No description available.

Made available in DSpace on 2013-08-07T19:09:25Z (GMT). No. of bitstreams: 1 000437839-Texto+Completo-0.pdf: 1986654 bytes, checksum: 1df17187443f6f4e556f999cb553466b (MD5) Previous issue date: 2012 / This study examines the course of Psychology and Neuroscience considering the centrality of the discourse of the brain in contemporary. Supported by the archaeological and genealogical thought of Michel Foucault, it tries to visualize the relationships between these two fields of knowledge from mapping an apparatus of the brain. There is the convergence of two lines of analysis throughout this thesis: the disciplinarization of Psychology and problematization of subjectivity. The first line seeks to map the conditions of emergency for the formation of a scientific Psychology, understanding that it has been maintained on the discourses of clinic and interiority. This map followed mainly the practice of interiorization and exteriorization of subjectivity, which made possible to delineate the displacement in the vectors of clinic and interiority which articulates Psychology as a scientific field. The second line, intended to map processes of subjectivation and thus interrogate the idea of a theory of the subject. Moreover, the lines that made up the internal and external processes of subjectivation are a field for the emergence of what I would call extended subjectivity. The practices of extension of subjectivity, as a new territory of constitution of self-knowledge of the subject, also finds a converging field with Social Psychology. / Este estudo analisa os rumos da Psicologia com as Neurociências considerando a centralidade do discurso do cérebro na contemporaneidade. Tendo como suporte o pensamento arquegenealógico de Michel Foucault, procurou-se visibilizar as relações entre os dois campos de saber a partir do mapeamento de um dispositivo do cérebro. Encontra-se a convergência de dois eixos de análise ao longo do trabalho: da disciplinarização da Psicologia e da problematização da subjetividade. O primeiro, procurou mapear as condições de emergência para a constituição de uma Psicologia científica, entendendo que ela passa a se sustentar sobre os discursos da clínica e da interioridade. Neste mapeamento, acompanhou-se principalmente as práticas de interiorização e de exteriorização da subjetividade, tornando-se possível delinear os deslocamentos nos vetores da clínica e da interioridade que articulam a Psicologia enquanto ciência. O segundo eixo, pretendeu mapear os processos de subjetivação e com isso desfazer a ideia de uma teoria do sujeito. Além disso, as linhas que compõe os processos de subjetivação interior e exterior constituem um campo para a emergência do que denominou-se como subjetividade estendida. As práticas de extensão da subjetividade, como um novo território de constituição do conhecimento de si do sujeito, também encontra um campo de convergência com a Psicologia Social.

O envelhecimento é um fator de risco para o desenvolvimento de alterações estruturais e funcionais associadas a doenças neurodegenerativas. A perda de neurônios em conjunto com alterações das conexões neurais, principalmente no hipocampo, tem sido associada ao declínio cognitivo no envelhecimento, e várias alterações neuroquímicas moduladas pela ação de hormônios neuroendócrinos parecem participar desse processo. Realmente, prejuízos na sinalização cerebral de insulina têm sido envolvidos na etiologia dos prejuízos cognitivos e de doenças neurodegenerativas. O objetivo desse estudo foi avaliar os efeitos da administração intracerebroventricular (ICV) de insulina na memória espacial, plasticidade mitocondrial e de células neurais. Ratos Wistar machos (jovens: 4 meses e velhos: 24-26 meses; n=10-12) foram tratados com insulina ICV (20mU) ou veículo uma vez ao dia durante 5 dias. A insulina aumentou os níveis extracelulares de lactato no hipocampo de animais jovens, mas não nos animais velhos. A produção de H2O2 mitocondrial, estimulada por succinato, diminuiu no grupo velho-insulina, em relação aos outros grupos. Além disso, o imunoconteúdo da proteína estimuladora de biogênese, PGC1-α, aumentou em animais jovens tratados com insulina. A insulina também melhorou o desempenho dos animais jovens na tarefa do Labirinto Aquático de Morris e aumentou os níveis hipocampais de BDNF nesses animais. A insulina modulou de maneira distinta a morfologia das subregiões CA1, CA3 e GD em animais jovens e velhos, mas aumentou a neurogênese em CA1 e CA3 somente nos animais velhos. Em resumo, o envelhecimento diminuiu a sensibilidade hipocampal à insulina no que se refere ao metabolismo do lactato, biogênese, BDNF e neuroplasticidade (número de células neurais e neurogênese). Entretanto, a administração de insulina ICV foi efetiva em aumentar a neuroplasticidade hipocampal no envelhecimento. / Aging is a risk factor for the development of brain structural and functional alterations associated with neurodegenerative disorders. The loss of neuronal cells along with the disruption of neural systems, mostly in the hippocampus, has been implicated in the cognitive decline associated with aging. A multitude of neurochemical changes modulated by neuroendocrine hormones may participate in this process. Indeed, impaired brain insulin/insulin receptor (IR) signaling that occurs through central insulin resistance is involved in the etiology of cognitive dysfunction and neurodegenerative disorders. The main goal of this study was to assess the effects of intracerebroventricular (ICV) insulin on spatial memory and mitochondrial and neural plasticity in aged rats. Male Wistar rats (young: 4 months and aged: 24-26 months; n= 10-12) were given ICV injections of insulin (20 mU) or vehicle daily over the course of five days. Insulin significantly increased extracellular fluid lactate levels in the hippocampus of young but not in aged rats. Mitochondrial H2O2 production induced by succinate was decreased in aged-insulin group relative to other groups. In addition, the immunocontent of mitochondrial PGC1-α, a biogenesis-stimulate protein, was increased by insulin administration in young animals. Insulin ICV improved spatial memory in the Water Maze task and hippocampal BDNF levels only in young animals. Insulin differentially modulated the hippocampal CA1, CA3 and DG morphology of young and aged rats but increased neurogenesis in CA1 and CA3 regions of aged animals. In summary, aging decreased hippocampal insulin sensitivity regarding lactate metabolism, mitochondrial biogenesis, BDNF expression and neuroplasticity (cell counts and neurogenesis). However, ICV insulin administration was effective in improving neuroplasticity in the hippocampus of aged rats.

