Chez des patients allergiques, il est possible de retrouver dans leur sérum desanticorps spécifiques du médicament (IgE) et dans leur sang des lymphocytes T spécifiquesdu médicament. La présence de LT spécifiques du médicament chez des patients allergiquessuggère la présentation du médicament par des cellules présentatrices d’antigène telles queles cellules dendritiques.Nous nous sommes alors intéressés à mieux comprendre l’implication deslymphocytes T et des cellules dendritiques dans le développement des allergies auxantibiotiques comme la pénicilline G (ou Benzyl-Pénicilline) ou le sulfaméthoxazole.Ce travail de thèse a permis: i) de démontrer la présence de lymphocytes Tspécifiques de la pénicilline G dans le sang périphérique de donneurs non allergiques à unefréquence mesurable, ii) de développer deux approches expérimentales et de modélisationpour l’identification des épitopes potentiellement présentés aux lymphocytes T et iii)d’étudier l’effet des médicaments sur les cellules dendritiques.Les perspectives de ce travail sont de mieux comprendre les mécanismes impliquésdans les allergies médicamenteuses au niveau des lymphocytes T et des cellules dendritiqueset de développer des tests de prédiction du « potentiel allergique » des médicaments, afinde mieux prédire les allergies médicamenteuses lors du développement des médicaments. / In allergic patients, antibodies like IgE or T-lymphocytes specific for the drugimplicated can be detected and measured. Presence of T-lymphocytes specific for the drugin allergic patients suggested the presentation of the culprit drug to T-lymphocytes byantigen presenting cells like dendritic cells.We were interested in better understanding the implication of T-lymphocytes anddendritic cells in the development of antibiotics allergies such as penicillin G (or Benzyl-Penicillin) or sulfamethoxazole.The results obtained in this work allowed us: i) to demonstrate the presence ofbenzyl-penicillin-specific T cells in the peripheral blood of non-allergic donors, at adetectable frequency; ii) to develop two approaches: one experimental and one usingmodelisation for the identification of epitopes potentially presented to T-lymphocytes andiii) to study the effect of drugs on DC.The perspectives of this research work are to better understand the mechanismsimplicated in drug allergies and to develop predictive tests for “drug allergic potential", inorder to be able to better predict drug allergies during drug development.

The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)

Theory has been used to complement experiment in the development of both drugs and delivery systems. Theoretical methods are capable of identifying the molecular basis of drug formulation inadequacies and systematic theoretical studies may suggest fruitful avenues for material modification. This thesis highlights the utility of computer-based theoretical calculations for guiding the design of drug formulations and enhancing material-drug compatibility and stability. Specifically, the present work explores the applications of semi-empirical methods and atomistic molecular dynamics (MD) simulations to enhance the performance of nano-emulsions and polymer micelle formulations for the delivery of hydrophobic drugs. This work includes three separate studies preceded by an introductory summary of available theoretical techniques. The first study evaluates the accuracy and reliability of semi-empirical methods and MD simulations as means to select suitable excipients to formulate the anti-cancer drug docetaxel in an emulsion. Here, simulations accurately predict the rank order of drug solubility in various excipients, suggesting that simulation is useful for library enrichment. In the second study, a drug conjugation approach is used to further improve the stability and solubility of docetaxel in a triglyceride-based nano-emulsion. Here, optimal conjugates are identified with computer-based theoretical calculations and conjugates with formulation-compatible moieties are synthesized. As predicted, the conjugates exhibit enhanced solubility and loading efficiency in a nano-emulsion. The goal of the third study is to rationally design a stable unimolecular star copolymer that, as a unimer, does not disassemble upon the dilution that accompanies intravenous injection. Here, MD simulation is used to systematically investigate the solution properties of differently composed star copolymers. Overall, star copolymers with a hydrophobic PCL core ≤ 2 kDa and hydrophilic PEG blocks approaching 14.6 kDa per arm are predicted to form unimolecular micelles that remain unimeric at high concentrations. The studies presented in this thesis demonstrate that theoretical approaches are useful for fast pre-screening of drug formulation materials and for the development of delivery systems and drug derivatives.

