Bevor ein zellbasiertes GTMP erstmalig beim Menschen angewendet werden kann, müssen verschiedene notwendige nicht-klinische Studien durchgeführt werden. Wichtig ist hier u.a. die Untersuchung der Biodistribution im Tiermodel. Diese umfasst die Verteilung, das Engraftment, die Persistenz, die Eliminierung und gegebenenfalls die Expansion der humanen Zellen in verschiedenen Organen, meistens im Mausmodel. Deshalb wurde eine qPCR-basierte Analysenmethode entwickelt, mit der humane genomische DNA innerhalb von muriner genomischer DNA bestimmt werden kann, und entsprechend den regulatorischen Richtlinien der European Medicines Agency und des International Council for Harmonisation validiert. Anschließend wurde diese Methode innerhalb einer präklinischen worst-case Szenario Biodistributionsstudie angewendet. Das Ziel dieser Studie war die Untersuchung des Biodistributionsprofils von genetisch modifizierten Blood Outgrowth Endothelial Cells von Hämophilie A Patienten 24 Stunden und sieben Tage nach intravenöser Applikation einer Dosis von 2x106 Zellen. Die Isolation, genetische Modifikation und die Expansion der Zellen sollte entsprechend den Richtlinien der Guten Herstellungspraxis durchgeführt werden. Hierbei ist die Auswahl und Anwendung geeigneter und essentieller Rohstoffe wichtig. Gleichermaßen ist die Durchführung einer definierten Qualitätskontrollstrategie notwendig und die Patientenzellen sollten nur innerhalb von nicht-klinischen Studien eingesetzt werden, wenn alle Akzeptanzkriterien erfüllt wurden. Die Validierung der qPCR-Methode zeigte eine hohe Genauigkeit, Präzision und Linearität innerhalb des Konzentrationsintervalls von 1:1x103 bis 1:1x106 humanen zu murinen Genomen. Bei Anwendung dieser Methode für die Biodistributionsstudie konnten nach 24 Stunden humane Genome in vier der acht untersuchten Mausorgane bestimmt werden. Nach sieben Tagen konnten in keinem der acht Organe humane Genome nachgewiesen werden... / The mandatory non-clinical study scheme prior to the first administration of a cell-based gene therapy medicinal product (GTMP) to human subjects includes and requires investigation of the biodistribution, comprising mobilization, persistence, and clearance, of the GTMP in a relevant animal model. Therefore, a qPCR-based method to determine the amount of human DNA in mouse DNA was developed and validated according to the guidelines of the European Medicines Agency and the International Council for Harmonisation. Furthermore, a preclinical worst-case scenario study was performed, in which this method was applied to investigate the biodistribution of 2x106 intravenously administered, genetically modified blood outgrowth endothelial cells from hemophilia A patients after 24 hours and seven days. The isolation, genetic modification and expansion of cells should be performed according to the guidelines on Good Manufacturing Practice. Here, the selection and application of appropriate and necessary raw materials is important. Likewise, the performance of a defined quality control program is mandatory and cells should only be applied within non-clinical studies if they passed all acceptance criteria. The validation of the qPCR method demonstrated high accuracy, precision, and linearity for the concentration interval of 1:1x103 to 1:1x106 human to mouse genomes. The application of this method in the biodistribution study resulted in the detection of human genomes in four out of the eight investigated organs after 24 hours. After seven days, no human DNA was detected in the eight organs analyzed. This biodistribution study provides mandatory data on the toxicokinetic safety profile of an actual cell-based medicinal product candidate. This is a prerequisite for designing and performing the subsequent toxicity studies necessary to ensure patient safety and permit moving the medicinal product towards a first-in-human clinical trial.

No description available.