Glioblastomas Multiformes (GBM) são tumores do Sistema Nervoso Central com altas taxas de invasibilidade e grande resistência a quimio e radioterapias, cuja origem foi inicialmente atribuída a células tronco neurais (NSCs). Mais recentemente, trabalhos de rastreamento de linhagem celular (lineage tracing) revelaram que a célula de origem em GBM, ao menos para certos subtipos, é na verdade a célula precursora de oligodendrócitos (OPC). A identificação da origem do tumor pode auxiliar na compreensão da doença e no desenvolvimento de terapias mais eficazes. OPCs são células com grande capacidade migratória e constituem a população de células cerebrais mais proliferativamente ativa, características compatíveis com a biologia de glioblastomas. Neste trabalho criamos uma meta-assinatura de OPCs que, quando aplicada a amostras populacionais e de céulas únicas de GBMs humanos, indica a presença de características de OPCs em virtualmente todos os tumores, principalmente dentre os do subtipo Proneural. Apesar disso, o cultivo de GBMs in vitro tem sido tradicionalmente realizado em meio próprio de NSCs, como forma de preservar as características originais do tumor. Entretanto, no caso de OPC ser a verdadeira célula de origem, o ideal seria a utilização de meio próprio para esta célula. Utilizamos meio padrão para NSCs e meio para OPCs em linhagens de camundongo bem como em biópsias humanas. Meio de NSCs provoca alterações morfológicas e em marcadores, enquanto meio de OPCs mantém as células mais similares ao tumor que lhes deu origem. Principalmente, meio de NSCs reduz o potencial tumorigênico das células in vivo, e faz com que alvos errôneos sejam identificados na resposta a drogas, devido à expressão de marcadores nãoautênticos pra célula de origem. A análise de gliomas humanos indica que a população proliferativamente ativa expressa marcadores de OPCs, independentemente do subtipo em que o tumor foi classificado. Assim, concluímos que o papel de OPCs no desenvolvimento de GBMs é mais importante do que se imaginava, e que a utilização de meio de cultivo baseado na célula de origem é fundamental para a correta identificação de alvos terapêuticos. / Glioblastoma Multiformes (GBM) are Central Nervous System tumors that present high invasibility rates and great resistance to chemo- and radiotherapies, whose origin was initially accredited to Neural Stem Cells (NSCs). More recently, papers employing lineage tracing revealed that the cell of origin in GBM, at least for certain subtypes, is in fact an Oligodendrocyte Precursor Cell (OPC). The elucidation about the origin of a tumor can help in the disease comprehension and in the development of more efficient therapies. OPCs are naturally migratory cells and constitute the most actively proliferating cell population in the brain, characteristics that are compatible with glioblastoma biology. In this work we created an OPC meta-signature that, once applied to populational and single-cell data in GBM, reveals the presence of OPC features in virtually every tumor, mainly from the Proneural subtype. Moreover, GBM in vitro culture has traditionally been done in NSC media, as an attempt to preserve original characteristics from the tumor. However, if OPC is the real cell of origin, it would be better to grow GBM samples in OPC media. Here, we used NSC media and OPC media in mice lines as well as in human byopsies. NSC media induces morphological and marker changes, while OPC media maintains the cells more similar to the tumor from where they were originated. Mainly, NSC media reduces the tumorigenic potential of the cells in vivo, and causes false targets to be identified in response to drugs due to the expression of non-authentic markers to the cell of origin. Human glioma analysis indicates that the actively proliferating population expresses OPC markers, regardless of the subtype in which the tumor was classified. Therefore, we conclude that the role of OPCs in GBM development is more importante than originally thought, and that the employment of culture media based on cell of origin is of fundamental importance for the correct identification of therapeutical targets.