Theory has been used to complement experiment in the development of both drugs and delivery systems. Theoretical methods are capable of identifying the molecular basis of drug formulation inadequacies and systematic theoretical studies may suggest fruitful avenues for material modification. This thesis highlights the utility of computer-based theoretical calculations for guiding the design of drug formulations and enhancing material-drug compatibility and stability. Specifically, the present work explores the applications of semi-empirical methods and atomistic molecular dynamics (MD) simulations to enhance the performance of nano-emulsions and polymer micelle formulations for the delivery of hydrophobic drugs. This work includes three separate studies preceded by an introductory summary of available theoretical techniques. The first study evaluates the accuracy and reliability of semi-empirical methods and MD simulations as means to select suitable excipients to formulate the anti-cancer drug docetaxel in an emulsion. Here, simulations accurately predict the rank order of drug solubility in various excipients, suggesting that simulation is useful for library enrichment. In the second study, a drug conjugation approach is used to further improve the stability and solubility of docetaxel in a triglyceride-based nano-emulsion. Here, optimal conjugates are identified with computer-based theoretical calculations and conjugates with formulation-compatible moieties are synthesized. As predicted, the conjugates exhibit enhanced solubility and loading efficiency in a nano-emulsion. The goal of the third study is to rationally design a stable unimolecular star copolymer that, as a unimer, does not disassemble upon the dilution that accompanies intravenous injection. Here, MD simulation is used to systematically investigate the solution properties of differently composed star copolymers. Overall, star copolymers with a hydrophobic PCL core ≤ 2 kDa and hydrophilic PEG blocks approaching 14.6 kDa per arm are predicted to form unimolecular micelles that remain unimeric at high concentrations. The studies presented in this thesis demonstrate that theoretical approaches are useful for fast pre-screening of drug formulation materials and for the development of delivery systems and drug derivatives.

La pharmacocinétique (PK) des anticorps monoclonaux (mAbs) est sujette à d’importantes variations interindividuelles. Le récepteur néonatal au Fc des IgG (FcRn) et le statut immun à l’encontre de ces mAbs sont des déterminants de cette PK. La bioconjugaison des mAbs à des cytotoxiques entraîne une altération de leur PK. Nous montrons que le taux de couplage modifie l’affinité de ces espèces pour le FcRn à pH6. La proportion d’agrégats au sein des solutions d’anticorps armés augmente avec le taux de couplage et pourrait entraîner une altération de leur PK. Par ailleurs, cette agrégation est impliquée dans l’immunogénicité des mAbs, et nous avons donc cherché à identifier des acides aminés impliqués dans l’agrégation de mAbs indiqués en clinique. Il apparait que la nature biochimique de résidus des paratopes pourrait augmenter cette agrégation. Les anti-TNF- présentent très peu d'agrégats et figurent pourtant parmi les plus immunogènes chez l’Homme. Nous avons donc exploré le rôle des complexes immuns dans leur immunogénicité chez la souris. Il apparait que la présence du FcRn n’est pas à l’origine de l’immunisation contre ces mAbs, contrairement à celle des complexes immuns. Ces résultats donnent des pistes pour la production de mAbs plus efficients et mieux tolérés. / The pharmacokinetic (PK) profile of monoclonal antibodies (mAbs) shows interindividudal variability. The neonatal Fc receptor (FcRn) and the immounogenicity of these mAbs are determinative factors of mAb PK. Generation of antibody-drug-conjugates alters their PK profile. We show that the the affinity for FcRn at pH6 increases with the drug-to-mAb ratio, as does the amount of aggregates inside the mAb-drug-conjugate. The amount of aggregates could be responsible for an avidity effect towards FcRn. These aggregates are known to cause immunogenicity, so we studied biochemical determinants inside the aminoacid sequence of marketed mAbs. We show that the biochemical nature of some aminoacids inside the paratope has an impact on the amount of aggregation. Anti-TNF- mAbs show very little aggregation but are very immunogenic in humans. We studied the role of the formation of immune complexes in the immunization against anti-TNF- mAbs in mice, and showed that immune complexes, but not FcRn are essential in the immunization process against anti- TNF- mAbs. These results give leads towards the generation of more efficient, better tolerated mAbs.

