O Plasmodium vivax é a espécie causadora de malária de maior distribuição mundial e maior prevalência nas Américas. A complexidade do ciclo de vida do parasito e sua extensa diversidade antigênica têm dificultado a obtenção de uma vacina eficaz e inferem que seja pouco provável que este objetivo seja alcançado utilizando um único antígeno. Neste contexto, a combinação de regiões imunodominantes de antígenos de um ou mais estágios do ciclo de vida do Plasmodium pode ser uma estratégia com melhor prognóstico na indução de resposta imune protetora e duradoura contra a atividade parasitária. Este trabalho avaliou a imunogenicidade, em camundongos, de uma formulação vacinal composta pela mistura dos antígenos CSP, pré-eritrocítico e AMA-1, o qual é expresso em ambos os estágios, préeritrocítico e eritrocítico assexuado. A proteína quimérica yPvCSAllFL, que contém epítopos para células B da região central (repeats) das 3 variantes alélicas PvCSP-VK210, PvCSP-VK247 e PvCSP-P. vivax-like fusionados, e a yPvAMA-1 foram expressas com sucesso em leveduras Pichia pastoris e purificadas por métodos cromatográficos para a imunização de camundongos BALB/c e C57BL/6, na presença do adjuvante Poly(I:C), agonista de TLR3. Por ELISA, foram determinados os títulos de anticorpos, as subclasses de IgG e a avidez destes pelas proteínas indutoras, administradas isoladamente ou em combinação. A resposta de anticorpos anti-yPvCSAllFL mostrou ser linhagem dependente, tendo sido observado altos títulos de anticorpos IgG (106) em C57BL/6, os quais se mantiveram elevados por até 6 meses após a última dose. Os anticorpos anti-yPvCSAllFL, predominantemente IgG1, foram capazes de reconhecer proteínas representando as 3 variantes alélicas. No geral, a coadministração dos antígenos yPvCSAllFL e yPvAMA-1 não comprometeu a resposta de anticorpos individual. Utilizando este protocolo de vacinação não foi possível detectar resposta proliferativa de células TCD3+TCD4+ ou TCD3+TCD8+ específicas após a estimulação com yPvCSAllFL. Os índices de proliferação (8,31%) e o padrão de secreção das citocinas IFN-γ, IL-2, TNF-α e IL-10, associados à yPvAMA-1, sofreram redução com a coadministração de antígenos (6,33%) e alteração, com elevação de IL-2 em detrimento das demais citocinas. Os dados gerados no estudo das formulações vacinais apresentadas neste trabalho podem ser úteis para o desenvolvimento de uma vacina anti-P. vivax, principalmente por explorarem estratégias de combinação e fusão de antígenos. / Plasmodium vivax is the species of malaria more widely distributed worldwide and with higher prevalence in the Americas. The complexity of the parasite life cycle and its extensive antigenic diversity have hampered the achievement of an effective vaccine and infer that it is unlikely that this goal will be achieved using a single antigen. In this context, the combination of immunodominant regions of antigens of one or more stages of the Plasmodium life cycle can be a strategy with better prognosis at inducing protective and durable immune responses against this parasite. Our study assessed the immunogenicity of vaccine formulations consisting of mixture of antigens CSP, pre-erythrocytic and AMA-1, which is expressed in the both stages, pre-erythrocytic and erythrocytic asexual, in mice. The chimeric protein yPvCSAllFL, which contains B-cell epitopes of the central region (repeats) of the 3 allelic variants PvCSP-VK210, PvCSP-VK247 and PvCSP-P. vivax-like fused, and the yPvAMA-1 were successfully expressed in the yeast Pichia pastoris and purified by chromatographic methods for immunization of BALB/c and C57BL/6 mice in the presence of the adjuvant Poly(I:C), a TLR3 agonist. By ELISA, we determined the titles, IgG subclasses and the avidity of the antibodies to these proteins, administered alone or in combination. The immune response to yPvCSAllFL proved to be dependent on mouse strain, having been observed high titers of IgG antibodies (106) in C57BL/6, which remained high for up to 6 months after the last dose. Anti-yPvCSAllFL antibodies, predominantly IgG1, were able to recognize proteins representing the 3 allelic variants. In general, the co-administration of yPvCSAllFL and yPvAMA-1 antigens did not compromise the individual antibodies response. Using this vaccination protocol, we could not detect cell specific proliferative responses of TCD3+TCD4+ or TCD3+TCD8+ after stimulation with yPvCSAllFL. The proliferation (8.31%) and the pattern of secretion of cytokines IFN-γ, IL-2, TNF-α and IL-10, associated with the yPvAMA-1, were reduced during the co-administration (6.33%) and compensated by the elevation of IL-2. The data generated on the study of vaccine formulations presented in this thesis may be useful for the development of a vaccine anti-P. vivax, mainly by exploiting strategies of combination and fusion of antigens.