The potential for biodegradation of contaminants in soil was assessed using an array of molecular methods, including terminal restriction fragment length polymorphism (TRFLP), quantitative polymerase chain reaction (qPCR), and traditional culturing techniques combined with sequencing of the 16S or ITS regions of the cultured bacteria and fungi. Soil was collected from the Santa Susana Field Laboratory (SSFL), which was the site of numerous liquid-propulsion rocket engine tests as well as nuclear energy research and development, which led to contamination of the soil with a wide variety of constituents. The contaminants of interest (COIs) at this site include polychlorinated biphenyls (PCBs), dioxins, polycyclic aromatic hydrocarbons (PAHs) and non-PAH petroleum hydrocarbons (PHCs). Various metals, most notably mercury and silver, are also present on the site. The purpose of this study was to determine if biodegradation is contributing to natural attenuation of contaminants in the soil, what organisms are likely causing biodegradation, and what rate(s) can be expected in the future. A literature review was conducted to investigate the chemical properties of theses COIs, their toxicity, and abiotic and biotic degradation. This research concluded that these COIs can be biodegraded if the right bacteria and/or fungi are present and active in the soil in sufficient numbers under the right conditions. Many known biodegraders of the COIs were identified in the literature review along with the most common pathways of biodegradation and degradation rates observed in field and laboratory studies. Soil was collected from 30 sample locations, with 3 sets of 10 samples containing high concentrations of one COI but low concentration of the others. PHCs and PAHs were found to be largely co-located, so 10 samples were selected for both of them. The remaining 20 samples were split evenly between PCBs and dioxins. DNA was extracted directly from all 30 soil samples and amplified using PCR for TRFLP analyses. Two soil samples were sent to Microbial Insights® for qPCR analysis. This analysis included 18 gene targets for the degradation of PHCs and PAHs, as well as the target gene for Dehalococcoides (an anaerobic dechlorinating bacteria). For each culturing a model chemical was selected to represent each COI and added to Bushnell-Haas agar plates containing no added carbon source other than the model compounds. The model chemicals were No. 2 diesel fuel for PHCs, naphthalene for PAHs, PCB #1 (monochloro) for PCBs, and dibenzofuran for dioxin. These plates were used to screen for biodegrading bacteria and fungi for each COI. Once cultured, 16S and ITS sequencing were used to identify these potential COI degraders and determine what TRFLP peak they would produce. The identity of isolated organisms was compared to information from the literature to assess the likelihood of COI biodegradation at SSFL. From the culturing experiments, 45 organisms were isolated, sequenced, and identified. The 45 included 14 unique bacteria and seven unique fungi. Of these, 10 different bacterial species and 5 different fungal species have been reported as COI biodegraders or belong to genera that contain reported COI biodegraders. TRFLP analysis revealed that the soil type has more effect on the microbial population than the presence of any of the COIs. There were no specific peaks that were significantly correlated to any specific COI. The peak distributions were fairly even, indicating a large amount of biodiversity in the microbial populations of the soil samples. The qPCR analysis revealed that SSFL soils contain significant populations of microbes that can degrade PHCs aerobically. Anaerobic PHC, anaerobic PAH, and aerobic PAH targets were not detected. A small amount of Dehalococcoides was detected in one of the samples. Collectively this study suggests that microbes present in SSFL soils are capable of biodegrading PHCs, and the genes for such biodegradation are actively being expressed. With the exception of a small population of Dehalococcoides, bacteria associated with the biodegradation of PAHs, PCBs, and/or dioxins were not detected. However, several strains of fungi were identified which have been reported to mediate cometabolic biodegradation of these compounds. Since these fungi do not require anaerobic conditions, they are more likely to contribute to natural attenuation than bacterial reductive dechlorination. Laboratory microcosm experiments are suggested for estimating rates of biodegradation at SSFL under natural attenuation conditions. Bioaugmentation and/or biostimulation methods should also be investigated in addition of natural attenuation. These microcosm experiments are currently underway in a companion study at Cal Poly by graduate student Mackenzie Billings.