Dissertação (mestrado)—Universidade de Brasília, Faculdade de Ciências da Saúde, Programa de Pós-Graduação em Ciências da Saúde, 2012. / Submitted by Tania Milca Carvalho Malheiros (tania@bce.unb.br) on 2012-10-29T14:09:23Z No. of bitstreams: 1 2012_LudmyllaCostaCunha_Parcial.pdf: 2564492 bytes, checksum: 6e6ce6ca592e7c52d9722490cc9c373a (MD5) / Approved for entry into archive by Jaqueline Ferreira de Souza(jaquefs.braz@gmail.com) on 2012-11-22T12:01:03Z (GMT) No. of bitstreams: 1 2012_LudmyllaCostaCunha_Parcial.pdf: 2564492 bytes, checksum: 6e6ce6ca592e7c52d9722490cc9c373a (MD5) / Made available in DSpace on 2012-11-22T12:01:03Z (GMT). No. of bitstreams: 1 2012_LudmyllaCostaCunha_Parcial.pdf: 2564492 bytes, checksum: 6e6ce6ca592e7c52d9722490cc9c373a (MD5) / Gliomas representam o tipo de tumor cerebral primário de maior malignidade. Entre as alterações que conferem competência tumoral ao glioma, está o aumento na expressão do canal de potássio hEag1. Na última década, a interferência de RNA (RNAi) tem se destacado como técnica para estudo da função de genes em mamíferos, via silenciamento gênico pós-transcricional. Neste sentido, a técnica de RNAi foi utilizada no atual estudo para silenciar o gene Eag1 em células de glioma. Na primeira etapa deste projeto, foram identificados alvos para RNAi na região codante do gene hEag1 (NM_172362.2), via algoritmo baseado em redes neurais artificiais. Foram identificados 25 alvos de RNAi, com escores variando de 0,82 a 0,87, e selecionados para o atual estudo os dois alvos com maiores escores. Foi realizada síntese química de siRNAs para estes alvos situados nos exons 2 e 8, daí a denominação e2_hEag1 e e8_hEag1. Também foram sintetizados o siRNA controle positivo descrito anteriormente Kv10.1-3 e o controle negativo scramble (Qiagen). Foi inicialmente determinado o ponto temporal (4h, 8h, ou 48h) e a concentração (18,75 nM, 37,5 nM ou 75,0 nM) de maior silenciamento de hEag1, utilizando-se os siRNAs controles transfectados em lipossomas catiônicos. O maior silenciamento foi observado no tempo de 8h pós-transfecção, na menor dosagem testada, 18,75 nM. Nesta condição experimental, foi testado o grau de silenciamento de Eag1 causado pelos dois novos siRNAs, em comparação com o controle positivo Kv10.1-3. Ambos siRNAs desenhados no atual estudo -e2_hEag1 e e8_hEag1 -foram mais efetivos que o controle positivo Kv10.1-3, reduzindo assim o conteúdo relativo de hEag1 em 0,46 vezes e 0,52 vezes, respectivamente, em relação ao valor obtido no controle negativo scramble (p < 0,05). Na última etapa deste estudo, foi avaliado se vetores de expressão de short hairpins RNAs (shRNA) direcionados ao alvo 5´ GTCCACTTGGTCCATGTCCAG 3´ do controle positivo Kv10.1-3 (pKv10.1-3hum_LI), causariam alteração de fenótipo celular, ou seja, redução da viabilidade dos gliomas. O efeito destes vetores de expressão (pKv10.1-3hum_LI ou pScramble, dose de 0,2 µg) sobre a viabilidade de gliomas, em uso isolado ou em combinação com interferon gama (IFN-y, 25 ng/mL ) foi testado pelo ensaio de MTT. A redução de viabilidade obtida com a combinação do vetor pKv10.1-3hum_LI e IFN-y (40,4 %)foi superior àquela obtida com o uso isolado de ambos, 16,0% e 11,4%, nesta ordem (p < 0,05). Este efeito sinérgico não foi observado com o vetor controle negativo pScramble, o que indica tratar-se de efeito sequência-específico, ou seja, dependente da sequência do shRNA expresso pelo vetor pKv10.1-3hum_LI. Em síntese, o presente estudo mostra que é possível silenciar a expressão de hEag1 de gliomas via siRNAs sintéticos. Além disto, revela a importância de hEag1 para a viabilidade celular do glioma, principalmente durante a injúria por IFN-y. No sentido tecnológico, o atual estudo apresenta um protocolo inovador com potencial uso na terapêutica de gliomas, baseado na associação de RNAi sobre hEag1 com o agente imunomodulador IFN-y. ______________________________________________________________________________ ABSTRACT / Glioma is the most common type of primary malignant brain tumor. The disease presents poor clinical outcome and the treatment is essentially palliative. Among the genetic changes that confer capability to tumor cells is the hEag1 gene overexpression. RNA interference (RNAi) has rapidly advanced into a practical technique for mammalian gene function studies, through post-transcriptional genetic silencing. The technique was used in the present study to silence hEag1 gene in glioma cells in culture. We first identified RNAi targets in the coding region of hEag1 (NM_172362.2) by using algorithms based on artificial neural networks. Twenty-five hEag1 RNAi targets were found, with scores ranging from 0.82 to 0.87; the two highest rated were selected. They were chemically synthesized as short interfering RNAs (siRNAs), and designated e2_hEag1 and e8_hEag1, according to the targeted exon. Positive and negative siRNA controls were the previously published Kv10.1-3, and the scramble All Star (Qiagen), respectively. We first determined the time-point (4h, 8h, or 48h) and siRNA concentration (18.75 nM, 37.5 nM, or 75.0 nM) that provide the highest silencing effect, by using RT-qPCR. The best hEag1 knock-down occurred at 8h post-transfection with 18.75 nM siRNA concentration. We used this experimental condition to compare the two new siRNAs - e2_hEag1 and e8_hEag1 – with the positive control Kv10.1-3. Both siRNAs in test produced higher silencing effects compared to Kv10.1-3 (p < 0.05). The mRNA fold decrease varied from 0.46 to 0.52, according to each transfected siRNA e2_hEag1 or e8_hEag1, respectively. Finally, we evaluated whether an expressed short hairpin RNA (shRNA) to the same hEag1 Kv10.1-3 target sequence (5´- GTCCACTTGGTCCATGTCCAG 3´) would decrease the glioma cell viability. The expression vectors (pKv10.1-3hum_LI or a scramble control one pScramble, dose 0.2 µg) were transfected into glioma cells, with or without interferon gamma concurrent treatment (IFN- y, 25 ng/mL ) viability was determined by MTT assay. The association of the vector pKv10.1-3hum_LI and IFN- y decreased the glioma cell viability to 40.4%, which surpassed the results obtained from their isolate use, 16.0% and 11.4%, respectively (p<0.05). As pScramble showed no synergism with IFN- y we consider the pKv10.1-3hum_LI effects were sequence-specific. In conclusion, this study showed the ability of two unpublished siRNAs to knock-down hEag1. Our results are in agreement with previous data that established a role for Eag1 in the tumor cell viability. This role seems to be even more important during IFN-y injury. Regarding to biotechnology, this study presents an innovative treatment able to reduce the glioma cell viability, based on the association of shRNA expression vector to hEag1 and the immunomodulatory agent IFN- y.