LOPES NETO, Antônio Viana. Atividade fungistática de uma quitinase recombinante do feijão de corda [Vigna unguiculata (L.) (Walp.)] contra Lasiodiplodia theobromae Pat. (Griff. e Maubl.), agente causal da resinose do cajueiro (Anacardium occidentale L.). 2014. 57 f. Dissertação (Mestrado em Bioquímica)-Universidade Federal do Ceará, Fortaleza-CE, 2014. / Submitted by Eric Santiago (erichhcl@gmail.com) on 2016-07-08T13:45:57Z No. of bitstreams: 1 2014_dis_avlopesneto.pdf: 1483564 bytes, checksum: 0e776910b7f818898df5c2fc18bff4ec (MD5) / Approved for entry into archive by José Jairo Viana de Sousa (jairo@ufc.br) on 2016-08-02T20:18:18Z (GMT) No. of bitstreams: 1 2014_dis_avlopesneto.pdf: 1483564 bytes, checksum: 0e776910b7f818898df5c2fc18bff4ec (MD5) / Made available in DSpace on 2016-08-02T20:18:18Z (GMT). No. of bitstreams: 1 2014_dis_avlopesneto.pdf: 1483564 bytes, checksum: 0e776910b7f818898df5c2fc18bff4ec (MD5) Previous issue date: 2014 / The aim of this work was to evaluate the biological activity of a recombinant chitinase (rVuChi) from cowpea (Vigna unguiculata) against the phytopathogenic fungus Lasiodiplodia theobromae. The recombinant protein was expressed in Pichia pastoris, collected and purified after 72h of induction, using a chitin affinity chromatography. The chitinase was eluted from the affinity chromatography using 0.1 M acetic acid. Enzymatic assay was performed against the synthetic substrate (colloidal chitin) in order to determine the activity of the purified recombinant protein. The chitinase displayed a specific activity of 5,637.32 U/mg of protein. Biological tests were performed. In these tests three different isolates of L. theobromae, identified as CNPAT CCJ-127, CNPAT CCJ-166 and CNPAT CCJ-184, were used and the experiments were performed on triplicate. The fungal isolates were obtained from the collection of work from the laboratory of plant pathology from the Embrapa Agroindústria Tropical (Fortaleza-CE, Brasil). In all biological assays the fungicide Carbomax 500 SC® (Carbendazim) at a concentration of 2 mL/L and sterile distilled water were used as positive and negative controls, respectively. A total of 50, 100 and 300 µg of recombinant chitinase (rVuChi) was used in all tests. The first test was based on the disk diffusion methodology using filter paper in which the effects of the protein on the mycelium growth, as well as the formation of an inhibition zone on the fungal hyphae were investigated. The second test was based on the diffusion assay in agar. Photographs were used to register the observations. The rVuChi showed moderate to strong fungistatic activities on the mycelial growth of all L. theobromae isolates when used at 100 and 300 µg in the disk diffusion assay. CNPAT CCJ-127 was the most resistant specimen to the rVuChi fungistatic action, as observed by the lower impact of the protein on it is mycelial growth. In the agar diffusion test the amount of 300 µg was the most effective, as observed in the disk diffusion test. In addition, the effect of the protein was most pronounced on the isolates CNPAT CCJ-166 and CNPAT CCJ-184 and less impacting on CNPAT CCJ-127. The recombinant chitinase rVuCHi showed to be an inhibitor of the mycelial growth of three L. theobromae isolates. The fungistatic effects of the protein described here may be due to its ability to degrade chitin, a structural biopolymer that makes part of the cell wall of several phytopathogenic fungi, including L. theobromae. Once this is only a scientific speculation, more studies need to be made to definitely reveal the mechanism of action of rVuChi on L. theobromae. / O objetivo deste trabalho foi avaliar a atividade biológica de uma quitinase recombinante (rVuChi) de feijão-caupi (Vigna unguiculata) contra o fungo fitopatogênico Lasiodiplodia theobromae. A proteína recombinante foi expressa em Pichia pastoris, coletada e purificada após 72h de indução, utilizando cromatografia de afinidade em matriz de quitina. A quitinase foi eluída a partir da cromatografia de afinidade com ácido acético a 0,1 M. Ensaio enzimático foi realizado contra o substrato sintético (quitina coloidal), a fim de determinar a atividade da proteína recombinante purificada. A quitinase apresentou atividade específica de 5.637,32 U/mg de proteína. Testes biológicos foram realizados. Nestes testes três diferentes isolados de L. theobromae, identificados como CNPAT CCJ-127, CNPAT CCJ-166 e CNPAT CCJ-184, foram utilizados e os experimentos foram realizados em triplicata. Os isolados fúngicos foram obtidos da coleção de trabalho do Laboratório de Fitopatologia da Embrapa Agroindústria Tropical (Fortaleza-CE, Brasil). Em todos os ensaios biológicos o fungicida Carbomax 500 SC® (Carbendazim), a uma concentração de 2 mL/L, e água destilada estéril foram utilizados como controles positivos e negativos, respectivamente. Um total de 50, 100 e 300 µg de quitinase recombinante (rVuChi) foi utilizado em todos os testes. O primeiro ensaio foi baseado na metodologia de difusão em disco de papel de filtro em que foram investigados os efeitos da proteína sobre o crescimento do micélio, bem como a formação de halo de inibição sobre o crescimento micelial do fungo. O segundo ensaio foi baseado no ensaio de difusão em ágar. Fotografias foram usadas para registrar as observações. A quitinase rVuChi mostrou efeito fungistático variando de moderado a forte sobre o crescimento micelial de todos os isolados de L. theobromae, particularmente quando usada nas doses de 100 e 300 µg, no ensaio de difusão em disco. CNPAT CCJ-127 foi o isolado mais resistente à ação fungistática de rVuChi, como observado pelo menor impacto da proteína em seu crescimento micelial. No teste de difusão em ágar a quantidade de 300 µg foi a mais efetiva, da mesma forma como observado para o de difusão em disco de papel de filtro. Além disso, o efeito da proteína foi mais pronunciado nos isolados CNPAT CCJ-166 e CNPAT CCJ-184 e menos impactante no isolado CNPAT CCJ-127. A quitinase recombinante rVuCHi mostrou ser um inibidor do crescimento micelial de três diferentes isolados de L. theobromae. Os efeitos fungistáticos da proteína aqui descritos podem ser devido à sua capacidade de degradar quitina, um biopolímero estrutural que faz parte da parede celular de vários fungos fitopatogênicos, incluindo L. theobromae. Entretanto, mais estudos precisam ser conduzidos para revelar os possíveis mecanismos de ação de rVuChi sobre L. theobromae.

