. 60 clones were selected and were subjected to restriction analysis and 90% of the clones showed fragments with the expected size. The expressed fusion proteins of 4 of these clones were recognized in Western blots by a polyclonal antibody raised against a fragment of Tc85-11 (H3.3). The sequences obtained from the 5\' termini revealed that all four clones belong to the gp85/trans-sialidase supergene family (GenBank TM). The alignment of these sequences with Tc85-11 showed a homology of 60-80% and an identity of 40-70% in aminoacid sequence. These data confirm the heterogeneity of the Tc-85 family that is expressed by the parasite. Additionally, the expression of high amounts of the corresponding proteins will allow the identification of putative Iigands for these trypomastigote specific surface proteins.

Beta-Amyloid (1-40) (Aβ40) is an aggregation prone protein, which undergoes a nucleation-dependent aggregation process causing the pathological neurodegeneration by amyloid plaque formation implicated in Alzheimer’s disease. In this thesis, we investigated the effects of small molecule modulators extracted from the marine invertebrate Pseudopterogorgia elisabethae on the Aβ40 amyloidogenic process using in- vitro ThT fluorescence assay and atomic force microscopy. We also investigated the effects of neutral and anionic phospholipid liposomes on Aβ40 aggregation. Our results show that a marine natural product Pseudopterosin-A and its derivatives can suppress and modulate the Aβ40 aggregation process. Furthermore, our results demonstrate that a neutral phospholipid liposome inhibits Aβ40 fibril formation, whereas the anionic liposomes promote it. / Includes bibliography. / Thesis (M.S.)--Florida Atlantic University, 2015 / FAU Electronic Theses and Dissertations Collection

No presente trabalho analisou-se um total de 101 indivíduos, sendo 26 não infectados e 75 infectados pelo HIV e classificados de acordo com o Walter Reed Army Institute (28 pacientes WR 1, 31 pacientes WR 2 e 16 pacientes WR 3/4). 05 indivíduos infectados pelo HIV apresentaram, nos estágios iniciais, uma diminuição progressiva do peso corporal, dos níveis séricos de uréia, albumina, colesterol total, HOL colesterol e LOL colesterol. Já os níveis séricos de proteínas totais, globulinas, IgG, IgA, α1 glicoproteína ácida, haptoglobina e as atividades enzimáticas da AST e da LD apresentaram elevação nos indivíduos infectados e em conseqüência da evolução da infecção. Os triglicérides demonstraram apenas tendência para aumento dos níveis séricos nos indivíduos estadiados como WR3/4. Os níveis de ferro sérico encontraram-se diminuídos nos indivíduos estadiados como WR 3/4, enquanto que a concentração de transferrina apresentou-se diminuída apenas no Grupo WR 2. Houve uma tendência para a elevação progressiva dos níveis médios de ferritina com a evolução da doença. Nenhuma alteração foi verificada nos níveis de proteína \"C\" reativa. A EC-SOO apresentou diminuição dos níveis de atividade nos indivíduos infectados pelo HIV, enquanto que em células mononucleares a SOD apresentou atividade diminuída nos indivíduos estadiados como WR 3/4. A GSH-Px não apresentou alteração de sua atividade em decorrência da infecção pelo HIV. Os níveis plasmáticos do α-tocoferol e do ascorbato apresentaram tendência para diminuição, enquanto o β-caroteno não apresentou alteração nos grupos estudados. Estes resultados sugerem que a haptoglobina, as globulinas e a IgA podem ser utilizadas para a avaliação da evolução da infecção pelo HIV. Por outro lado, os níveis dos constituintes do sistema de defesa antioxidante analisados indicam que os indivíduos soropositivos encontram-se menos protegidos contra a ação de espécies reativas de oxigênio, o que favoreceria a presença de um estresse oxidativo e a replicação viral. / A total number of 101 individuals, including 26 controls and 75 patients classified according to the Walter Reed Army Institute (28 WR 1, 31 WR 2 and 16 WR 3/4) was studied. HIV infected individuals presented, during the early stages, a progressive reduction of body weigth, as well as urea, albumin, total cholesterol, HDL cholesterol and LDL cholesterol in blood serum. However, increased serum levels of total protein, globulin, IgG, IgA, α1 acid glycoprotein, haptoglobin, AST and LD were observed in HIV infected individuals during the evolution of infection. Decreased serum iron and a trend for increasing triglyceride was shown only for those individuals classified as WR 3/4. Transferrin was diminished only in the WR 2 group. A trend for enhancing serum ferritin following the progession of HIV infection was also observed. No alteration was observed on the levels of reactive \"C\" protein. Decreased EC-SOD activities were observed in HIV infected individuals as compared to controls, whereas in mononuclear cells the SOD activity was diminished only in WR 3/4 patients. HIV infection did not alter GSH-Px activity. A trend for decreasing α-tocopherol and ascorbate plasma levels was shown during the evolution of HIV infected patients, while no difference was observed for β-carotene levels in the studied groups. The above results suggest that haptoglobin, globulins and IgA can be used to assess the evolution of the HIV infection. Moreover, the decreased levels of the antioxidant defense system components observed in HIV infected patients may indicate that they are under an oxidative stress that could favor HIV replication.