Geosmin is a strong musty-flavored organic compound that is responsible for many taste-and-odor events in surface drinking water sources like lakes and reservoirs. The taste threshold of geosmin for humans is lower than 10 ng/L. Traditional treatment methods will not remove geosmin to this level. Additional water treatment methods must be implemented to successfully remove the geosmin and its associated flavor and odor from drinking water. Furthermore, geosmin is produced by cyanobacteria somewhat sporadically, so it is difficult to predict when taste-and-odor events are going to occur. The difficulty involved with predicting geosmin events has led most water treatment facilities to adopt reactive approaches towards geosmin treatment; these facilities typically treat for geosmin in response to complaints of an earthy off-flavor in the drinking water. This reactive approach causes issues with consumer confidence, as the flavor of the water is one of the only metrics a consumer has for judging the safety of his or her water. To enable proactive treatment of geosmin from water, more sensitive methods for geosmin detection or taste-and-odor event prediction must be developed.This study investigates the use of quantitative Polymerase Chain Reaction (qPCR) for the early detection of geosmin-producing cyanobacteria. qPCR can detect geosmin-producing cyanobacteria via their DNA. I developed a qPCR assay for this study that is capable of sensitively detecting multiple strains of the geosmin-producing Nostoc genus. The developed assay showed high sensitivity, demonstrating the possibility for its use in detecting low concentrations of geosmin-producing cyanobacteria before detectible levels of geosmin have been produced and released into the water. Through further sequencing of more geosmin-producing genera and species, the methodology outlined in this research could be applied to develop the tools necessary to predict taste-and-odor events caused by geosmin-producing cyanobacteria.

The genus Aspergillus possesses broad functionality and occupation of ecological niches. Underpinning this are changes in the transcriptome of these species. Transcriptional changes are clinically relevant with respect to understanding triazole resistant isolates of Aspergillus fumigatus. Reverse-transcription quantitative Polymerase Chain Reaction (RT-qPCR) is a highly specific means of measuring changes in gene expression. The most common method of which requires normalization to experimentally validated, stably expressed reference genes. Ideal reference genes are unaffected by differences in the experimental conditions or strains/isolates and are expressed at levels near the target gene(s). The first study reviewed current practices for reference gene selection and validation for RT-qPCR gene expression analysis of the genus, Aspergillus. Information on the species examined, experimental conditions, sample type, normalization strategy, reference gene(s) and their state of validation was obtained from 90 primary studies. Twenty reference genes were used, with the most popular reference genes used encoding beta-tubulin, actin, 18S rRNA and glyceraldehyde-3-phosphate dehydrogenase. Seventeen of the 90 studies experimentally validated the expression stability of the reference genes used, out of which eight used more than one reference gene. The results of three studies conflicted with others described in the literature, with no experimental validation of the reference genes available to aid in interpreting the conflicting findings. In the Genome-Wide Association Study, genes noted to increase in expression in response to itraconazole and/or voriconazole treatment of A. fumigatus were extracted from published RNA-sequencing or RT-qPCR studies. Ten ATP-binding cassette transporters, four major facilitator superfamily transporters and 16 transcription factors were identified. Collectively, the findings of this thesis show a large disparity in experimentally validated reference genes as well as future targets of gene expression analysis in triazole resistant isolates of A. fumigatus. / Thesis / Master of Science (MSc) / Aspergillus is a globally distributed genus of fungi, with some species threatening opportunistic human infection. To combat infection with the opportunistic species, Aspergillus fumigatus, antifungal drugs including: itraconazole, voriconazole and amphotericin B are used. Recent years have seen a rise in antifungal resistance in A. fumigatus. To understand this and other mechanisms in Aspergillus, changes in gene expression must be examined. My thesis aimed to determine how reference genes are selected for reverse-transcription quantitative polymerase chain reaction, a method applied to measure gene expression changes in Aspergillus. It was discovered that very few studies between the years 2001 and 2020 experimentally validated that the reference genes used were stably expressed, with only 17 out of 90 studies providing validation. In part two of my thesis, genes overexpressed in A. fumigatus when exposed to antifungal drugs, from formerly published articles, were summarized to better understand the role of gene expression in antifungal drug resistance.