CoordenaÃÃo de AperfeÃoamento de Pessoal de NÃvel Superior / O objetivo deste trabalho foi avaliar a atividade biolÃgica de uma quitinase recombinante (rVuChi) de feijÃo-caupi (Vigna unguiculata) contra o fungo fitopatogÃnico Lasiodiplodia theobromae. A proteÃna recombinante foi expressa em Pichia pastoris, coletada e purificada apÃs 72h de induÃÃo, utilizando cromatografia de afinidade em matriz de quitina. A quitinase foi eluÃda a partir da cromatografia de afinidade com Ãcido acÃtico a 0,1 M. Ensaio enzimÃtico foi realizado contra o substrato sintÃtico (quitina coloidal), a fim de determinar a atividade da proteÃna recombinante purificada. A quitinase apresentou atividade especÃfica de 5.637,32 U/mg de proteÃna. Testes biolÃgicos foram realizados. Nestes testes trÃs diferentes isolados de L. theobromae, identificados como CNPAT CCJ-127, CNPAT CCJ-166 e CNPAT CCJ-184, foram utilizados e os experimentos foram realizados em triplicata. Os isolados fÃngicos foram obtidos da coleÃÃo de trabalho do LaboratÃrio de Fitopatologia da Embrapa AgroindÃstria Tropical (Fortaleza-CE, Brasil). Em todos os ensaios biolÃgicos o fungicida Carbomax 500 SC (Carbendazim), a uma concentraÃÃo de 2 mL/L, e Ãgua destilada estÃril foram utilizados como controles positivos e negativos, respectivamente. Um total de 50, 100 e 300 Âg de quitinase recombinante (rVuChi) foi utilizado em todos os testes. O primeiro ensaio foi baseado na metodologia de difusÃo em disco de papel de filtro em que foram investigados os efeitos da proteÃna sobre o crescimento do micÃlio, bem como a formaÃÃo de halo de inibiÃÃo sobre o crescimento micelial do fungo. O segundo ensaio foi baseado no ensaio de difusÃo em Ãgar. Fotografias foram usadas para registrar as observaÃÃes. A quitinase rVuChi mostrou efeito fungistÃtico variando de moderado a forte sobre o crescimento micelial de todos os isolados de L. theobromae, particularmente quando usada nas doses de 100 e 300 Âg, no ensaio de difusÃo em disco. CNPAT CCJ-127 foi o isolado mais resistente à aÃÃo fungistÃtica de rVuChi, como observado pelo menor impacto da proteÃna em seu crescimento micelial. No teste de difusÃo em Ãgar a quantidade de 300 Âg foi a mais efetiva, da mesma forma como observado para o de difusÃo em disco de papel de filtro. AlÃm disso, o efeito da proteÃna foi mais pronunciado nos isolados CNPAT CCJ-166 e CNPAT CCJ-184 e menos impactante no isolado CNPAT CCJ-127. A quitinase recombinante rVuCHi mostrou ser um inibidor do crescimento micelial de trÃs diferentes isolados de L. theobromae. Os efeitos fungistÃticos da proteÃna aqui descritos podem ser devido à sua capacidade de degradar quitina, um biopolÃmero estrutural que faz parte da parede celular de vÃrios fungos fitopatogÃnicos, incluindo L. theobromae. Entretanto, mais estudos precisam ser conduzidos para revelar os possÃveis mecanismos de aÃÃo de rVuChi sobre L. theobromae. / The aim of this work was to evaluate the biological activity of a recombinant chitinase (rVuChi) from cowpea (Vigna unguiculata) against the phytopathogenic fungus Lasiodiplodia theobromae. The recombinant protein was expressed in Pichia pastoris, collected and purified after 72h of induction, using a chitin affinity chromatography. The chitinase was eluted from the affinity chromatography using 0.1 M acetic acid. Enzymatic assay was performed against the synthetic substrate (colloidal chitin) in order to determine the activity of the purified recombinant protein. The chitinase displayed a specific activity of 5,637.32 U/mg of protein. Biological tests were performed. In these tests three different isolates of L. theobromae, identified as CNPAT CCJ-127, CNPAT CCJ-166 and CNPAT CCJ-184, were used and the experiments were performed on triplicate. The fungal isolates were obtained from the collection of work from the laboratory of plant pathology from the Embrapa AgroindÃstria Tropical (Fortaleza-CE, Brasil). In all biological assays the fungicide Carbomax 500 SC (Carbendazim) at a concentration of 2 mL/L and sterile distilled water were used as positive and negative controls, respectively. A total of 50, 100 and 300 Âg of recombinant chitinase (rVuChi) was used in all tests. The first test was based on the disk diffusion methodology using filter paper in which the effects of the protein on the mycelium growth, as well as the formation of an inhibition zone on the fungal hyphae were investigated. The second test was based on the diffusion assay in agar. Photographs were used to register the observations. The rVuChi showed moderate to strong fungistatic activities on the mycelial growth of all L. theobromae isolates when used at 100 and 300 Âg in the disk diffusion assay. CNPAT CCJ-127 was the most resistant specimen to the rVuChi fungistatic action, as observed by the lower impact of the protein on it is mycelial growth. In the agar diffusion test the amount of 300 Âg was the most effective, as observed in the disk diffusion test. In addition, the effect of the protein was most pronounced on the isolates CNPAT CCJ-166 and CNPAT CCJ-184 and less impacting on CNPAT CCJ-127. The recombinant chitinase rVuCHi showed to be an inhibitor of the mycelial growth of three L. theobromae isolates. The fungistatic effects of the protein described here may be due to its ability to degrade chitin, a structural biopolymer that makes part of the cell wall of several phytopathogenic fungi, including L. theobromae. Once this is only a scientific speculation, more studies need to be made to definitely reveal the mechanism of action of rVuChi on L. theobromae.