Dissertação (mestrado)—Universidade de Brasília, Faculdade de Ciências da Saúde, 2008. / Submitted by Kathryn Cardim Araujo (kathryn.cardim@gmail.com) on 2009-10-06T17:33:35Z No. of bitstreams: 1 2008_ClaudiaMendesGuimaraes.pdf: 1219592 bytes, checksum: 7417a5ef24e4d8aea08e41e1786680b9 (MD5) / Approved for entry into archive by Gomes Neide(nagomes2005@gmail.com) on 2010-07-08T12:11:35Z (GMT) No. of bitstreams: 1 2008_ClaudiaMendesGuimaraes.pdf: 1219592 bytes, checksum: 7417a5ef24e4d8aea08e41e1786680b9 (MD5) / Made available in DSpace on 2010-07-08T12:11:35Z (GMT). No. of bitstreams: 1 2008_ClaudiaMendesGuimaraes.pdf: 1219592 bytes, checksum: 7417a5ef24e4d8aea08e41e1786680b9 (MD5) Previous issue date: 2008 / Introdução: Pesquisas recentes têm demonstrado que após lesão da área motora de um hemisfério cerebral, uma excessiva inibição transcalosa a partir do hemisfério cerebral não-lesado contribui para os déficits motores do paciente. Outros trabalhos têm demonstrado déficits motores sutis também no membro “sadio” desses pacientes. Este estudo propõe o uso do biofeedback EMG para treino de relaxamento do membro superior não-parético (MSNP) como uma ferramenta de inibição do input sensorial e, por conseguinte, modulação da hiperexcitabilidade do hemisfério intacto. Acreditamos que isso resultaria em melhora do desempenho motor do membro superior parético (MSP) de pacientes acometidos por acidente vascular encefálico (AVE). Amostra: Participaram do estudo nove pacientes ( 7 homens e 2 mulheres), com idades entre 33 e 66 anos (55,3 ± 10,9), com hemiparesia espástica secundária a AVE. O tempo pós-AVE foi de 6 a 36 meses. Nenhum paciente estava deprimido ou possuía déficit cognitivo. Método: A avaliação incluiu os seguintes testes: Escala de avaliação motora funcional de Fugl-Meyer, Mini-Exame do Estado Mental (Folstein), Escala de Destreza Manual de Edinburgh, Escala Modificada de Ashworth e Escala Geriátrica de Depressão. Para a avaliação do desempenho motor do MSP foram realizados os Testes da Prancha de Pegboard e da Caixa e Blocos associados ao Eletromiograma de Superfície (EMGS) nos seguintes músculos do MSNP: deltóide (fibras médias), bíceps braquial, flexor superficial do carpo e extensor comum dos dedos. Quando a atividade elétrica era maior que 100μV em qualquer um desses músculos, o paciente era incluído no treino de relaxamento com biofeedback EMG, durante o qual atividades manuais grosseiras e finas eram realizadas com o MSP. Por fim, os testes de desempenho motor foram repetidos, simultaneamente aos registros EMGS, em duas condições: Final Sem Solicitação de Relaxamento (Final SSR) e Final com Solicitação de Relaxamento (Final CSR). O MSNP realizou os mesmos testes, todavia sem registro EMGs. Resultados: O desempenho do MSP foi avaliado pelo modelo ANOVA de medidas repetidas, que não apresentou significância estatística para as condições Inicial X Final SSR e Inicial X Final CSR, tanto no teste de Pegboard (p=0,079) quanto no da Caixa e Blocos (p=0,068), embora houvesse uma tendência à melhora do desempenho após o treinamento de biofeedback. Para o MSNP foi usado o teste t-pareado que apresentou significância importante para as condições INICIAL X FINAL SSR no teste de Pegboard (p<0,001), enquanto que para o teste da Caixa e blocos não houve diferença significativa (p=0,105). Conclusão: O Biofeedback EMG se apresenta como uma ferramenta potencial para a redução do input somatossensorial do MSNP e melhora de performance do MSP; a falta de significância estatística pode ser atribuída ao pequeno número de pacientes nesta amostra. Em contrapartida, a mesma abordagem apresentou-se como uma alternativa promissora em aprimorar o desempenho do MSNP ao equilibrar a hiperexcitabilidade do hemisfério não-lesado ou mesmo ao evidenciar que esse hemisfério retém importante capacidade de aprendizado motor. ______________________________________________________________________________________ ABSTRACT / Introduction: There has been recent evidence that, after lesion of the motor area of a cerebral hemisphere, an excessive transcalosal inhibition from the intact hemisphere contributes to the motor deficits experienced by patients. Other studies have been able to disclose subtle motor deficits also in the so-called “healthy” limbs of stroke patients. The present study suggests the use of EMG biofeedback for relaxation training of the non-paretic upper limb (NPUL) as a tool for inhibiting sensory inputs, which might result in modulation of excitability of the intact hemisphere. We hypothesized that this might result in improvements in motor performance of the paretic upper limb (PUL) of stroke patients. Sample: Nine patients participated in the study (7 men and 2 women), with ages from 33 to 66 years (55.3 + 10.9), with spastic hemiparesis secondary to stroke. Time after stroke ranged from 6 to 36 months. No patient was depressed or had cognitive deficits. Methods: The evaluation included the following: Fugl-Meyer Motor Function Scale, Folstein's Mini Mental State Examination, Edinburgh Handedness Inventory, Ashworth modified scale and Geriatric Depression Scale. For the evaluation of the PUL we have used the Purdue Pegboard Test and the Box and Blocks test in association with