Screening for resistance to Aspergillus flavus and aflatoxin contamination in maize is an ongoing effort by universities, state and federal agencies. We evaluated two techniques to screen for resistance; quantitative polymerase reaction (QPCR) and solid-phase microextraction (SPME). Methods were adapted to accurately detect and quantify the fungus in culture and in the vegetative stage of plant tissues. These assays can eliminate microbiological techniques. The primary objectives of the study were to utilize 1) QPCR to detect and quantify fungal biomass in maize stem tissues to evaluate resistance in maize genotypes to A. flavus colonization in situ and in vivo and 2) SPME to identify key MVOC’s to differentiate aflatoxigenic and non-aflatoxigenic strains of A. flavus in situ. A novel QPCR TaqMan probe (OMG3) was designed to detect a region in the aflP gene. The OMG3 probe detected 98.3% of the aflatoxigenic strains. The predominant MVOC’s extracted from both aflatoxigenic and non-aflatoxigenic strains were alcohols, ketones and hydrocarbons. The aflatoxigenic strain produced 39 compounds and the non-aflatoxigenic strain produced 41 compounds. Dimethylsulfide and 2-heptanol were key MVOC biomarkers produced only by the aflatoxigenic strain of A. flavus. Accuracy of the QPCR OMG3 probe, in vivo and in situ procedures were developed. A toothpick inoculation method was used to artificially inoculate maize stems in the vegetative stage five (V5). Plants were harvested at V7 and sampled at predetermined sites. This method was 91% consistent for infecting maize plants. The OMG3 probe was evaluated in in vivo and in situ studies conducted in the greenhouse, growth chamber, and field. Lesion length was greater in susceptible lines in 4 of 7 greenhouse trials. Based on inoculation data, subsequent research should focus on refining tissue-sampling methods and increasing length of plant growth time for tissue sampling post-inoculation.

A atrazina, um herbicida triazínico amplamente utilizado no controle de ervas daninhas, é um potencial contaminante ambiental, e possui como principal via de degradação uma via biológica. A linhagem Pseudomonas sp. ADP é o micro-organismo de referência no processo de degradação da atrazina em ambientes contaminados, pois contém em seu genoma os genes atzA, atzB, atzC, atzD, atzE e atzF, os quais codificam as enzimas responsáveis pelo processo de degradação. Bactérias gram-positivas também possuem capacidade para degradar a atrazina, mas iniciam a via de degradação através do gene trzN, análogo ao atzA. O objetivo do presente trabalho foi obter e analisar isolados bacterianos e consórcios formados por duas ou mais bactérias com capacidade para degradação completa do herbicida atrazina, como também analisar os efeitos da atrazina na comunidade bacteriana do solo. Duas bactérias gram-negativas, A01 e A02, foram isoladas de amostras de solo e foram identificadas como pertencentes aos gêneros Achromobacter e Pseudomonas, respectivamente, através do sequenciamento do gene 16S rRNA. Ambos os micro-organismos apresentaram potencial para biodegradação da atrazina em meio sólido, mas somente o isolado Pseudomonas sp. apresentou todos os genes atzA, atzB, atzC, atzD, atzE e atzF, que codificam as enzimas da via completa de degradação da atrazina. O isolado Achromobacter sp. apresentou somente os genes atzA, atzB e atzC, que representam a via inicial de degradação da atrazina até a formação de ácido cianúrico como metabólito. Um ensaio utilizando o método Southern Blot foi realizado para verificar se os genes atz detectados nos isolados do estudo são plasmidiais, sendo que apenas o isolado Pseudomonas sp. apresentou plasmídeo. A expressão dos genes atzA, atzB, atzC e atzD foi avaliada pelo método Northern Blot, contudo apenas o isolado Pseudomonas sp. apresentou expressão diferencial após tratamento com atrazina. Análises em HPLC/DAD e LC-MS/MS demonstraram que o isolado Pseudomonas sp. apresenta um perfil de degradação da atrazina semelhante ao perfil do micro-organismo padrão Pseudomonas sp. ADP, sendo apto a degradar 99% de atrazina in vitro em 24 horas. Já o isolado Achromobacter sp. apresentou um perfil de degradação lento, com início do processo após 24 horas. Os três metabólitos iniciais formados pela degradação da molécula de atrazina foram detectados em amostras contendo tanto o isolado Pseudomonas sp. quanto o isolado Achromobacter sp. O consórcio bacteriano composto pelos dois isolados deste estudo não apresentou eficiência de degradação superior às