The work described in this thesis involves the study of weak interactions by NMR spectroscopy and using them to develop novel applications. The two different applications chosen are i) using molecular interactions for chiral discrimination and ii) understanding the nature of the interaction between peptide and nanoparticles to develop potent antibacterial agents. The thesis, which is divided into five chapters starts with a general introduction of NMR spectroscopy for the study of molecular interactions in conjunction with other techniques. The remaining four chapters focus on four different areas/projects that I have worked on. Chapter 1: Introduction This chapter reviews different kinds of molecular interactions along with the introduction to NMR spectroscopy and other techniques used for all the studies. Starting with the application of chiral discrimination the chapter proceeds to the general introduction of antimicrobial peptides, silver nanoparticles and the strategy for peptide resonance assignment. Chapter 2: Chiral discrimination for versatile functionalities There are many chiral agents available for discriminating enantiomers which mainly target specific functional groups. In this study, we have explored a strategy involving ternary complexation to investigate chiral discrimination of different kind of functional groups by NMR spectroscopy. The proposed protocol was employed for the enantiodiscrimination of molecules containing functional groups, such as amino alcohols, secondary alcohols, cyanohydrins, oxazolidones, diols, thiones and epoxides, using a phosphorous based three component mixture. The simple mixing and shaking of enantiopure 1,1’-binaphthyl-2,2’-diyl hydrogenphosphate (BNPA), 4-(dimethylamino)pyridine (DMAP) and a chiral analyte in the solvent CDCl3 served as a chiral solvating agent and resulted in well-dispersed peaks for each enantiomer in the 1H NMR spectrum. Discrimination was achieved not only for the proton at the chiral center but also for multiple proton sites. The J-resolved technique was used for alleviating the spectral complexity pattern to accurately measure the chemical shift difference. The devised approach also permitted the precise measurement of the enantiomeric excess (ee). Chapter 3: Simultaneous discrimination of secondary alcohols and carboxylic acids In this chapter, I describe two novel ternary ion-pair complexes, which serve as chiral solvating agents (CSA), for enantio discrimination of secondary alcohols and carboxylic acids. The superiority of CSA over other auxiliaries arises due to the formation of diastereomeric complexes through non-covalent interactions with the analyte. By exploiting the acid-base interaction strategy and employing DMAP, which further enhanced the hydrogen bonding efficiency the discrimination for both carboxylic acids and secondary alcohols were achieved. The protocol for discrimination of secondary alcohols is designed by using one equivalent mixture each of enantiopure mandelic acid, 4-dimethylaminopyridine (DMAP) and a chiral alcohol. For discrimination of carboxylic acids, the ternary complex is obtained by one equivalent mixture each of enantiopure chiral alcohol, DMAP, and a carboxylic acid. Furthermore, the formation of the complex was supported by calculating the energy-minimized structure of the proposed complex by density functional theory (DFT). The designed protocols also permit accurate measurement of the enantiomeric composition. Chapter 4: Enhanced potency of nanoparticle-antimicrobial peptide conjugates Antibiotic resistance is emerging as the new global health problem. Due to the blatant misuse and overuse of these drugs has resulted in the bacteria becoming resistant to a wide range of antibiotics. Researchers have found an alternative of current antibiotics which are a group of peptides known as antimicrobial peptides (AMP). But using these molecules as drug is rather costly due to high synthesis cost. Further the antibacterial activity of silver nanoparticle is well established. However, due to its toxic nature after, it cannot be used in high concentration. The conjugation of nanoparticles with antimicrobial peptides is emerging as a promising route to achieve superior anti-microbial activity. However, the nature of peptide-nanoparticle interactions in these systems remains unclear. This study describes the interactions of antimicrobial peptide with silver nanoparticles by NMR spectroscopy in conjunction with other biophysical techniques to completely understand the underlying mechanism of interaction between nanoparticles and peptide. It reveals that the conjugation process involves dynamic interaction between the nanoparticle and the peptide. This study also confirms the enhanced antibacterial efficiency of the nano-conjugate towards bacterial killing compared to the nanoparticle or the peptide alone. Chapter 5: Mechanistic insights into the action of nano-conjugates It is well established that antimicrobial peptides act as pore-formers to rupture the bacterial cells. This chapter is focused on studying the mechanism of action of the nano-conjugate with bacterial membrane mimic models. This study for the first time reveals the details of nanoconjugate membrane interaction at an atomic level. The pore formation mechanism and the enhanced efficiency of the nanoconjugate were explored using fluorescence spectroscopy, CD spectroscopy, and NMR spectroscopy. Structural changes of the peptide and the nanoparticle bound peptide have been captured which infers the propensity of the peptide to form a helical structure upon interacting with the membrane. The calculated structure of the peptide and nanoparticle bound peptide remains almost identical in presence of the membrane mimic environment. In the case of the nanoconjugate, the increase in local positive charge concentration makes the system to penetrate the bacterial membrane faster which further allows the nanoparticle to access the intercellular organelles easily. This dual mode of mechanism thus makes this nano-conjugate a promising antibacterial agent towards multi drug resistant bacteria. In summary, the thesis has focused on the studies of weak intermolecular interactions in different chemical and biological systems using NMR spectroscopy. It is demonstrated that in certain chemical systems, such interactions can be exploited to discriminate enantiomers and determine the enantiopurity of compounds by NMR. In the case of biomolecules, such weak interactions exist when protein or peptides interact with nanoparticles. Using silver nanoparticles, it is shown that such interactions result in a stable conjugate system. NMR spectroscopy provides valuable insights into the structure and dynamics of the system. Further, by using anti-microbial peptides conjugated with silver nanoparticles, new superior antibacterial agents can be developed.