surface EMG in the following muscles in the NPUL: medial deltoid, biceps, flexor carpi superficialis, and extensor digitorum communis. Whenever electrical activity was above 100 μV in any of these muscles, the patient was enrolled in biofeedback relaxation training, during which gross and fine manual tasks were performed with the PUL. Lastly, motor performance tests were repeated, simultaneously with surface EMG (sEMG) records, under two different conditions: final with no relaxation command (Final NRC) and final with relaxation command (Final RC). The NPUL performed the same tasks, but without sEMG monitoring. Results: Performance of the PUL was evaluated by a repeated measures ANOVA, and there was no statistical significance for the comparisons baseline X Final NRC and baseline X Final RC, both in the Purdue Pegboard Test (p=0.079) and in the Box and Blocks Test (p=0.068); however, there was a trend for better performance after biofeedback relaxation training. For the NPUL we used a paired T-Test, which showed a significant difference for the condition baseline X Final NRC in the Pegboard Test (p< 0.001), whereas for the Box and Blocks Test there was no statistical significance (p=0.105). Conclusion: EMG biofeedback training emerges as a potential tool for reducing somatosensory input to the NPUL, resulting in better performance of the PUL; the lack of statistical significance may be due to the small number of patients in this sample. At the same time, the same procedure proved to be a promising alternative for improving the performance of the NPUL, either by balancing excitability in the intact hemisphere or by tapping into a substantial capacity for motor learning, that may well be still present in the contralesional cerebral hemisphere.

Dissertação (mestrado)— Universidade de Brasília, Faculdade de Ciências da Saúde, Programa de Pós-Graduação em Ciências da Saúde, 2013. / Submitted by Albânia Cézar de Melo (albania@bce.unb.br) on 2013-10-29T14:43:25Z No. of bitstreams: 1 2013_RicardoAmoreiraGepp.pdf: 1242435 bytes, checksum: a146601c5b5f73f3b58e6363d9d021af (MD5) / Approved for entry into archive by Guimaraes Jacqueline(jacqueline.guimaraes@bce.unb.br) on 2013-10-30T12:36:05Z (GMT) No. of bitstreams: 1 2013_RicardoAmoreiraGepp.pdf: 1242435 bytes, checksum: a146601c5b5f73f3b58e6363d9d021af (MD5) / Made available in DSpace on 2013-10-30T12:36:05Z (GMT). No. of bitstreams: 1 2013_RicardoAmoreiraGepp.pdf: 1242435 bytes, checksum: a146601c5b5f73f3b58e6363d9d021af (MD5) / Introdução: A RM é o padrão atual de imagem para o diagnóstico de tumores encefálicos, com imagens anatômicas e funcionais. Achados anatômicos por meio da ressonância magnética são insuficientes na avaliação prognóstica dos tumores, sendo necessária a utilização de outros métodos. A análise da metilação do gene promotor do MGMT é outro fator importante no prognóstico de gliomas anaplásicos. Este estudo teve o objetivo de estudar o prognóstico e as relações entre aspectos de perfusão na ressonância magnética e a análise da metilação do gene promtor de MGMT. Métodos: Foram analisados 39 pacientes com gliomas malignos encefálicos. Os pacientes foram submetidos a ressonância magnética com estudo da perfusão e após a cirurgia foi realizada a análise da presença do gene promotor de MGMT. Foi feito a análise estatística e o estudo das curvas de sobrevivências do grupo metilado e não metilado e da perfusão. Resultados:O estudo demonstrou que a sobrevida média dos pacientes negativos para metilação no gene promotor de MGMT foi de 17,9 meses, enquanto que no grupo positivo para metilação a sobrevida foi de 29,2 meses (p<0,05). A curva de Kaplan-Meier demonstrou uma sobrevida maior no grupo com metilação do gene promotor de MGMT (p<0,01 log-rank teste). A curva de sobrevivência da análise da metilação do gene promotor do MGMT com relação a perfusão demonstrou que nos pacientes com presença do gene a variação da perfusão entre alta e baixa não foi significante (p=0,944). Na avaliação dos casos sem a presença do gene, os pacientes com perfusão alta tiveram pior sobrevida (p=0,038). Conclusão: A presença de metilação do gene promotor de MGMT associado a uma perfusão baixa na ressonância magnética são fatores para melhor prognóstico nos gliomas malignos encefálicos. ______________________________________________________________________________ ABSTRACT / BACKGROUND: Magnetic resonance imaging is the current standard in the diagnostic imaging of brain tumors, yielding both anatomical and functional images. Anatomical findings on MRI are insufficient for the prognostic assessment of tumors; thus, other methods are needed. MGMT promoter methylation assessment is another important factor in the prognosis of malignant gliomas. The aim of the present study was to examine prognosis and the relationships between perfusion features on MRI and the presence of MGMT promoter methylation. METHOD: A total of 39 patients with malignant brain gliomas were evaluated. The patients underwent brain MRI and perfusion, and the presence of MGMT promoter methylation was assessed postoperatively. Statistical analysis and a study of the survival curves of the methylated and unmethylated groups were performed, and perfusion was assessed for each group. RESULTS: The mean survival of patients who were negative for MGMT promoter methylation was 17.9 months, while in the methylation-positive group survival was 29.2 months (p<0.05). The Kaplan-Meier curve showed longer survival for the groupwith MGMT promoter methylation (p<0.01 by the log-rank test). The survival curve of MGMT promoter methylation in relation to perfusion showed that variations between high and low perfusion values were not significant (p=0.944) for themethylation-positive patients. In the evaluation of the methylation-negative patients, those who showed high perfusion values had poorer survival (p=0.038). CONCLUSION: Presence of MGMT promoter methylation in conjunction with low perfusion on MRI are factors of better prognosis in malignant brain gliomas.