culturas puras. Por fim, um experimento de campo foi realizado com o objetivo de analisar os efeitos da atrazina na comunidade bacteriana do solo. O herbicida atrazina foi aplicado ao solo e amostras foram coletadas para análise através das técnicas de qPCR e Sequenciamento de Nova Geração. Foi possível observar que a abundância dos genes responsáveis pelo início da via de degradação da atrazina se altera ao longo do tempo, sendo que o aumento mais expressivo foi observado no gene trzN, comumente encontrado em bactérias gram-positivas com capacidade para degradar a atrazina. O sequenciamento do gene 16S rRNA indicou que a aplicação de atrazina ao solo não provocou mudanças significativas na comunidade bacteriana. As amostras apresentaram alta diversidade antes e após o tratamento com atrazina e a análise ii da abundância relativa mostrou pequenas diferenças na abundância de famílias após quatro e oito semanas de aplicação da atrazina ao solo. Assim, é possível sugerir que a aplicação do herbicida atrazina ao solo nas doses recomendadas não provoca danos significativos na estrutura da comunidade bacteriana do solo. / Atrazine, a triazine herbicide widely used to control broadleaf weeds, is a potential contaminant of soils, groundwater, rivers, lakes and oceans. Its main route of degradation is a biological pathway. Pseudomonas sp. ADP is a standard bacterium in the process of atrazine mineralization in contaminated environments, because it possesses a plasmid that contains the genes atzA, atzB, atzC, atzD, atzE and atzF, which encode the enzymes responsible for the atrazine degradation process. Gram-positive bacteria also have the ability to degrade atrazine, but the degradation starts through the trzN gene, wich is analogue to atzA. The aim of the present work was to obtain and analyze a bacterial isolate or a consortium formed by two or more bacteria capable of completely degrade the herbicide atrazine and to analyze the effects of atrazine on the soil bacterial community. Two gram-negative microorganisms, A01 and A02, were isolated from soil samples and were identified as Achromobacter sp. and Pseudomonas sp., respectively, through the sequencing of the 16S rRNA gene. Both microorganisms showed potential to degrade atrazine on solid medium, but only the isolate Pseudomonas sp. presented the genes atzA, atzB, atzC, atzD, atzE and atzF that are essential for the biodegradation process. Achromobacter sp. presented only the atzA, atzB and atzC genes, which represent the initial pathway of atrazine degradation that leads to the formation of cyanuric acid. An assay using Southern Blot was performed to verify if the atz genes detected in the isolates were located on plasmid, however only Pseudomonas sp. showed a plasmid. The atz gene expression was evaluated through Northern Blot methodology, but only Pseudomonas sp. showed differential expression after atrazine induction. Analyzes in HPLC/DAD and LC-MS/MS demonstrated that the isolate Pseudomonas sp. presents an atrazine degradation profile similar to the profile of Pseudomonas sp. ADP and is capable of degrading 99% of atrazine in vitro. The strain Achromobacter sp. presented a slow degradation profile and started the degradation process after 24 hours of incubation. The three initial metabolites formed after atrazine degradation were detected in samples containing both Pseudomonas sp. and Achromobacter sp. The bacterial consortium composed of the two isolates of this study did not show higher degradation efficiency than pure cultures. Lastly, a field experiment was performed in order to study the effects of atrazine on the soil bacterial community. The herbicide atrazine was applied to the soil and samples were collected to be analysed using qPCR and Next Generation Sequencing. It was possible to observe that the abundance of the atz genes that initiate the degradation process is changed over time. A significant increase was observed on trzN, which is commonly found in gram-positive bacteria that is capable of degrading atrazine. 16S rRNA gene sequencing indicated that atrazine application to soil do not cause significant changes in the bacterial community. Soil samples presented high diversity before and after atrazine treatment and the relative abundance analysis showed slight differences in families abundance after four and eight weeks of atrazine application to soil. Therefore, the results suggest that the use of atrazine in recommended doses does not cause significant damage to the structure of the soil bacterial community.