A produção de proteínas terapêuticas recombinantes compreende moléculas complexas e de alto valor agregado, incluindo a enzima glucocerebrosidase (GCase). Sua deficiência resulta na Doença de Gaucher, passível de tratamento por meio da terapia de reposição enzimática. A forma ativa da GCase recombinante usada na terapia apresenta resíduos terminais de manose expostos no seu perfil de glicosilação. Perfil este que espera-se ser reproduzido por meio da construção de uma linhagem de Pichia pastoris com um padrão de glicosilação humanizado, por meio da deleção de dois genes envolvidos no sistema de glicosilação da levedura: alg3 e och1, responsáveis pela posterior hiper-manosilação característica desse organismo. Assim, a expressão da GCase será usada como modelo no desenvolvimento desta linhagem de Pichia pastoris que permita a expressão de glicoproteínas com um perfil humanizado específico de glicosilação. Além da produção da linhagem mutante pela técnica de CRISPR/Cas9, propomos a construção de duas linhagens controle: uma expressando a proteína GCase para análise do seu padrão selvagem de glicosilação em P. pastoris e outra expressando a proteína Cas9 de Streptoccocus pyogenes (SpCas9). A linhagem P. pastoris/GCase foi construída testando-se duas sequências sinal de secreção diferentes: fosfatase alcalina (PHO1) e albumina humana (Alb). Resultados de western blot mostraram a GCase no lisado celular e baixos níveis de proteína secretada no sobrenadante de cultura, sendo mais expresso na linhagem contendo a sequência PHO1. A linhagem P. pastoris/SpCas9 foi construída e a enzima SpCas9 foi detectada via western blot no lisado celular após indução com metanol. Para a produção da linhagem com padrão de glicosilação humanizado propôs-se a deleção dos genes alg3 e och1 e a inserção, pela via de reparo por recombinação homóloga (HDR), de marcas de resistência aos antibióticos higromicina ou canamicina. Para tal, propusemos a construção de dois vetores finais de expressão do sistema CRISPR/Cas9 em P. pastoris, cada um contendo a enzima SpCas9 e os RNAs guia (gRNAs) para deleção do gene alg3 ou och1, e também a construção de dois fragmentos para HDR contendo o gene de resistência ao antibiótico flanqueado por regiões de 1Kb de homologia com a região de deleção do gene alg3 ou och1. A construção dos vetores e fragmentos para HDR foram inicialmente feitas por meio de técnicas de clonagem clássica. No entanto, apesar de inúmeras tentativas, resultados de PCR e sequenciamento mostraram o insucesso das construções. Partiu-se então para a técnica de Gibson Assembly®, através da qual os dois fragmentos para HDR foram construídos. Porém, os vetores de expressão contendo SpCas9 e os gRNAs ainda apresentam dificuldades na sua construção. Esforços ainda estão sendo feitos para a construção dos vetores e consequente tentativa de estabelecimento das linhagens mutantes. O sucesso no estabelecimento de um sistema de expressão de proteínas heterólogas com este padrão de glicosilação humano específico permitirá a obtenção e possível comercialização da GCase em sua forma terapêutica. Além disso, permitirá possíveis edições genômicas futuras para um padrão de maior complexidade de glicosilação humanizado, criando uma plataforma nacional para produção de outras glicoproteínas terapêuticas de interesse biotecnológico. / The production of therapeutic recombinant protein comprises complex and high valued molecules, including the glucocerebrosidase enzyme (GCase). Its deficiency results in Gaucher Disease, susceptible of treatment by enzymatic replacement therapy. The active form of recombinant GCase employed in therapy presents exposed terminal mannose residues in its glycosylation pattern. We hope to reproduce such pattern by constructing a Pichia pastoris strain with a specific human glycosylation pattern through the deletion of two genes involved in yeast glycosylation system, alg3 and och1, responsible for the final hyper-mannosylation characteristic of this organism. Therefore, the expression of GCase will be a case model for the development of the recombinant Pichia pastoris strain that could allow the expression of glycoproteins with a specific humanized glycosylation profile. Despite the establishment of the mutant strain using the CRISPR/Cas9 technique, we propose the construction of two control strains: one expressing the GCase protein for analysis of its wild type glycosylation pattern and another one expressing the Cas9 protein from Streptoccocus pyogenes (SpCas9). The P. pastoris/GCase strain was constructed testing two different secretion signal sequences: alkaline fosfatase (PHO1) and human albumin (Alb). Western blot results have shown GCase in cell lysate and in low expression levels in culture supernatant, being more expressed in the strain containing the PHO1 signal sequence. P. pastoris/SpCas9 strain was constructed and SpCas9 enzyme was detected via western blot in cell lysate after the induction with methanol. To produce the strain with the humanized glycosylation pattern, the deletion of alg3 and och1 genes was proposed along with the insertion, by homology directed repair pathway (HDR), of hygromycin and kanamycin antibiotics resistance marks. In order to do so, we have proposed the construction of two final expression vectors of the CRISPR/Cas9 system in P. pastoris, each one containing SpCas9 enzyme and the guide RNAs (gRNAs) for deletion of alg3 or och1, and also the construction of two fragments for HDR containing the antibiotics resistance gene flanked by 1Kb regions of homology with the deleted regions of alg3 or och1. Vectors and HDR fragments constructions were initially performed using classic cloning techniques. However, despite numerous tries, PCR and sequencing results have shown the failure of the constructions. Then, we moved on to the Gibson Assembly® technique, through which the two HDR fragments were built. Still, the expression vectors containing SpCas9 and the gRNAs presented difficulties in its assembly. Efforts continue to be made to successfully construct the remaining vectors and to establish the mutant lineage. Success in the establishment of a heterologous protein expression system with specific human glycosylation pattern will allow the obtainment and possible commercialization of the therapeutic form of GCase. Furthermore, it will also allow possible future genomic editing to a high complexity human glycosylation pattern, creating a national platform for the production of other therapeutic glycoproteins of biotechnological interest.

O papilomavirus humano (HPV) é o agente etiológico da infecção sexualmente transmissível mais comum na população mundial. A prevalência da infecção por HPV é estimada em 660 milhões de pessoas e mais de 50% das mulheres serão acometidas pela infecção ao menos uma vez na vida. O HPV é responsável por virtualmente todos os casos de câncer de colo de útero (99%), além de causar muitos outros tipos de câncer de mucosa. O câncer cervical afeta aproximadamente 1.4 milhões de mulheres e 500 mil novos casos surgem anualmente, resultando em 250 mil mortes por ano. Os maiores índices de incidência são observados na América Latina e na África. Duas vacinas contra o HPV são comercializadas desde 2006 por empresas estrangeiras. Entretanto, o custo mínimo da vacinação é superior a 600 reais. Este preço torna sua incorporação pelo sistema de saúde um processo economicamente inviável. Dessa forma, devem ser buscadas alternativas para a produção de uma vacina eficaz, de qualidade e de baixo custo no Brasil. A proteína L1, principal proteína do capsídeo do HPV, tem a propriedade de se auto agregar em partículas semelhantes às virais (VLPs), que são o principal componente das vacinas atuais e possuem muita semelhança com os vírions nativos, introduzindo inclusive, uma imunização predominantemente tipo-específica. Este projeto se propôs a construir e avaliar vetores de expressão visando à produção em larga escala da proteína L1 do HPV 16, o tipo de HPV de maior risco e incidência na população mundial. Foram construídos