In this thesis molecular interactions between polypeptide conjugates and protein targets were investigated. Polypeptides were derivatized with small organic molecules, peptides and oligonucleotides. New strategies were developed with the aim to increase affinities for proteins of biological interest. A 42-residue polypeptide (4-C15L8) conjugated to a small organic molecule 3,5-bis[[bis(2-pyridylmethyl)amino]methyl]benzoic acid (PP1), was shown to bind glycogen phosphorylase a (GPa) in the presence of zinc ions. Under the assumption that hydrophobic interactions dominated the binding energy, the hydrophobic residues of 4-C15L8-PP1 were systematically replaced in order to study their contribution to the affinity enhancement. The replacement of the Nle, Ile and Leu residues by Ala amino acids reduced affinities. The introduction of non-natural L-2-aminooctanoic acid (Aoc) residues into the peptide sequence enhanced the binding affinity for GPa. A decreased KD of 27nM was obtained when Nle5, Ile9 and Leu12 were replaced by Aoc residues, in comparison to the KD value of 280nM obtained for the unmodified 4-C15L8-PP1. It is evident that there are non-obvious hydrophobic binding sites on the surfaces of proteins that could be identified by introducing the more hydrophobic and conformationally flexible Aoc residues. The downsizing of the 42-mer peptide to an 11-mer and the incorporation of three Aoc residues gave rise to a KD of 550 nM, comparable to that of  4-C15L8-PP1 suggesting that bioactive peptides can be downsized by the introduction of Aoc. Aiming to improve in vivo stability, the affinity for human serum albumin (HSA) of hydrophobic, positively and negatively charged polypeptide-PP1 conjugates was evaluated. Increased hydrophobicity due to the introduction of Aoc residues did not significantly increase the affinity for HSA. No binding was observed in the case of the most negatively charged polypeptides whereas the slightly negatively and positively charged polypeptides conjugated to PP1 bound HSA with affinities that increased with the positive charge. It was found that polypeptide-PP1 conjugates target the zinc binding site of the HSA. Affinity enhancement was obtained due to the incorporation of PP1 and increased by charge to charge interactions between the positively charged amino acids of the polypeptide and the negatively charged residues of HSA, in close proximity to the HSA zinc binding site. The survival times of the peptide-PP1 conjugates in human serum were extended as a result of binding to HSA. Zn2+ ion chelating agents can be incorporated in potential peptide therapeutics with a short plasma half-life, without increasing their molecular weights.