The present thesis deals with different aspects of the chemistry and photo-biology of various ferrocene-conjugates, their interaction with double helical DNA, DNA photocleavage and photo-enhanced cytotoxicity in visible light, localization and cellular uptake to study the mechanism of cell death. Phenyl analogues of the active complexes have been synthesized and used for comparison in biological assays. Chapter I presents an overview of cancer and its types, various treatments for cancer. A general overview on the Photodynamic Therapy, a new modality of light activated cancer treatment and its various possible mechanism of action, has been made. The promise of photoactivated chemotherapy is discussed with recently developed metal based antitumor agents. Biological applications of few ferrocene conjugates as anticancer and anti-malarial agents are discussed. The objective of the present investigation is also presented in this chapter. Chapter II presents the synthesis, characterization, structure, DNA binding, DNA photocleavage, photocytotoxicity and cellular localization of ferrocene-conjugated dipicolylamine oxovanadium(IV) complexes of curcumin. To explore the role of the ferrocenyl moiety the phenyl analogue of the ferrocenyl complexes is synthesized and used as a control for comparison purpose. Chapter III deals with the photo-induced DNA cleavage and photo-enhanced cytotoxicity of ferrocene-conjugated oxovanadium(IV) complexes of heterocyclic bases. The synthesis, characterization, structural comparisons, DNA binding, DNA photocleavage and photocytotoxic activity in visible light are discussed in detail. Chapter IV describes the synthesis, characterization and structure of ferrocene-conjugated oxovanadium(IV) complexes of acetylacetonate derivatives. The complexes are evaluated for DNA binding, DNA photocleavage and photocytotoxic activity in HeLa, MCF-7, 3T3 cells in visible light. The fluorescent nature of the complexes is used to study the cellular localization of the complexes and the mechanism of cell death induced by the complexes is also discussed. Chapter V presents the photocytotoxic effect of ferrocene-conjugated oxovanadium(IV) complexes of different curcuminoids in HeLa , HepG2 and 3T3 cells. Curcumin based fluorescence has been successfully used to study the cellular uptake and localization behavior of the complexes. The positive role of the ferrocenyl complex is evident from the ~4 fold increase in its photocytotoxicity compared to the phenyl analogue. The apoptotic mode of cell death is evident from nuclear co-staining using Hoechst dye. Chapter VI describes the synthesis, characterization and photochemotherapeutic efficacy of ferrocene conjugates of N-alkyl pyridinium salts. Mitochondria targeting property of ferrocene compound having n-butyltriphenylphosphonium group has been studied by JC-1 assay. FACS analysis showed significant sub G1/G0 phase cell-cycle arrest in cancer cells on visible light treatment. Finally, the summary of the dissertation and conclusions drawn from the present investigations are presented. The references in the text have been indicated as superscript numbers and compiled at the end of each chapter. The complexes presented in this thesis are represented by bold-faced numbers. Crystallographic data of the structurally characterized complexes are given in CIF format in the enclosed CD (Appendix-I). Due acknowledgements have been made wherever the work described is based on the findings of other investigators. Any unintentional omission that might have happened due to oversight or mistake is regretted. INDEX WORDS: Ferrocene conjugates Crystal structure DNA binding DNA photocleavage Photocytotoxicity Vanadium Cellular Imaging

La chromatographie en phase liquide bidimensionnelle « comprehensive » en ligne (LCxLC) est une technique à très haut pouvoir de séparation. Après avoir établi son intérêt mais aussi les enjeux liés au développement de méthodes et les conditions expérimentales utilisées, une attention particulière est portée à l'optimisation des méthodes en LCxLC. Une procédure d'optimisation basée une méthode « Pareto-optimal » est décrite. Les conditions optimales prédites sont ensuite appliquées à la séparation RPLCxRPLC d'un mélange complexe de peptides et comparée avec la 1D-RPLC en termes de capacité de pics, temps d'analyse et facteur de dilution démontrant l'avantage fournit par la RPLCxRPLC. L'optimisation d'une méthode HICxRPLC-UV/MS en ligne permettant la caractérisation exhaustive d'un anticorps conjugué est réalisée soulignant, entre autres, la grande complémentarité entre les différents modes de détection employés en 1D et 2D.Enfin, la possibilité de développer un couplage RPLCxSFC est explorée dans le but d'augmenter l'espace de séparation pour des composés neutres. La méthode RPLCxSFC optimisée est comparée avec une séparation RPLCxRPLC optimisée pour l'analyse d'une bio-huile montrant qu'elle peut-être considérée comme une alternative crédible pour la séparation de tels échantillons / Comprehensive two-dimensional liquid chromatography is a powerful but complex separative technique. After detailing the interest of such a technique, the method development issues and the experimental conditions employed throughout this work, a particular attention is paid to the optimization of LCxLC methods. Accordingly an optimization procedure based on Pareto-optimal method is described. The predicted optimal conditions are then applied to experimental RPLCxRPLC separations of complex samples of peptides and compared with 1D-RPLC in terms of peak capacity, analysis time and sensitivity clearly showing the advantage of RPLCxRPLC approach.The optimization of a HICxRPLC-UV/MS method for the exhaustive characterization of an antibody-drug conjugate is achieved highlighting the high complementarity of the different detection modes used both in 1D and 2D. Finally, a proof of concept concerning the implementation of RPLCxSFC coupling is achieved with the aim of increasing the separation space coverage for neutral compounds. The optimized RPLCxSFC separation is then compared with an optimized RPLCxRPLC approach for the analysis of a bio-oil sample showing that RPLCxSFC is a credible alternative for the separation of such a sample