cinco plasmídeos para Pichia pastoris, uma das principais plataformas industriais de expressão. Eles se diferenciam pelos marcadores de seleção e pelas sequências de manutenção do vetor, mas têm exatamente o mesmo objetivo: gerar sistemas que possuam múltiplas cópias do gene da L1 e que não necessitem da utilização de antibióticos. Essa estratégia foi escolhida porque a produtividade de muitas das proteínas heterólogas tem grande dependência da dosagem gênica e porque o uso de antibióticos encarece muito o custo da produção. Na primeira etapa do projeto foi avaliado um sistema de expressão epissomal auxotrófico, mas ele não se manteve estável ao longo de 60 gerações. Na segunda parte, dois vetores de integração ao sítio do DNA ribossomal foram testados. O sistema mais estável e produtivo foi caracterizado quanto ao número de cópias integradas ao genoma da P. pastoris e ao nível de expressão. O sistema é capaz de produzir clones com mais de 30 cópias do gene da L1 e dois clones expressaram cerca de 20 a 30 miligramas/litro de L1. Adicionalmente outros dois vetores integrativos que utilizam sequências teloméricas para integração foram construídos. Ainda são necessários estudos conjuntos de fermentação em larga escala e purificação da proteína para verificar a viabilidade do sistema / The human papillomavirus (HPV) is the etiologic agent of the sexually transmitted infection most common worldwide. The prevalence of HPV infection is estimated at 660 million people and over 50% of women will be affected by the infection at least once in their lifetime. HPV is responsible for virtually all cervical cancers cases (99%), and causes many other types of mucosal cancer. Cervical cancer affects approximately 1.4 million women, and 500.000 new cases occur annually, resulting in 250.000 deaths per year. The highest incidence rates are seen in Latin America and Africa. Two HPV vaccines are marketed since 2006 by foreign companies. However, the minimum cost of vaccination is higher than 360 dollar. This price makes its incorporation by the Brazilian Health System economically unfeasible. Thus, alternatives must be found to produce an effective vaccine, with low cost and high-quality in Brazil. The L1 protein, the major capsid protein of HPV, has the ability to self aggregate into virus-like particles (VLPs) which are the main component of current vaccines. The VLPs are very similar to the native virions and can introduce an immunization predominantly type-specific. This project aimed to construct and evaluate expression vectors to produce, at large scale, the L1 protein of HPV 16, which is the HPV type at greater risk and incidence in the world. Five plasmids were constructed for Pichia pastoris, one of the major industrial expression platforms. They differ in the selection markers and the vector maintenance sequences, but they have exactly the same goal: to create systems with multiple copies of the L1 gene and that don\'t require the use of antibiotics. This strategy was chosen because the productivity of many heterologous proteins have heavy dependence on gene dosage and because the use of antibiotics is extremely expensive for its production. In the first stage of the project, it was rated an episomal auxotrophic expression system, but it was unstable after a period of 60 generations. In the second part, two vectors for integration in the ribosomal DNA locus were tested. The most stable and productive system was featured on the number of copies integrated into the P. pastoris genome and on the expression level. It was proved that the system is able to produce clones with more than 30 copies of the L1 gene and two clones expressed approximately 20-30 milligrams/liter of L1. Additionally, two other integrative vectors for integration in telomeric sequences were constructed for future testing. More studies on large-scale fermentation and protein purification will be necessary to determine the feasibility of the system.

A malária é um problema de saúde pública no Brasil e no mundo. Em 2016, o número de casos estimado pela Organização Mundial de Saúde foi de 216 milhões. Plasmodium falciparum é a espécie mais prevalente e responsável pelo maior número de mortes no mundo, sobretudo no continente africano. Por outro lado, o Plasmodium vivax é conhecido por sua ampla distribuição geográfica, sendo a espécie que predomina nas Américas, incluindo o Brasil. Nos últimos 20 anos, nosso grupo tem gerado e caracterizado diversas proteínas recombinantes baseadas em antígenos imunodominantes de P. vivax que podem servir como base para o desenvolvimento de uma vacina contra malária. Entre os antígenos de merozoítas, uma das principais proteínas em estudo pelo nosso grupo é o Antígeno 1 de Membrana Apical de P. vivax (PvAMA-1), caracterizado previamente como altamente imunogênico em infecções naturais e em camundongos imunizados, na presença de diferentes adjuvantes. O objetivo do presente estudo foi investigar o efeito da diversidade antigênica dessa proteína no reconhecimento por anticorpos específicos e na indução de imunidade contra o parasita. Para isso, foram geradas seis novas proteínas representando diferentes alelos descritos na natureza: PvAMA-1-Belem, PvAMA-1-Sal-I, PvAMA-1-Chesson-I, PvAMA-1-SK0814-apical, PvAMA-1-Indonesia-XIX e PvAMA-1-PNG_62_MU. As proteínas recombinantes foram expressas em leveduras Pichia pastoris e purificadas em duas etapas cromatográficas. Em seguida, as imunizações em camundongos C57BL/6 foram realizadas com as proteínas administradas de forma isolada, ou em combinação, na presença do adjuvante agonista de TLR3 (Poly I:C). Por ELISA, observamos que todas as formulações foram capazes de induzir anticorpos IgG contra as proteínas homólogas e heterólogas, o que sugere que a diversidade antigênica entre as formas alélicas não compromete o reconhecimento. Os dados gerados no presente trabalho sugerem que uma formulação contendo mistura de diferentes alelos representando a proteína AMA-1 pode ser explorada para o desenvolvimento de uma vacina de ampla cobertura contra o P. vivax. / Malaria is a public health problem in Brazil and throughout the world. In 2016, the World Health Organization estimated there were 216 million cases of malaria. Plasmodium falciparum is the most prevalent species and is responsible for the largest number of deaths, especially in the African continent. However, Plasmodium vivax is known for its wide geographic distribution, being the species that prevails in the Americas, including Brazil. In the last 20 years, our group has generated and characterized several recombinant proteins based on immunodominant antigens of P. vivax that can serve as a basis for the development of a malaria vaccine. Among the merozoite antigens, one of the main proteins studied by our group is P. vivax apical membrane antigen-1 (PvAMA-1), previously characterized as highly immunogenic in natural infections and immunized mice, in the presence of different adjuvants. The objective of this study was to investigate the effect of antigenic diversity of this protein in the recognition of specific antibodies and the induction of immunity against the parasite. For this, six new proteins were generated representing different alleles described in nature: PvAMA-1-Belem, PvAMA-1-Sal-i, PvAMA-1-Chesson-i, PvAMA-1-SK0814-apical, PvAMA-1-Indonesia-XIX, and PvAMA-1-PNG_62_MU. Recombinant proteins were expressed in Pichia pastoris yeast and purified by two chromatographic stages. Then, C57BL/6 mice were immunized with these proteins administered in isolation or in combination, in the presence of the TLR3 agonist adjuvant, Poly I:C. Using an enzyme-linked immunosorbent assay, we observed that all formulations induced IgG antibodies against homologous and heterologous proteins. This indicates that antigenic diversity between allele forms does not compromise recognition. This finding suggests that a formulation containing a mixture of different alleles representing the PvAMA-1 protein can be exploited for developing of a wide coverage vaccine against P. vivax.