Fungos fitopatogênicos veiculados por sementes de soja podem causar sérios prejuízos à cultura, bem como danos diretos reduzindo o poder germinativo, vigor e emergência das sementes. A detecção e identificação precisa de fitopatógenos é uma das estratégias mais importantes para iniciar as medidas preventivas ou curativas no controle de doenças de plantas. Para se evitar a introdução e propagação de patógenos em áreas onde ainda não ocorrem, uma atenção especial deve ser tomada na detecção de agentes patogênicos em sementes. Os métodos tradicionalmente utilizados para detectar e identificar fungos em sementes são, muitas vezes, demorados, laboriosos e exigem um conhecimento extenso de taxonomia clássica. Métodos moleculares têm sido utilizados para detectar, identificar e quantificar uma longa lista de fungos fitopatogênicos. A técnica da reação em cadeia da polimerase em tempo real (qPCR) é atualmente considerada a mais eficiente para a detecção de fitopatógenos, não exigindo conhecimentos taxonômicos especializados para interpretar seus resultados. Considerando a importância e as implicações da diagnose rápida e bem sucedida de agentes patogênicos em sementes de soja, este estudo teve como objetivo estabelecer uma metodologia para elevar a eficiência de detecção dos fungos fitopatogênicos Sclerotinia sclerotiorum, Colletotrichum truncatum, Phomopsis spp. e Corynespora cassiicola, encontrados com maior frequência em sementes de soja, por meio de qPCR. Iniciadores e sondas de hidrólise TaqMan® foram projetados para os diferentes patógenos e avaliados quanto à sua especificidade e sensibilidade. Curvas padrões, baseando-se em diluições seriadas dos DNAs alvos de iniciadores e sondas específicas, foram estabelecidas para a quantificação desses patógenos. Amostras de sementes de soja naturalmente infectadas, provenientes dos Estados de Goiás, Minas Gerais e Paraná, foram submetidas a testes de detecção por meio de qPCR e métodos tradicionais, para fins de comparação. De todos os iniciadores e sondas projetados, apenas os de Phomopsis spp. e S. sclerotiorum apresentaram-se específicos e sensíveis, viabilizando sua utilização na detecção desses patógenos. Por meio dos testes tradicionais de detecção, Phomopsis spp. apresentou incidência máxima de 2,75% em uma amostra de Minas Gerais e S. sclerotiorum não foi detectado em nenhuma das amostras avaliadas. O método de qPCR proporcionou a detecção de Phomopsis spp. em todas as amostras testadas, alcançando o nível de incidência máximo de 6,75%. em amostra de Minas Gerais. S. sclerotiorum não foi detectado em nenhuma das amostras avaliadas pelo método de qPCR. Comparando-se os métodos de detecção testados, a qPCR foi mais sensível na detecção de Phomopsis spp. em sementes de soja. / Seed-born pathogenic fungi in soybean can cause serious damage to the crop, as well as direct damage by reducing seeds germination, vigor and emergence. The detection and accurate identification of plant pathogens is one of the most important strategies to initiate preventive and curative measures in the management of plant diseases. Particular attention should be taken in the detection of pathogens in seeds in order to avoid introduction and spread of pathogens in areas where they do not occur. The traditionally used methods for detection and identification of seed-born pathogenic fungi are often time consuming, laborious and require extensive knowledge of classical taxonomy. Molecular methods have been used to detect, identify and quantify a long list of plant pathogenic fungi. Quantitative real time polymerase chain reaction (qPCR) is currently considered the most efficient technique for the detection of pathogens because it does not require specialized taxonomical knowledge to interpret its results. Given the importance and implications of rapid and successful diagnosis of seed-born pathogenic fungi in soybean, this study aimed to establish a qPCR methodology to increase the detection efficiency of plant pathogenic fungi Sclerotinia sclerotiorum, Colletotrichum truncatum, Phomopsis spp. and Corynespora cassiicola, the most commonly occurring seed-born pathogenic fungi. Primers and TaqMan® hydrolysis probes were designed for these four pathogens and tested for specificity and sensitivity. Standard curves were established to quantify these pathogens, based on serial dilutions of the target DNA and specific primers and probes. Samples of naturally infected soybean seed from the states of Goiás, Minas Gerais and Paraná were subjected to detection tests using qPCR and traditional methods, for comparison purposes. From all primers and probes designed, only those for Phomopsis spp. and S. sclerotiorum showed up specificity and sensitivity, enabling their use to detect of these pathogens. Detection by traditional tests, resulted in a maximum Phomopsis spp. incidence of 2.75% in a sample from Minas Gerais and S. sclerotiorum was not detected in any of the samples. The detection and quantification of these pathogens by qPCR revealed the presence of Phomopsis spp. in all tested samples, the highest incidence level of 6.75% in a sample from Minas Gerais. S. sclerotiorum was not detected in any sample assessed by qPCR method. In comparison with traditional methods, qPCR was more sensitive in detecting Phomopsis spp. in soybean seeds.