Orientadores: Licio Augusto Velloso, Mario Jose Abdalla Saad / Tese (doutorado) - Universidade Estadual de Campinas. Faculdade de Ciencias Medicas / Made available in DSpace on 2018-07-26T22:47:39Z (GMT). No. of bitstreams: 1 Fernandes_MariaLuizadeLimaAguilar_D.pdf: 2848766 bytes, checksum: 4e790a5436936ff2a950c65443b1ea1c (MD5) Previous issue date: 2000 / Resumo: A insulina, agindo através do seu receptor (IR) pertencente à família dos receptores com atividade tiro sina quinase, desencadeia uma série de respostas tecido-específicas mediadas por diferentes vias intracelulares. Uma destas vias, com atividade predominantemente ligada a crescimento celular e mitogênese envolve as proteínas SHC e GRB2. No presente estudo avaliou-se a sinalização da insulina através da vias SHC/GRB2 em sistema nervoso central (SNC) de ratos. Inicialmente determinou-se presença e quantidades de IR, SHC e GRB2 em córtex cerebral e cerebelar. As três proteínas foram encontradas em concentrações similares em ambos os tecidos. Entretanto, quando os animais experimentais foram submetidos a tratamento agudo com insulina detectou-se aumento significativo da fosforilação de IR e SHC e da associação SHC/GRB2 somente em cerebelo e não em córtex cerebral. Em seguida avaliou-se a variação da concentração de IR, SHC, GRB2 e da tirosina fosfata'Se SHP2, desde o primeiro dia até a sexagésima semana de vida. Com relação ao nível de expressão protéica somente SHP2 sofreu queda significativa no período avaliado, mantendo-se as demais proteínas em níveis estáveis. Sob tratamento agudo com insulina observou-se que no decorrer do período avaliado ocorreu uma queda progressiva da fosforilação basal ou insulino-dependente de IR e SHC e da associação entre SHC/GRB2 tanto em cérebro quanto em cerebelo. Conclui-se que elementos participantes de uma das vias intra-celulares de sinalização da insulina estão presentes em SNC, que sua atividade sofre modulação de acordo com a idade e que existem diferenças funcionais entre córtex cerebral e cerebelar na resposta à insulina / Abstract: Insulin, acting through its protein tyrosine kinase receptor (IR), induces a series of tissue specific responses that are mediated by different intracelIular pathways. One of these pathways, which promotes mitogenic and growth-related effects involve SHC and GRB2. In the present study insulin signaling was evaluated through the SHC/GRB2 pathway in the central nervous system (CNS) of rats. InitialIy we determined the presence and amounts of IR, SHC and GRB2 in forebrain cortex and cerebelIum. AlI three proteins were found at similar concentrations in both tissues. However, when the experimental animaIs were submitted to treatment withinsulin we found significant increase in IR and SHC phosphorylation and SHC/GRB2 association only in cerebelIum, but not in forebrain cortex. Next we determined the IR, SHC, GRB2 and SHP2 concentrations during postnatal development. Conceming protein expression, only SHP2 was shown to suffer a progressive falI from day one to week sixty of life. When acutely treating with insulin, we observed a progressive, time-dependent decrease on both basal and insulin-stimulated phosphorylation of IR and SHC and SCH/GRB2 association in forebrain cortex and cerebelIum. We conclude that, the elements involved in the intracelIular pathway of insulin signaling are present in the CNS, their functional status suffer variation with age and there is a site-specific variation in the response to insulin / Doutorado / Clinica Medica / Doutor em Clínica Médica

Orientador: Antonio Roberto Martins / Dissertação (mestrado) - Universidade Estadual de Campinas, Faculdade de Ciências Médicas / Made available in DSpace on 2018-07-31T15:09:42Z (GMT). No. of bitstreams: 1 Zanella_CesarAugustoBueno_M.pdf: 20682837 bytes, checksum: c0f8e5f63d925ba85f94e349339b4f1c (MD5) Previous issue date: 2002 / Resumo: A ontogênese do cérebro ocorre através de um programa coordenado de eventos celulares, entre eles, divisão celular, migração neuronal, morte celular seletiva e diferenciação. A interrupção desses processos, ou de um deles, pode provocar anormalidades da arquitetura do córtex cerebral em desenvolvimento e de suas propriedades eletrofisiológicas. Uma manifestação de malformação relacionada ao desenvolvimento cortical é a epilepsia. Entre as lesões estruturais do SNC que causam epilepsia destacam-se as displasias corticais. No SNC, o NO é um importante neurotransmissor e