We are interested in understanding the molecular mechanisms that govern synaptic growth and plasticity. Recent evidence from several laboratories suggests that small GTPases play an important role in the promotion of neurite outgrowth; however, their role in the control of synaptic growth and functional plasticity is not well understood. The goal of this thesis is to investigate the role of small GTPases (including Rac, Rho and Cdc42) in the regulation of synaptic growth in vivo, using the Drosophila larval neuromuscular junction (NMJ) synapses as a model system. Our results show that presynaptic overexpression of Rac, but not of Rho or Cdc42, positively regulates both synaptic structure and function. Genetic loss of Rac leads to embryonic lethality, making it impossible to assess the full loss-of-function phenotype using conventional mutants. To circumvent this, we use the MARCM (Mosaic Analysis with a Repressible Cell Marker) technique to generate single motor neuron clones devoid of all genetic copies of Rac. Our data suggest that Rac activity is crucial for normal synaptic development. In support of this conclusion, we demonstrate that genetic removal of trio, a guanine nucleotide exchange factor (GEF) that is known to activate Rac, leads to a drastic reduction in the number of synaptic boutons. In addition, genetic removal of one copy of trio is sufficient to suppress the gain-of-function phenotype of Rac. Moreover, we demonstrate that partial removal of the fragile X mental retardation gene (dfmr1), a known suppressor of Rac, enhances the gain-of-function phenotype of Rac. Taken together, our findings support a model in which Rac signaling positively regulates synaptic growth and function at the Drosophila larval NMJ.

In experimental membranous nephropathy, complement C5b-9-induced glomerular epithelial cell (GEC) injury leads to breakdown of glomerular peimselectivity and proteinuria. This study addresses mechanisms that limit complement-mediated injury, focusing on Ras. Complement-mediated injury was attenuated in cultured GEC expressing a constitutively active form of Ras (V12Ras), compared with Neo (control) GEC. V12Ras GEC showed constitutive activation of phosphatidylinositol 3-kinase and extracellular signal-regulated kinase pathways, but inhibition of these pathways did not reverse the protective effect of Ras. V12Ras GEC showed smaller and rounder morphology, decreased F- to G-actin ratio, decreased activity of the Rho GTPase, Rac, and decreased Src activity. In V12Ras GEC, disruption or stabilization of the F-actin cytoskeleton reversed the protective effect of V12Ras on complement-mediated injury. Thus, the protective effect of V12Ras may be dependent on remodeling of the actin cytoskeleton. Furthermore, the reduction of Src activity due to Ras activation may alter the equilibrium in activities of Rho GTPases, a family of proteins known regulate the actin cytoskeleton. Activation of Ras signaling is a novel pathway to consider in developing strategies for cytoprotection in complement-mediated injury.

Environmental and genetic factors contribute to the development of schizophrenia. For example, epidemiological evidence has linked infections during pregnancy with increased incidence of schizophrenia in the adult offspring. At the same time mutation to DISC1, a protein involved in neurone migration and synaptic plasticity, is an important genetic risk for the disorder. Accordingly, the aim of this project was to determine if these environmental and genetic influences converge along a common pathogenic pathway leading to schizophrenia. Using a model of prenatal infection by bacterial endotoxin in rodents, we demonstrated a 50% reduction in DISC1 protein expression in the hippocampus and cortex of juvenile offspring. In addition, we found a significant induction of prostaglandins (final mediators of the inflammatory process) in the fetal brain while many cytokines remained unaltered. Taken together our results identify prostaglandins as potential mediators of the teratogenic effects of prenatal infection and show that prenatal infection itself can affect systems related to genetic risk factors for schizophrenia, in this case DISC1.