A transmissão oral ganhou destaque devido aos recentes surtos que ocorreram no Brasil com a ingestão de alimentos contaminados, além dessa via outra de grande importância é a transmissão transplacentária, sendo assim o presente trabalho associou as duas formas de transmissão da doença, juntamente com o tratamento com o benzonidazol único medicamento disponível no Brasil para o tratamento da doença. O medicamente é adotado somente para o tratamento da fase aguda, porém alguns pesquisadores mostraram alguns benefícios da terapia com benzonidazol na fase crônica da doença podendo o medicamento diminuir o avanço da doença e prolongar a soro conversão negativa em pacientes intermediários. Assim o objetivo deste trabalho foi de investigar a eficácia do tratamento tanto na fase aguda quanto na fase crônica da doença, bem como o efeito do tratamento em fêmeas de fase crônica. Utilizou-se camundongos Balb/c infectados com 2 x 105 formas tripomastigotas sanguíneos da cepa RC de T. cruzi administrado via oral. Os animais de fase aguda tratados receberam 50mg/Kg/dia de benzonidazol por 16 dias enquanto que aos animais de fase crônica o tratamento se iniciou ao 3º dia de gestação sendo administrado pelo mesmo período. O curso da parasitemia sanguínea foi verificada bem como ao fim do tratamento a parasitemia tecidual em baço, fígado e coração; placenta e feto, quando havia, empregando-se as técnicas de qPCR, com dois distintos métodos de cálculos matemáticos, imunofluorescência em microscopia confocal e análise histopatológica por coloração HE. A administração de benzonidazol proporcionou a diminuição das cargas parasitárias de baço, fígado e coração elucidando a eficácia do medicamento também em fase crônica. Porém em placenta e feto o medicamento gerou aumento de parasitas teciduais nos grupos que receberam tratamento em detrimento aos que não receberam. Deste modo, podemos sugerir que o tratamento com benzonidazol pode ser indicado para minimizar a carga de parasitas ou até mesmo para sua completa erradicação em indivíduos em fase crônica. Bem como, sugerimos que o medicamento deve ser ofertado por maior tempo aos indivíduos chagásicos tanto na fase aguda quanto na fase crônica visto que apresenta melhores resultados com o prolongamento da terapia. Entrementes dissuadimos o tratamento durante o período gestacional visto que, pode induzir a diminuição das barreiras imunológicas maternas e/ou facilitar a migração parasitária para os tecidos placentários e fetais. / Chagas\' disease affect millions of people around the world and the benznidazole is the only drug for the treatment in Brazil, but it is used basically for the acute phase of the disease. Some researchers showed many benefits of benznidazole therapy in chronic phase like reduction of the progression of the disease. Therefore, the objective of this work was investigate the efficacy of treatment in both acute and chronic phase of this disease, as well as the effect of treatment of female mouse in chronic phase. Balb/c mice were infected with 2 x 105 trypomastigotes forms of RC strain of Trypanosoma cruzi by oral route. Mice in acute phase were treated with 50mg/Kg/day Benznidazole for 16 days. Some chronically-infected mice were treated by 3rd to 18th day of gestation with the same dose. Blood parasitaemias were determined by microscopic examination of tail vein blood amount. Tissues parasitism were determined by qPCR with two different mathematical forms, immunofluorescence confocal microscopy and histopathology by HE staining. Administration of benznidazole promoted decrease of parasites in spleen, liver and heart indicating the efficacy of the drug in the chronic phase. However in placenta and fetus the drug caused tissues parasites increased in the groups that received treatment. Therefore, we suggest that the treatment with benznidazole would be indicated to minimize the number of parasites or eliminate them in individuals in chronic phase. As well, we suggest that the drug should be offered for longer chagasic individuals to both acute and chronic phase because it shows better results with prolonged therapy. However, our results indicate the treatment do not be offered during pregnancy because it can induce the decrease of maternal immunological barriers and facilitate the parasite migration to the placental and fetal tissues.