La thèse est intitulée « Modifications chimiques de polysaccharides pour l'obtention de nouveaux systèmes polymère-principe actif ». Le thème de la recherche porte sur trois axes principaux, dont l’objectif majeur est la synthèse et la caractérisation de nouveaux systèmes pour la libération contrôlée de principes actifs. Le premier chapitre traite de l’optimisation de la méthode pour préparer des émulsions stables simples inverses (eau/huile) et multiples (eau/huile/eau) à base de polysaccharides (amidon et 2-hydroxyethyle cellulose). On a étudié le processus de relargage de la caféine, l’influence de la présence d’amidon dans la phase aqueuse sur la stabilité et cinétique de libérations. Le second chapitre a pour objet l’obtention de nouveaux principes actifs à partir d’aminoacides et leur immobilisation sur polysaccharides par couplage chimique covalent. Les conjugues polymère-médicament obtenus ont été caractérisés par spectroscopie, physico-chimie. Leur activité antimicrobienne, leur toxicité in vivo, l’efficacité de l’immobilisation et la cinétique de relargage in vitro de médicaments couplés ont été étudiées. Le dernier chapitre traite de la synthèse des dérivés de chitosane avec l’anhydride maléique et l’acide acrylique, ainsi que leur utilisation dans la préparation d’hydrogels sous forme de films et de nanoparticules par copolymérisation avec le méthacrylate de 2-hydroxyethyle et l’acrylamide de N- isopropyl. Les dérivés ont été évalués par leur degré de fonctionnalisation. Les nanosystèmes ont été caractérisés par leur potentiel zêta, leur capacité de gonflement, d’adhésion et de relargage in vitro. Tous les résultats expérimentaux ont été soutenus par importantes études bibliographiques / The thesis is entitled “Chemical modifications of polysaccharides for the obtaining of new drug-polymer systems“. The topic of research includes four main working axes, diverted from the major objective to synthesize and characterize new drug delivery systems. The first chapter treats the optimization of the preparation method of stable simple W/O emulsions and multiple W/O/W emulsions, based on polysaccharides (starch and 2-hydroxyethyle cellulose). We also studied the process of caffeine release outside the multiple emulsions particles and the influence of starch in the internal aqueous phase stage upon the stability and the drug release kinetics. The second chapter studies the obtaining of new active principles from aminoacid and their immobilization on polysaccharides by covalent coupling. The new drug-polymer conjugates were characterized by spectral, physicochemical properties, antimicrobial activity, in vivo toxicity, immobilization efficiency and I vitro drug release kinetics. The last chapter treats the synthesis of the chitosan derivatives with maleic anhydride or acrylic acid, and their use in the preparation of hydrogels as film and nanoparticles by copolymerization with 2-hydroxymethacrilate or N-isopropyl acrylamide. The derivatives were evaluated by determining the degree of functionalization and by spectral methods. The nanosystems were characterized by measurements of zeta potential, swelling and adhesion capacity and membership and in vitro drug release kinetics. All experimental results were supported by important bibliographic studies

The misassembly of soluble proteins into toxic aggregates, including amyloid fibrils, underlies a large number of human degenerative diseases. Cardiac amyloidosis, which is most commonly, caused by aggregation of Immunoglobulin (Ig) light chains or transthyretin (TTR) in the cardiac muscle, represent an important and often underdiagnosed cause of heart failure. TTR-mediated amyloid cardiomyopathies are chronic and progressive conditions that lead to arrhythmias, biventricular heart failure, and death. As no Food and Drug Administration-approved drugs are currently available for treatment of these diseases, the development of therapeutic agents that prevent TTR-mediated cardiotoxicity is desired. AG10 is a potent and selective kinetic stabilizer of TTR. AG10 prevents dissociation of TTR in serum samples obtained from patients with amyloid cardiomyopathy. The oral bioavailability and selectivity of AG10, makes it a very promising candidate to treat TTR amyloid cardiomyopathy. Understanding the reason behind the potency of AG10 would be beneficial for designing stabilizers for other amyloid diseases. This would be possible by designing and synthesizing structural analogues of AG10. Here we report the synthesis, characterization and analysis of AG10 analogs and the comparison of the in vitro activities of the synthesized analogs. The tremendous therapeutic potential of peptides has not been fulfilled and potential peptide therapies that have failed far outnumber the successes so far. A major challenge impeding the more widespread use of peptides as therapeutics is their poor pharmacokinetic profile, due to short In vivo half-life resulting from inactivation by serum proteases and rapid elimination by kidneys. Extending the In vivo half-life of peptides is clearly desirable in order for their therapeutic potential to be realized, without the need for high doses and/or frequent administration. Covalent conjugation of peptides to macromolecules (e.g. polyethylene glycol or serum proteins such albumin) has been the mainstay approach for enhancing the In vivo half-life of peptides. However, the steric hindrance and immunogenicity of these large macromolecules often compromises the In vivo efficacy of the peptides. Recently, our laboratory established the first successful reversible method of extending the half-life of peptides using serum protein TTR. The approach involved the use of a TTR Ligand for Half-life Extension (TLHE-1) which binds to TTR with high specificity and affinity. We have shown that our technology extends the half-life of multiple peptides without seriously affecting their activity. Our main objective here is to modify the structure of TLHE1 using linkers with different length and composition to optimize its affinity and selectivity for TTR in human serum.