Vários laboratórios descreveram moléculas que estão envolvidas na invasão do Trypanosoma cruzi à célula hospedeira. Nosso laboratório foi o primeiro a descrever moléculas de 85 kDa pertencentes a uma família de glicoproteínas (Tc-85) que possuem graus diferentes de homologia de seqüência com os membros da superfamília das gp85/transialidases. Um componente acídico (Tc85-11) da família Tc-85 que se liga à laminina e a receptores da célula hospedeira foi clonado e expresso (Giordano et al., JBC 274, 3461,1999). Nós levantamos a hipótese de que o polimorfismo dos diferentes membros da família Tc-85 poderiam determinar diferentes propriedades da adesão à célula hospedeira. Para provar tal hipótese, uma biblioteca genômica de Tc-85 utilizando o vetor pTEX e os seguintes primers: R-1 (5\') ATGTCCCGGCGTGTGTTTACTTCC e GPI-2(3\') TCACAAAGTCGCAAAGCCCCACAGTCC, foi digerida com enzimas de restrição resultando em fragmentos de tamanho esperado (~2-2,5 kb) em 91% dos clones selecionados. Treze clones foram seqüenciados em suas extremidades 5\' e 3\'. Nenhum era idêntico entre si apesar da variabilidade da homologia de seqüência (40-70%). No entanto, quando comparadas as regiões codantes para o peptídeo sinal foi encontrada uma homologia de 90%. Para assegurar a clonagem de genes funcionais, uma biblioteca de cDNA foi construída com primers degenerados (5\'-ATTTTTGTTCCGCAGAAGACGCAGGTG, 3\'ATTCAGTGGGCGGTTGTACAGAAAGAC) por transcrição reversa de seqüências conservadas da superfamília das gp85/transialidases, excluindo a seqüência codante para o peptídeo sinal e a seqüência codante para âncora de GPI (presença de aminoácidos hidrofóbicos). Os cDNAs foram amplificados e clonados no vetor de expressão pCR®T7/NT-TOPO. Foram selecionados 60 clones que foram submetidos à análise de restrição e 90% deles mostraram fragmentos com tamanho esperado. As proteínas de fusão de 4 destes clones foram reconhecidas em Western blot por um anticorpo policlonal feito contra um fragmento da Tc85-11 (H3.3). As seqüências obtidas da extremidade 5\' revelou que os quatro clones pertencem à superfamília das gp85/transialidase (GenBank). O alinhamento destas seqüências com a Tc85-11 mostrou uma homologia de 60-80% e uma identidade de 40-70% na seqüência de aminoácidos. Estes dados confirmam a heterogeneidade da família da Tc-85 que é expressa pelo parasita. Ademais, a expressão de elevadas quantidades das proteínas correspondentes permitirá a identificação dos ligantes respectivos para estas proteínas de superfície específicas de tripomastigotas. / Several laboratories described molecules that are involved in Trypanosoma cruzi invasion of host-cells. Our laboratory was the first to describe molecules of 85 kDa belonging to a glycoprotein family (Tc-85) having different degrees of sequence homology with the members of the gp85/trans-sialidase supergene family. An acidic component (Tc85-11) of the Tc-85 family that binds to laminin and to host-cell receptors was cloned and expressed (Giordano et al., JBC 274, 3461, 1999). We raised the hypothesis that the polymorphism of different members of the Tc-85 family could specify different adhesion properties to host proteins. In order to prove the hypothesis, a genomic Iibrary of Tc-85 using the pTEX vector and primers R-1 (5\') ATGTCCCGGCGTGTGTTTACTTCC and GPI-2 (3\') TCACAAAGTCGCAAAGCCCCACAGTCC was cut with restriction enzymes resulting in fragments of the expected size (~2-2.5 kb) in 91% of the clones. Thirteen clones were sequenced from their 5\' and 3\' terminal ends. None were identical in spite of a variable sequence homology (40-70%), as opposed to 90% of homology when the signal peptide coding regions were compared. In order to assure the cloning of functional genes, a cDNA Iibrary was constructed with degenerated primers ((5\') ATTTTTGTTCCGCAGAAGACGCAGGTG / (3\') ATTCAGTGGGCGGTTGTACAGAAAGAC) for reverse transcription of conserved sequences from the gp85/trans-sialidase supergene family excluding the hydrophobic sequences from both extremities. The cDNAs were amplified by PCR and cloned into pCR ®T7/NT-TOPO expression vector. 60 clones were selected and were subjected to restriction analysis and 90% of the clones showed fragments with the expected size. The expressed fusion proteins of 4 of these clones were recognized in Western blots by a polyclonal antibody raised against a fragment of Tc85-11 (H3.3). The sequences obtained from the 5\' termini revealed that all four clones belong to the gp85/trans-sialidase supergene family (GenBank TM). The alignment of these sequences with Tc85-11 showed a homology of 60-80% and an identity of 40-70% in aminoacid sequence. These data confirm the heterogeneity of the Tc-85 family that is expressed by the parasite. Additionally, the expression of high amounts of the corresponding proteins will allow the identification of putative Iigands for these trypomastigote specific surface proteins.