participa da regulação de diversas funções cerebrais. O NO é sintetizado após ativação ou indução da enzima NOS, e no córtex cerebral ele é produzido sob demanda pela nNOS. No entanto, quando presente em altas concentrações, o NO, assim como o glutamato, podem iniciar uma cascata neurotóxica. Pode, também, ter papel importante na fisiopatologia da epilepsia. No presente trabalho, realizamos um estudo imunohistoquímico para mostrar a expressão da nNOS em displasias corticais e no córtex cerebral humano normal. Padronizamos um método para recuperação da antigenicidade de secções de tecido de córtex cerebral humano fixados em formalina e embebidos em parafina com tratamento em forno de microondas em tampão Tris-HCI 50 mM pH 9.5 , e que foi utilizado nos experimentos imunohistoquímicos. Os córtices displásicos mostraram nNOS-IR em neurônios por toda a espessura do córtex, om predomínio em duas camadas que correspondem às camadas III e V. A intensidade de marcação foi variável e com predomínio de marcação citoplasmática, embora alguns neurônios mostraram marcação nuclear. Fibras com varicosidade em toda espessura cortical apresentaram intensa nNOS IR. No córtex cerebral humano normal, neurônios nNOS imunorreativos foram encontrados, preferencialmente, nas camadas mais profundas da substância cinzenta e na substância branca. A camada I não mostrou neurônios nNOS imunorreativos. A nNOS-IR de corpos celulares neuronais teve predomínio de marcação citoplasmática. Um número expressivo de fibras apresentaram nNOS-IR por toda a espessura do córtex. Os tecidos displásicos utilizados em nossos estudos estão associados com epilepsia farmacologicamente intratável. Assumindo que a nNOS-IR detectada nos neurônios corresponda à forma cataliticamente ativa da nNOS, nós sugerimos que a liberação do NO por estes neurônios poderia ativar neurônios alvo aditivamente provocando uma hipersincronização, e eventualmente disparando uma descarga epiléptica / Abstract: Nitric oxide (NO) is a diffusible and reactive molecular messenger in the nervous, vascular and immune systems. NO is not stored, but rather synthesized on demand from the amino acid L-arginine by a family of isoenzymes, the nitric oxide synthases (NOS). NO is a mediator of many physiological roles. In the brain, NO acts as a neurotransmitter/neuromodulator and regulate many cerebral functions. NO also plays patophysiological roles such as in epilepsy and some neurodegenerative diseases. The heading of cortical dysplasia groups heterogenous disorders of development often associated with epilepsy. Some neocortical dysplasias are considered disorders of neuronal migration, which have variously been classified regarding their morfology or putative etiology. We describe here cytoarchitetonic alterations in displatic tissue from patients affected by pharmacologically resistant epilepsy, which were obtained at surgery for epilepsy. This study shows the distribution of nNOS immunoreactivity-like structures in displastic and normal neocortex. Normal cortex was obtained from patients without history of neurologic disease and evidence of neuropathologic changes. In the displastic cortex, cortical laminar disorganization was found in all cases. The strongest nNOS immunoreactivity was detected in the cytoplasm and nucleus of neurons in the deepest cortical layers and in the white matter. The normal cortex showed nNOS immunoreactivity predominantly in neurons of layers III e V. Varicose fibers were detected throughout both the normal and displastic cortex. Assuming that the nNOS immunoreactivity in the deepest cortical neurons of displastic neocortex corresponds to a catalytically active form of the enzyme, we suggest that the release of NO by them might additively activate target neurons, possibly via soluble guanylate cyclase, thereby leading to their hypersynchronization, and eventually triggering an epileptic discharge / Mestrado / Mestre em Farmacologia

Orientador: Benito Pereira Damasceno / Tese (doutorado) - Universidade Estadual de Campinas, Faculdade de Ciencias Medicas / Made available in DSpace on 2018-08-03T17:04:37Z (GMT). No. of bitstreams: 1 Maciel_ErnanePires_D.pdf: 1546017 bytes, checksum: 7e2fc8678ac08ee4bf0ea612ff94550a (MD5) Previous issue date: 2002 / Resumo: A esclerose múltipla (EM) é uma doença crônica do sistema nervoso central (SNC) de etiologia desconhecida cujas manifestações iniciais ocorrem na adolescência e no adulto jovem, secundárias à desmielinização multifocal por mecanismo autoimune e inflamatório. O curso clínico pode assumir a forma surto-remissão, progressão secundária, progressão primária. O diagnóstico é feito com base no quadro clínico evolutivo com o suporte dos exames de líquor, potencial evocado visual, ressonância magnética de crânio e medula, excluindo-se outras doenças de natureza inflamatória ou infecciosa. O exame de líquor na EM mostra pleocitose linfomonocitária, elevação do índice de IgG (imunoglobulina G) e presença de bandas oligoclonais. O quociente de albumina é alterado infrequentemente na doença. A ressonância magnética mostra lesões de hipersinal em seqüências T2, DP e FLAIR (Fluid-attenuated inversion recovery magnetic resonance imaging) e hipossinal em T1 na substância branca cerebral, nervo