No experimento 1, avaliou-se os efeitos da leptina exógena na concentração sérica de leptina e na expressão do gene LEP no tecido adiposo de novilhas zebuínas pré-púberes. Amostras de tecido adiposo (mesentérico, perirenal e subcutâneo) e de sangue foram obtidas de 36 novilhas, distribuídas nos tratamentos: A) dieta de alta energia; B) dieta de baixa energia; BL) dieta de baixa energia + 4,8 g/kg PV de oLeptin subcutânea, duas vezes ao dia, por 56 dias. A concentração de leptina foi determinada com kit comercial ELISA (Cusabio) específico. Amostras de sangue de quatro novilhas por grupo foram coletadas em seis pontos no tempo, sendo um antes e um após o tratamento hormonal. Dois dias após a obtenção da puberdade, oito novilhas por grupo foram abatidas para coleta de tecido. A expressão gênica foi quantificada nos depósitos de gordura por PCR em tempo real. A oLeptina aumentou transitoriamente a concentração de leptina do grupo BL, com pico (11,1 ± 1,4 ng/mL) após 7 dias do início do tratamento. A leptina sérica do grupo A aumentou linearmente no tempo, enquanto no grupo B, manteve-se constante (4,0 ± 2,0 ng/mL). A dieta A aumentou a expressão de leptina no tecido adiposo em 2,4 vezes; e a administração de oLeptina diminuiu a expressão do gene LEP em cerca de 2,5 vezes, comparando com o grupo controle. A redução na expressão do gene LEP explica a redução na leptina sérica do grupo BL após 30 dias de tratamento hormonal. O objetivo do experimento 2 foi clonar a região codificadora da leptina bovina, transformar leveduras Pichia pastoris KM71H e expressar a proteína no meio de cultura. O gene da leptina foi amplificado em reação de PCR, a partir de amostra de tecido adiposo subcutâneo de novilha do grupo A. Os primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (senso) e 5\' - ATTGTCGACGCACCCGGGACTGAGGT - 3\' (antisenso), contendo sítios EcoRI e SalI, foram desenhados com base na sequência do mRNA da leptina bovina (NM 173928.2), substituindo a sequência sinal de secreção nativa pela sequência do Fator do Saccharomyces cereviasiae. O inserto foi clonado nos vetores de expressão pPICZαA e pGAPZαA (Invitrogen), sendo as leveduras transformadas por eletroporação. Clones com múltiplas cópias do gene foram selecionados em meio YPD + 500 μg/mL de zeocina, e 22 colônias recombinantes foram selecionadas para análise de expressão em pequena escala. Colônias pPICbLep foram inicialmente cultivadas em meio de crescimento (BMGY), sendo transferidas para meio de indução (BMMY), contendo metanol. A indução durou 144 horas. Alíquotas de 200 μl de sobrenadante foram coletadas diariamente, para análise da presença da bLeptina por SDS-PAGE. As colônias pGAPbLep foram cultivadas em meio YPD por 96 h, com coleta de sobrenadante a cada 24 h. As leveduras foram transformadas com sucesso, com os plasmídeos pPICbLep e pGAPbLep, entretanto, apenas as colônias pGAPbLep expressaram uma proteína de 35 kDa, o dobro do tamanho esperado para a bLeptina (17 kDa), provavelmente por ocorrência de dimerização. Mais estudos são necessários sobre os processos de produção de leptina recombinante bovina em Pichia pastoris. / In experiment 1, the effects of exogenous leptin were evaluated on serum leptin levels and on LEP gene expression in the adipose tissue of prepubertal zebu heifers. Adipose tissue (mesenteric, perirenal and subcutaneous) and blood samples were collected from 36 heifers, distributed among treatments: A) high energy diet; B) low energy diet; BL) low energy diet + 4,8 g/kg BW subcutaneous oLeptin, twice daily, for 56 days. Leptin concentration was determined with specific commercial ELISA kit (Cusabio). Blood from four heifer per group was sampled in six time points, one before and one after the hormonal treatment. Two days after puberty attainment , eight heifers per group were slaughter for tissue sampling. Gene expression was quantified in fat depots by real time PCR. The oLeptin increased transiently leptin concentration in group BL, with a peak (11,1 ± 1,4 ng/mL) after 7 days of treatment. Serum leptin in group A increased linearly in time, while in group B it remained constant (4,0 ± 2,0 ng/mL). Diet A enhanced leptin expression in the adipose tissue 2.4-fold, and oLeptin administration decreased de expression 2.5-fold, comparing to the control group. The decrease in LEP gene expression explains the reduction in serum leptin from group BL after 30 d of hormonal treatment. The objective with experiment 2 was to clone de codifying region of bovine leptin, transform KM71H Pichia pastoris yeasts, and express the protein in culture media. The leptin gene was amplified by PCR, from subcutaneous adipose tissue sample from a heifer in group A. Primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (forward) and 5\' - ATTGTCGACGCACCCGGGACTGAGGT 3 (reverse), containing EcoRI and SalI restriction sites, were designed based in the mRNA sequence from bovine leptin (NM 173928.2), replacing the native secretion signal sequence by the -factor sequence from Saccharomyces cereviasiae. The insert was cloned in the expression vectors pPICZαA and pGAPZαA (Invitrogen), and yeasts were transformed by electroporation. Clones with multiple copies of the gene were selected in YPD + 500 μg/mL zeocina, and 22 recombinant colonies were selected for a small-scale expression analysis. pPICbLep colonies were initially cultivated in growth media (BMGY), and then transferred to the induction media (BMMY), containing methanol. The colonies were inducted for 144 h. Supernatant aliquots (200 μl) were collected daily, for bLeptin analysis in SDS-PAGE. pGAPbLep colonies were cultivated in YPD media for 96 h, collecting supernatant samples each 24 h. Yeasts were successfully transformed with the plasmids pPICbLep and pGAPbLep, however, only pGAPbLep colonies expressed a protein with 35 kDa, twice the size expected for the bovine leptin (17 kDa), probably because of dimerization. More studies are necessary about the recombinant bovine leptin production processes in Pichia pastoris.