Orientador: Maria Cristina Cintra Gomes Marcondes / Dissertação (mestrado) - Universidade Estadual de Campinas, Instituto de Biologia / Made available in DSpace on 2018-08-19T11:32:15Z (GMT). No. of bitstreams: 1 Pertile_Tatiane_M.pdf: 1613871 bytes, checksum: 2d715c00e32e2a411050801a7a1ac95f (MD5) Previous issue date: 2011 / Resumo: O câncer pode promover a morte do hospedeiro, pois durante sua evolução há modificações da homeostasia dos processos metabólicos, promovendo profundas alterações caracterizadas como caquexia, que por sua vez relaciona-se à diminuição da qualidade e do tempo de vida do hospedeiro. Assim, no presente estudo, analisamos os efeitos da evolução do crescimento de neoplasia - carcinossarcoma de Walker 256 - em ratos jovens e adultos e os efeitos modulatórios do tratamento desses animais com EPA (ácido eicosapentaenóico) sobre o processo de caquexia e a concentração de citocinas anti e proinflamatórias no músculo gastrocnêmio, pois o tecido muscular é o tecido mais afetado no processo de caquexia. Foram utilizados 108 ratos Wistar machos, com idade de 30 dias (jovens) e 100 dias (adultos), os quais foram distribuídos de acordo com o local de implante tumoral, intraperitônio e subcutâneo, e tratamento ou não com ácido eicosapentaenóico, 100?g/Kg de peso corpóreo. Os animais receberam gavagem diária do EPA (animais tratados) ou de óleo mineral (grupos sem tratamento) até a fase pré-agônica. A partir dos órgãos coletados, foram calculados o ganho de peso corpóreo, os pesos relativos de cada órgão, do tumor e da carcaça. Com o objetivo de identificarmos a via de degradação protéica predominante nos grupos experimentais, foram avaliados, no tecido muscular, o teor de proteína muscular total e as atividades das seguintes enzimas: chymotrypsin-like, catepsinas B e H, calpaína e fosfatase alcalina,. A partir do sangue desses animais foram feitas análises fluorimétricas do fator de crescimento semelhante à insulina (IGF) e das citocinas - interleucinas 4 (IL-4), 6 (IL-6) e 10 (IL-10), interferon gama (INF-?) e leptina, utilizando-se kits específicos para citômetro de fluxo de fluorescência (Luminex). Também foi analisada a expressão gênica, no tecido muscular, por reação em cadeia da polimerase em tempo real (PCR-RT), para a via proteossômica e também para os fatores eucarióticos de inicialização. Os dados indicam efeitos modulatórios do EPA sobre o tecido muscular (manutenção da proteína e do peso), principalmente para os grupos jovens, e também no processo inflamatório crônico (aumento de citocinas pró e antiinflamatórias). Entretanto, efeitos mais expressivos do EPA não foram verificados na prevenção da espoliação de gordura (gordura perirrenal e leptina), no processo de síntese protéica (manutenção da expressão gênica de fatores eucarióticos de inicialização) ou também sobre a via proteossômica / Abstract: Cancer can promotes the host death, because during its evolution there are modifications in metabolic processes of homeostasis, promoting deep changes characterized as cachexia, which in turn relates with reduction in quality and lifetime of the host. Thus, in this study, we analyze the effects of development in Walker 256 carcinoma evolution - in young and adults rats and the modulatory effect of treatment with EPA (eicosapentaenoic acid) in gastrocnemius muscle as this tissue is the most affected in the cachexia process. Wistar males rats were used (n=108 animals), 30 days-old (young) and 100 days-old (adults), which were distributed according to the tumour implant, intraperitoneally and subcutaneously and treatment or not with eicosapentaenoic acid, 100 ?g/Kg of body weight. The animals receive daily EPA by gavage (treated animals) or nujol (sham groups) and were cared up to pre-agonic state. The bodies weight were measured and the body weight gain was calculated, as well the relative weights of tissues, tumour, and carcass. In order to identify the predominant pathway of protein degradation the total muscle protein content and proteolytic enzymes activities (chymotrypsin-like, cathepsin B and H, calpain and alkaline phosphatase) were measured in gastrocnemius muscle. The blood samples were assessed to measure the insulin-like growth factor 1 (IGF-1), leptin and the cytokines - interleukins (IL-4), 6 (IL-6) and 10 (IL-10), gamma interferon (INF-?), using specific kits for cytometer fluorescence (Luminex). It was also examined gene expression, in the muscle tissue, by real-time polymerase chain reaction (RT-PCR), assessing keys of ubiquitin-proteasome pathway and also on the eukaryotic initiation factors. The data indicated some modulatory effects of EPA on the muscle tissue (maintenance of protein and weight), mainly for the young rats, and also the chronic inflammatory process. However, more expressive effects of EPA have not been verified as preventing fat wasting (perirenal fat and leptin), nor in the process of protein synthesis (maintenance of eukaryotic initiating factors gene expression) or also in the ubiquitin-proteasome via / Mestrado / Fisiologia / Mestre em Biologia Funcional e Molecular

No presente trabalho analisou-se um total de 101 indivíduos, sendo 26 não infectados e 75 infectados pelo HIV e classificados de acordo com o Walter Reed Army Institute (28 pacientes WR 1, 31 pacientes WR 2 e 16 pacientes WR 3/4). 05 indivíduos infectados pelo HIV apresentaram, nos estágios iniciais, uma diminuição progressiva do peso corporal, dos níveis séricos de uréia, albumina, colesterol total, HOL colesterol e LOL colesterol. Já os níveis séricos de proteínas totais, globulinas, IgG, IgA, α1 glicoproteína ácida, haptoglobina e as atividades enzimáticas da AST e da LD apresentaram elevação nos indivíduos infectados e em conseqüência da evolução da infecção. Os triglicérides demonstraram apenas tendência para aumento dos níveis séricos nos indivíduos estadiados como WR3/4. Os níveis de ferro sérico encontraram-se diminuídos nos indivíduos estadiados como WR 3/4, enquanto que a concentração de transferrina apresentou-se diminuída apenas no Grupo WR 2. Houve uma tendência para a elevação progressiva dos níveis médios de ferritina com a evolução da doença. Nenhuma alteração foi verificada nos níveis de proteína \"C\" reativa. A EC-SOO apresentou diminuição dos níveis de atividade nos indivíduos infectados pelo HIV, enquanto que em células mononucleares a SOD apresentou atividade diminuída nos indivíduos estadiados como WR 3/4. A GSH-Px não apresentou alteração de sua atividade em decorrência da infecção pelo HIV. Os níveis plasmáticos do α-tocoferol e do ascorbato apresentaram tendência para diminuição, enquanto o β-caroteno não apresentou alteração nos grupos estudados. Estes resultados sugerem que a haptoglobina, as globulinas e a IgA podem ser utilizadas para a avaliação da evolução da infecção pelo HIV. Por outro lado, os níveis dos constituintes do sistema de defesa antioxidante analisados indicam que os indivíduos soropositivos encontram-se menos protegidos contra a ação de espécies reativas de oxigênio, o que favoreceria a presença de um estresse oxidativo e a replicação viral. / A total number of 101 individuals, including 26 controls and 75 patients classified according to the Walter Reed Army Institute (28 WR 1, 31 WR 2 and 16 WR 3/4) was studied. HIV infected individuals presented, during the early stages, a progressive reduction of body weigth, as well as urea, albumin, total cholesterol, HDL cholesterol and LDL cholesterol in blood serum. However, increased serum levels of total protein, globulin, IgG, IgA, α1 acid glycoprotein, haptoglobin, AST and LD were observed in HIV infected individuals during the evolution of infection. Decreased serum iron and a trend for increasing triglyceride was shown only for those individuals classified as WR 3/4. Transferrin was diminished only in the WR 2 group. A trend for enhancing serum ferritin following the progession of HIV infection was also observed. No alteration was observed on the levels of reactive \"C\" protein. Decreased EC-SOD activities were observed in HIV infected individuals as compared to controls, whereas in mononuclear cells the SOD activity was diminished only in WR 3/4 patients. HIV infection did not alter GSH-Px activity. A trend for decreasing α-tocopherol and ascorbate plasma levels was shown during the evolution of HIV infected patients, while no difference was observed for β-carotene levels in the studied groups. The above results suggest that haptoglobin, globulins and IgA can be used to assess the evolution of the HIV infection. Moreover, the decreased levels of the antioxidant defense system components observed in HIV infected patients may indicate that they are under an oxidative stress that could favor HIV replication.