óptico, tronco cerebral e medula espinal. A captação de contraste indica lesão recente. O propósito do presente trabalho foi o de avaliar as correlações entre número de células no liquor, índice de IgG, síntese diária intratecal de IgG (imunoglobulina G), a presença de bandas oligoclonais com: o volume de lesão em FLAIR, T1 e T1 com contraste, e com a área de lesão em contato com espaço liquórico em FLAIR, T1 e T1 com contraste e o grau de incapacidade medido pela EDSS (escala de incapacidade expandida de Kurtzke), a forma clínica, duração da doença, cor da pele e idade dos pacientes. Setenta e um pacientes com esclerose múltipla clinicamente definida, pelos critérios de Poser, foram submetidos a exame de líquor com contagem de células, dosagem de IgG e albumina por nefelometria e cálculo do índice de IgG, síntese diária intratecal de IgG e quociente de albumina. Os dados clínicos: idade, raça, duração da doença, forma clínica e EDSS foram definidos após anamnese e exame neurológico. O volume de lesões em FLAIR, T1 e T1 com contraste foi estimado por estereologia. A área de lesão em contato com espaço liquórico foi obtida manualmente medindo-se a extensão da área lesionada em contato com a parede ventricular, superfície externa do tronco cerebral e córtex cerebral e multiplicando-se pela espessura dos cortes. Dos 71 pacientes, 62 tiveram RM de crânio com imagens em FLAIR, 56 pacientes tiveram analisadas as imagens em T1 sem contraste e 26 pacientes com imagens em T1 com contraste. Os resultados mostraram média de idade maior nas formas progressivas, maior índice de IgG na forma surto remissão, maior freqüência de bandas oligoclonais exclusivas no líquor nos casos com maior síntese diária intratecal de IgG. Quanto maior o EDSS mais elevado o quociente de albumina e a síntese diária de IgG. A área de lesão que toca o espaço liquórico foi diretamente proporcional ao quociente de albumina, sugerindo que as áreas desnudas de lesão em torno do sistema LCR é que determinam uma maior entrada de albumina, mas não de IgG, ao sistema LCR / Abstract: Multiple sclerosis (MS) is a chronic disease of the central nervous system (CNS) of unknown aetiology, which first manifestations occur in adolescence or in young adulthood, after multifocal demyelination caused by an autoimmune and inflammatory process. The clinical evolutive sequence can take the relapsing-remitting, secondarily progressive and primary progression forms. Diagnosis is based on the evolutive clinical manifestations, supported by cerebrospinal fluid (CSF), visual evoked responses, brain and spinal cord magnetic resonance images, with exclusion of other inflammatory or infectious diseases. The CSF analysis in MS shows lymphocyte and monocytes pleocytosis, increase in intrathecal immunoglobulin G (IgG) synthesis and the presence of oligoclonal bands. The albumin quotient is seldom changed in the disease. Magnetic resonance imaging (MR) shows hyperintensities in T2 weight, proton density (PD) and fluid-attenuated inversion recovery (FLAIR) images and hypointensity in T1 weight images, in the cerebral white matter, optic nerves, brainstem and spinal cord . The acute lesions show enhancement with contrast. The purpose of this thesis was to evaluate the correlations between the number of cells in the liquor, the IgG index, the daily intrathecal IgG synthesis, the presence of oligo-clonal bands with: the lesion volume in FLAIR, T1 and T1 with contrast and with the lesion area in contact with the CSF space in FLAIR, T1 and T1 with contrast and the degree of disability measured by EDSS (Kurtzke¿s expanded disability scale), clinical forms, duration of the disease, race and age of patients. Seventy-one patients with clinically defined multiple sclerosis, according to Poser's criteria, had CSF analysis done with cell counting, IgG and albumin dosage by means of nephelometry and calculation of the IgG index, the daily IgG intrathecal synthesis and the albumin quotient. The clinical data: age, race, duration of the disease, clinical form and EDSS were defined after anamnesis and neurological examination. The volume of lesions in FLAIR, T1 and T1 with contrast was measured by means of stereology. The lesion area in contact with the CSF space was calculated measuring manually the extension of the injured area on the ventricular wall, on the external surface of the brainstem and on the cerebral cortex and multiplying this figure by the thickness of the slices. Of the 71 patients, 62 of them were examined by brain MR with images in FLAIR, 56 patients had images in T1 without contrast analysed and 26 patients, T1 with contrast. The results showed a higher age average in the progressive forms, a greater IgG index in the relapsing-remitting form, a higher frequency of the exclusive oligoclonal bands in the CSF, in the cases with a greater daily intratechal synthesis of IgG. The greater the EDSS, the higher was the albumin quotient and the daily synthesis of IgG. The lesion area that contacts the CSF space was directly proportional to the albumin quotient, what suggests that the lesion areas around the CSF system determine a greater input of albumin, but not IgG, in the CSF system / Doutorado / Neurologia / Doutor em Ciências Médicas