Introdução: A água tem sido considerada um importante veículo para a disseminação de surtos de toxoplasmose em vários países. Os oocistos de Toxoplasma gondii podem persistir no ambiente durante longos períodos, sendo altamente resistentes aos vários processos químicos de inativação, inclusive aos processos comuns de desinfecção utilizados pelos sistemas produtores de água. Pouco se tem registrado no país sobre a real extensão da contaminação dos recursos hídricos por Toxoplasma gondii, sendo que a sua detecção em amostras de águas é muito importante na implantação de ações preventivas. As metodologias existentes no momento para identificação e quantificação deste parasita nestes tipos de amostras não estão universalmente padronizadas e apresentam limitações. Objetivo: O presente estudo teve como objetivo verificar a possível presença do protozoário em águas superficiais de abastecimento público no Estado de São Paulo mediante a implantação de uma metodologia específica para a quantificação de oocistos de Toxoplasma gondii por reação quantitativa de PCR em tempo real nessas amostras. Método: Um total de 39 amostras de águas superficiais provenientes de 10 mananciais do Estado de São Paulo foram analisadas durante o período de maio a dezembro de 2015. Volumes de 20L da amostra foram concentrados por meio de filtração em cápsulas Envirocheck® HV (Pall Gelman Laboratory), sendo a cápsula filtrante tratada com uma solução dispersante, eluída e o eluato concentrado por centrifugação. O sedimento obtido após a centrifugação da amostra foi submetido à extração de DNA, sendo utilizado o kit de extração PowerSoil DNA isolation® (MO BIO Laboratories). A sequência alvo selecionada para detecção e quantificação de oocistos de Toxoplasma gondii através da reação quantitativa de PCR em tempo real foi um fragmento de 62 pares de bases do gene B1, sendo utilizado o seguinte conjunto de iniciadores: 5 CTAGTATCGTGCGGCAATGTG 3 (531-551) e 5GGCAGCGTCTCTTCCTCTTTT 3 (571-592). A sonda utilizada foi: 5 (6-FAM) CCACCTCGCCTCTTGG-(NFQ-MGB) 3. Resultados: Do total das amostras analisadas, 7,7 por cento (3/39) foram positivas para oocistos de Toxoplasma gondii e dentre os 10 mananciais estudados, detectou-se a ocorrência do protozoário em 30 por cento (3/10) dos mesmos. Conclusão: Os dados obtidos no presente estudo demonstram que o protozoário Toxoplasma gondii está circulando em águas superficiais de abastecimento público no Estado de São Paulo. / Introduction: Water is an important vehicle for the spread of toxoplasmosis outbreaks in several countries. Toxoplasma gondii oocysts may remain for a long period in the environment and are highly resistant to chemical inactivation, including the routine classical disinfection procedures in water treatment facilities. Few reports have been published in Brazil about the real extent of the contamination of water resources by Toxoplasma gondii, which is of major importance to implement preventive actions. Methods for the identification and quantification of the parasite in water bodies are not standardized and have limitations. Objective: This study aimed to verify the presence of these protozoa in surface waters used as source for drinking water production in the State of São Paulo by implementing a specific methodology to quantify Toxoplasma gondii oocysts with quantitative real-time PCR. Method: Thirty nine samples of surface waters from 10 different sites in the State of São Paulo were analized from May to December 2015. Volumes of 20L of each sample were concentrated by filtration with capsule Envirocheck® HV (Pall Gelman Laboratory).The filter capsule was treated with a dispersant solution, eluted, and the eluate concentrated by centrifugation. DNA was extracted from the resulting pellet with PowerSoil DNA isolation® (MO BIO Laboratories) extraction kit. A fragment of 62 base pairs of the B1 gene was selected as target sequence for detection and quantitation the Toxoplasma gondii oocysts by the quantitative real-time PCR reaction, and the following primers: 5\' TAGTATCGTGCGGCAATGTG 3\' (531-551) and 5\'GGCAGCGTCTCTTCCTCTTTT 3\' (571-592) were used. The probe employed was 5 \'(6-FAM) CCACCTCGCCTCTTGG- (NFQ-MGB) 3\'. Results: Toxoplasma gondii oocysts were detected in 30 per cent (3/10) of the sites evaluated and 7.7 per cent (3/39) of all samples analyzed were positive. Conclusion: The results of the present study show that the protozoan Toxoplasma gondii is circulating in surface waters used as drinking water supply in the State of São Paulo.