Os mastócitos, em associação com outras células inflamatórias se acumulam em locais de tumor. Entretanto, pouco é conhecido sobre o papel exato dos mastócitos e de seus mediadores na progressão tumoral e angiogênese. Resultados recentes do nosso laboratório mostraram que a expressão das triptases específicas de mastócitos está correlacionada com a progressão tumoral (de Souza, Jr, PLosOne 7(7): e40790). Além do mais, existe uma associação entre mastócitos e a angiogênese tumoral. Então, tornou-se interessante investigar o papel das quimases específicas de mastócitos (mMCP-4 e -5) neste processo. Visto que estas quimases não são disponíveis comercialmente, a primeira etapa deste estudo foi produzir as quimases mMCP-4 e -5 recombinantes. Assim, as sequências dos genes respectivos para mMCP-4 e -5, além das sequências para seis resíduos de His e do sítio suscetível a enteroquinase foram clonadas no vetor de expressão pPIC9. A cepa GS115 de Pichia pastoris foi transformada com o respectivo vetor para mMCP-4 ou -5. Os clones transformados foram crescidos em meio BMMY e induzidos com várias concentrações de metanol para a produção de mMCP-4 ou -5 recombinantes. Depois de 96 horas, o meio foi centrifugado e as quimases mMCP-4 ou -5 foram purificadas do sobrenadante usando resina de níquel. A identidade das proteínas foi confirmada por Western Blotting usando o anticorpo anti-his, assim como os anticorpos anti-mMCP-4 e -5. As proteases foram ativadas pela clivagem do sítio suscetível a enteroquinase por cinco horas, a 22°C. A ativação das enzimas foi confirmada através da degradação de seus substratos específicos. Estes resultados mostram que P. pastoris é um organismo eficiente para a expressão de ambas as proteases. Estas proteases recombinantes se constituem em ferramentas importantes para se elucidar o papel da mMCP-4 ou -5 na angiogênese. / Mast cells, in association with other inflammatory cells, are known to accumulate at tumor sites. However, little is known about the exact role that mast cells and their mediators play in tumor progression and angiogenesis. Recent results from our laboratory have shown that expression of mast cell specific tryptases correlates with tumor progression (de Souza, Jr, PLosOne 7(7): e40790). Furthermore, there is an association between mast cells and tumor angiogenesis. It then became of interest to investigate the role of mast cell specific chymases (mMCP-4 and -5) in this process. Since these chymases are not commercially available, the first step in this study was to produce recombinant mMCP-4 and -5. The gene sequences for these chymases along with the sequence for six His residues and an enterokinase susceptible peptide were cloned into the expression vector pPIC9. The GS115 strain of Pichia pastoris was transformed with the respective vector for either rmMCP-4 or -5. The transformed clones were grown in BMMY media and induced to produce rmMCP-4 or -5 with various concentrations of methanol. After 96 hours, the medium was centrifuged and rmMCP-4 or -5 was purified from the supernatant using nickel-nitrilotriacetic acid agarose beads. The identity of the proteins was confirmed by Western blotting using an anti-his antibody as well as anti-mMCP-4 and -5. These results show that P. pastoris is an efficient organism in which to express both proteases.

Orientadores: Francisco Maugeri Filho, Gonçalo Amarante Guimarães Pereira / Tese (doutorado) - Universidade Estadual de Campinas, Faculdade de Engenharia de Alimentos / Made available in DSpace on 2018-08-25T00:15:25Z (GMT). No. of bitstreams: 1 Andrade_CristianeContePaimde_D.pdf: 8118229 bytes, checksum: e37327c8c0a8a32ecfc89552e46cbd0d (MD5) Previous issue date: 2014 / Resumo: Xilanases são enzimas que hidrolisam as ligações glicosídicas entre as unidades de xilose que compõem a xilana, o principal constituinte hemicelulósico. Devido à grande disponibilidade desse tipo de material na natureza, as xilanases podem ser empregadas em diversos ramos, como nas indústrias têxtil, de alimentos e de rações, na bioconversão de resíduos lignocelulósicos, no clareamento de papel e polpa, e no tratamento de resíduos. Visando descrever novas enzimas para futuras aplicações, este trabalho teve como objetivo purificar e caracterizar a xilanase produzida pelo basidiomiceto Cryptococcus sp. LEB-AY10, uma levedura previamente isolada da Mata Atlântica e selecionada pela produção de enzima termoestável. Para tanto, o micro-organismo foi inicialmente identificado em nível de espécie e depositado como C. flavescens LEB-AY10 (CCT 7725); em sequência, foi estudada a produção da enzima utilizando, como substrato, bagaço de cana-de-açúcar, pré-tratado por explosão a vapor em três diferentes condições, bem como suas respectivas frações solúveis, e suplementados com melaço ou componentes sintéticos. Tendo sido definida a metodologia de tratamento do bagaço, técnicas de planejamento experimental foram utilizadas para estudar a influência das variáveis de cultivo e aumentar a atividade da xilanase produzida. Nas condições otimizadas, obteve-se aumento de 5,6 vezes na atividade em relação aos testes iniciais, atingindo 4,67 U/mL (a 50°C) ou 8,33 U/mL (a 80°C) em 96 h de incubação. Posteriormente, realizou-se a purificação da xilanase em duas etapas cromatográficas (troca iônica e permeação em gel), sendo possível recuperar 45% da atividade inicial. A massa molecular média foi estimada em 48 kDa. A enzima apresentou atividade ótima a 77,5°C e maior estabilidade em pH próximo a 5,3. Neste pH, as meias-vidas desta enzima foram estimadas em 9,2 minutos a 77,5°C e 33,74 h a 67°C. Os parâmetros cinéticos Km e vmax utilizando xilana de bétula (birchwood) como substrato foram 4,13 g/L e 2,32 U/mL, respectivamente. A xilanase purificada apresentou baixas atividades de ?-xilosidase em 4-nitrofenil-?