Cancer is not only difficult to treat but the patients also suffer from the pain associated with anticancer treatments. Targeted chemotherapeutics can reduce the adverse effects by reducing the dose required for tumor cell kill. Cancers of various origins often have characteristic marker molecules that distinguish them from the normal tissues. Folate receptors are such marker molecules present in ovarian and cervical cancers. The hypothesis for the current study is that amphiphiles constructed out of folic acid, the natural ligand for the folate receptor, can deliver paclitaxel, a chemotherapeutic compound, to folate receptor expressing cancer cells. To test this hypothesis, amphiphilic molecules were synthesized out of folic acid and fatty acids or long chain aliphatic amines. The gamma carboxylic group of folic acid was converted to an N-alkyl substituted amide. The alkyl group had various chain lengths varying from eleven methylene groups to seventeen methylene groups giving rise to a number of amphiphiles. The amphiphiles formed micelles in aqueous solutions. The critical micellization concentrations of the amphiphiles were measured by pyrene fluorescence and were found to be in the range of 10–70μM. HeLa and Caco-2 cells were taken as in vitro tumor models. Folate receptor expression was verified in HeLa and Caco-2 cells by western blot analysis. HeLa showed more than forty fold expression of the receptor when compared to Caco-2 and was chosen as receptor positive cell line while Caco-2 served as a negative control. Uptake of the folate labeled delivery system in the cell lines was tested by a fluorescent probe (aminocoumarin) labeled amphiphile. To test the specificity of the delivery system towards the receptor positive HeLa cells, the receptors were knocked down (70%) by folate receptor specific siRNA. Fluorescent amphiphile uptake in the knockdown cells was comparable to that of the negative control, Caco-2. Finally cytotoxicity studies were performed for paclitaxel formulated with the folate labeled amphiphiles and compared to free drug treatment in HeLa and Caco-2. IC50 values in HeLa for formulations with the folate labeled amphiphiles were ten folds less than those observed for free drug treatment whereas in Caco-2 no significant difference was noted.

No description available.

No description available.

During last three decades, a great effort was invested to the development of polymer conjugates of low molecular drugs with the aim to improve the specific targeting of drugs to diseased tissues, cells and organs. The main reason for this effort was the fact that high molecular weight copolymers have a favourite distribution profile in tissues and organisms. A linker between a polymer backbone and drug has very important role: it is possible to synthesize a biodegradable linker, which can be enzymatically hydrolyzed. Conversely, there is a possibility to synthesize an inert linker, resistant to the hydrolysis. Proper choice of the suitable precursor- polymer is also essential, hence it has to accomplish all of the stringent demands for biocompatibility. Macromolecular polymer-drug conjugates tend to accumulate in solid tumors because of the so called enhanced permeability and retention (EPR) effect. There is a whole range of possible applications of high molecular polymer-drug conjugates. In the introduction part of this thesis, I summarize potential use of drugs based on poly(N-(2-hydroxypropyl)methacrylamide) (HPMA) copolymers. Moreover, I introduce some therapeutically important proteins used in experimental drug discovery. In our laboratory, we have developed a concept of HPMA copolymers...

Chez des patients allergiques, il est possible de retrouver dans leur sérum desanticorps spécifiques du médicament (IgE) et dans leur sang des lymphocytes T spécifiquesdu médicament. La présence de LT spécifiques du médicament chez des patients allergiquessuggère la présentation du médicament par des cellules présentatrices d’antigène telles queles cellules dendritiques.Nous nous sommes alors intéressés à mieux comprendre l’implication deslymphocytes T et des cellules dendritiques dans le développement des allergies auxantibiotiques comme la pénicilline G (ou Benzyl-Pénicilline) ou le sulfaméthoxazole.Ce travail de thèse a permis: i) de démontrer la présence de lymphocytes Tspécifiques de la pénicilline G dans le sang périphérique de donneurs non allergiques à unefréquence mesurable, ii) de développer deux approches expérimentales et de modélisationpour l’identification des épitopes potentiellement présentés aux lymphocytes T et iii)d’étudier l’effet des médicaments sur les cellules dendritiques.Les perspectives de ce travail sont de mieux comprendre les mécanismes impliquésdans les allergies médicamenteuses au niveau des lymphocytes T et des cellules dendritiqueset de développer des tests de prédiction du « potentiel allergique » des médicaments, afinde mieux prédire les allergies médicamenteuses lors du développement des médicaments. / In allergic patients, antibodies like IgE or T-lymphocytes specific for the drugimplicated can be detected and measured. Presence of T-lymphocytes specific for the drugin allergic patients suggested the presentation of the culprit drug to T-lymphocytes byantigen presenting cells like dendritic cells.We were interested in better understanding the implication of T-lymphocytes anddendritic cells in the development of antibiotics allergies such as penicillin G (or Benzyl-Penicillin) or sulfamethoxazole.The results obtained in this work allowed us: i) to demonstrate the presence ofbenzyl-penicillin-specific T cells in the peripheral blood of non-allergic donors, at adetectable frequency; ii) to develop two approaches: one experimental and one usingmodelisation for the identification of epitopes potentially presented to T-lymphocytes andiii) to study the effect of drugs on DC.The perspectives of this research work are to better understand the mechanismsimplicated in drug allergies and to develop predictive tests for “drug allergic potential", inorder to be able to better predict drug allergies during drug development.

The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)