<p>Liquid chromatography coupling with mass spectrometry (LC/MS) plays an important role in pharmaceutical characterization because of its ability to separate, identify, and quantify individual compounds from the mixture. Polymer brush layer bonded to the silica surface is designed as a novel stationary phase to improve the LC resolution and MS compatibility. The polymer thickness can be controlled to shield the analyte from interacting with the active silanol on the surface and reduce peak tailing. The functional group of the polymer can be changed to tune the selectivity in different separation modes. </p><p> </p><p>Two projects on LC/MS method development for biomolecule characterization using polymer-shell column are discussed in this work. In the first project, a polymer-shell column is used for disulfide bonds and free thiol subspecies identification, which is a major type of structural heterogeneities in IgG1. Compared with commercial columns, the polymer-shell column is able to resolve the free thiol variants without the presence of trifluoroacetic acid and greatly improve the MS signal. In the second project, a polymer-shell column is used for characterizing the drug-loading profile for antibody-drug-conjugates (ADC) via online LC/MS. The separation employs a mobile phase of 50 mM ammonium acetate to keep the ADC intact, and a gradient of water/isopropanol for ADC elution. MS data show that all ADC species remained intact and native on the column. Positional isomers can be separated and identified with the new method as well. Furthermore, to understand the surface chemistry and protein separation behavior quantitatively, a chromatographic simulation study is performed. The result shows that protein separation in RPLC can be described by a bi-Langmuir adsorption isotherm with mixed-mode retention of strong and weak sites. Smaller fractions and lower equilibrium constant of the strong site, which is the active silanol, give less tailing for protein separation.</p>

We present the bioconjugation of avidin as a central and/or bridging building block with mono-, bi- and tetravalent biotinylated glycodendrimers to fabricate defined supramolecular nanostructures for future (bio)medical applications. For this purpose mono-, bi- and tetravalent biotinylated glycodendrimers, decorated with short alkyl-linked or long PEG-linked biotin ligands, were synthesized and characterized by NMR, IR and mass spectrometry and HABA displacement assay. Various techniques (UV/Vis, DLS, TEM, LILBID-MS and AF4) were used in order to obtain information about the structural properties of different conjugates of avidin and mono-, bi- and tetravalent biotinylated glycodendrimers. The biotin ligand’s spacer length, its chemical structure and the degree of biotin functionalization are essential parameters in the formation of nanostructures with avidin having a controlled composition and size dimension up to 100 nm. Biohybrid structures with avidin as a central unit require monovalent glycodendrimers with PEG-linked biotin, while bi- and tetravalent glycodendrimers with short alkyl-linked biotin ligands are more efficient than their counterparts with longer PEG–biotin ligands in the fabrication of defined biohybrid structures (∅ up to 100 nm) with avidin as a bridging unit. The most dominating key issue, combined with other conjugation issues, is the optimal ligand–receptor stoichiometry to fabricate biohybrid structures with diameter of <20, <30 or up to 100 nm.

<p>Antibody-drug conjugates (ADCs) combine the cytotoxicity of traditional chemotherapy with the site-specificity of antibodies by conjugating payloads to antibodies with immunoaffinity. However, the conjugation alters the physicochemical properties of antibodies, increasing the risks of various types of degradation. The effects of common risk factors such as pH, temperature, and light on the stability of ADCs differ from their effects on monoclonal antibodies (mAb) due to these altered physicochemical properties. </p> <p>To date, ADC researchers have developed linkers with improved <i>in vivo</i> stability, and begun to understand the deconjugation mechanisms <i>in vivo</i>. In contrast, the <i>in vitro</i> stability of ADCs has not gained comparable attention. All nine of the U.S. FDA approved ADCs are lyophilized to minimize the potential for degradation. However, there are few studies on the solid-state stability of ADCs. To evaluate lyophilized solids, pharmaceutical development relies heavily on accelerated stability studies, which take months to determine the best formulation. Characterization methods that are often used orthogonally with accelerated studies include Fourier-transform infrared spectroscopy (FT-IR), Raman spectroscopy, near-infrared spectroscopy (NIR), differential scanning calorimetry (DSC), and x-ray powder diffraction (XRPD). Results from these methods are often poorly correlated with stability, however. Thus, stability evaluation of solid-state ADC products, and other recombinant protein drugs, is often a bottleneck in their development.</p> <p>To provide knowledge on how to improve the <i>in vitro</i> stability of lyophilized ADC formulations, the solid-state stability of ADC formulations with varying risk factors was studied in this dissertation project. The first study investigated interactions between an ADC and excipients in terms of solid-state stability enhancement. The second study investigated the process-driven instability of ADCs during lyophilization using various concentrations of ADCs. The first two studies incorporate a new method called solid-state hydrogen/deuterium exchange coupled with mass spectrometry (ssHDX-MS) as an analytical predictor of solid-state stability. The last study investigated the effects of pH on the stability of labile hydrazones, as a model for common linker chemistry used in ADCs. </p>