-D-xilopiranosídeo (0,02 U/mg) e de celulase em carboximetilcelulose (0,99 U/mg). Os produtos de hidrólise da xilana de faia (beechwood) pela xilanase de C. flavescens LEB-AY10 foram, principalmente, xilobiose e xilotriose. Para identificação do gene responsável pela produção da xilanase, foram utilizadas três estratégias: amplificação com primers degenerados, identificação de peptídeos por espectrometria de massas e sequenciamento do genoma da levedura. Um único gene (1265 pb) denominado Xyn10Cf foi identificado e o correspondente cDNA (1035 pb) foi clonado em Escherichia coli DH10B. O gene é interrompido por 6 íntrons, codifica um peptídeo sinal composto por 13 aminoácidos e a proteína madura é formada por 331 aminoácidos, tendo sua massa molecular estimada em 37,1 kDa (podendo conter cerca de 11 kDa de glicosilação). Com base na sequência de nucleotídeos e na caracterização da enzima purificada, a proteína foi classificada como membro da família GH10. Por fim, para comprovar a funcionalidade do gene identificado Xyn10Cf foi realizada a expressão na linhagem de Pichia pastoris GS115 sob o controle dos promotores álcool oxidase 1 (AOX1) ou gliceraldeído-3-fosfato desidrogenase (GAPDH), atingindo 5,66 U/mL e 7,67 U/mL, respectivamente, para 84 h de indução em frascos agitados / Abstract: Xylanases are enzymes that hydrolyze the glycosidic bonds between the xylose units of xylan, the main hemicellulosic compound. Due to the high availability in nature of this kind of material, the xylanases may be used in a wide range of industrial plants, including: textile, food and feed industries, bioconversion of lignocellulosic wastes, biobleaching of paper and pulp, and waste treatment. In order to describe novel enzymes for future applications, the goal of this work is to purify and characterize the xylanase produced by the basidiomycete Cryptococcus sp. LEB-AY10, a yeast previously isolated in the Atlantic Forest and selected by the production of a thermostable enzyme. First, the microorganism was identified at the species level and deposited as C. flavescens LEB-AY10 (CCT 7725); then, enzyme production was studied using the substrate sugarcane bagasse, pretreated by steam explosion in three different conditions, as well their corresponding soluble fractions, and supplemented with molasses or synthetic compounds. After selection of the treatment, experimental design techniques were used to assess the influence of cultivation variables and to increase the activity of produced xylanase. At optimized conditions, it was possible to increase activity by 5.6 times from initial assays, reaching 4.67 U/mL (at 50°C) or 8.33 U/mL (at 80°C) after 96 h of incubation. Later, the purification of the xylanase was performed in two chromatographic steps (ion exchange and gel permeation), in which it was possible to recover 45% of initial activity. The average molecular weight was estimated at 48 kDa. The enzyme showed optimal activity at 77.5°C and it was most stable at pH values near 5.3. At this pH, the half-lives of this enzyme were 9.2 min at 77.5°C and 33.74 h at 67°C. The kinetic parameters Km and vmax for Birchwood xylan were 4.13 g/L and 2.32 U/mL, respectively. The purified xylanase showed low activity of ?-xylosidase on 4-nitrophenyl-?-D-xilopiranosídeo (0.02 U/mg) and also showed some cellulase activity on carboxymethylcellulose (0.99 U/mg). The hydrolysis products of Beechwood xylan by the xylanase from C. flavescens LEB-AY10 were mainly xylobiose and xylotriose. For identification of the gene responsible for xylanase production, three strategies were used: amplification of degenerated primers, identification of peptides by mass spectrometry and yeast genome sequencing. A single gene (1265 pb) named Xyn10Cf was identified and the corresponding cDNA (1035 pb) was cloned into Escherichia coli DH10B. The gene is interrupted by 6 introns, it codifies a signal peptide of 13 amino acids and the mature protein is composed by 331 amino acids, with an estimated molecular mass of 37.1 kDa (it may contain around 11 kDa of glycosilation). Based on nucleotide sequencing and on characterization of the purified enzyme, the protein was classified as a member of GH10 family. Finally, to prove the functionality of the identified gene Xyn10Cf, the expression in Pichia pastoris GS115 strain was performed under the control of alcohol oxidase 1 (AOX1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoters, reaching 5.66 U/mL and 7.67 U/mL, respectively, after 84 h of incubation in shaker flasks / Doutorado / Engenharia de Alimentos / Doutora em Engenharia de Alimentos

Made available in DSpace on 2014-08-20T13:32:56Z (GMT). No. of bitstreams: 1 tese_daiane_drawanz_hartwig.pdf: 4007239 bytes, checksum: 7d50e5824c8c66e23049bd005ad56ea6 (MD5) Previous issue date: 2010-12-20 / Leptospirosis is a serious infectious disease caused by pathogenic spirochetes of the genus Leptospira, it is classified as a zoonosis of worldwide distribution. This disease results morbidity and mortality in humans and animals, justifying the application of prophylactic strategies. Current vaccines against leptospirosis are composed of inactivated bacteria and do not stimulate cross-protection. Thus, there is need to develop a safe and effective vaccine. In this study, we used the outer membrane proteins LigANI e LipL32, because they have been identified as vaccinogens. These, in their recombinant form, are usually expressed in Escherichia coli and as subunit vaccines have shown variable efficacy. We describe in this work the use of Pichia pastoris as an alternative expression system. The genes ligANI and lipL32 were cloned into vector pPICZαB, which allowed the secretory expression of proteins in P. pastoris. The protein yield in this system was 276 mg/L for LigANI and 285 mg/L for LipL32. The recombinant proteins were glycosylated and remained antigenic. The immunoprotective potential was evaluated in the hamster model, challenged with virulent L. interrogans serovar Copenhageni. Both proteins induced high levels of antibodies (P < 0.001). The animals immunized with LigANI and LipL32 using aluminium hydroxide as adjuvant, showed no protection against challenge, but showed a significant increase in survival (P < 0.001). In conclusion, the yeast P. pastoris has proved an efficient heterologous expression system of LigANI and LipL32 L. interrogans proteins. The secreted and glycosylated LigANI protein may be used in the control of leptospirosis, although additional studies are needed. / Leptospirose é uma doença infecciosa grave causada por espiroquetas patogênicas do gênero Leptospira, sendo classificada como uma zoonose de ampla distribuição mundial. Esta doença resulta morbidade e mortalidade em humanos e animais, justificando a aplicação de estratégias profiláticas. As vacinas atuais contra a leptospirose são compostas por bactérias inativadas e não estimulam proteção cruzada. Assim, existe a necessidade de desenvolver uma vacina efetiva. No presente estudo, as proteínas de membrana externa LigANI e LipL32 foram utilizadas, pois são apontadas como potenciais vacinógenos. Estas, em sua forma recombinante, costumam ser expressas em Escherichia coli e, como vacina de subunidade tem apresentado eficiência variável. Nós descrevemos neste trabalho a utilização da levedura Pichia pastoris como sistema de expressão alternativo. Os genes ligANI e lipL32 foram clonados no vetor pPICZαB, que permitiu a expressão secretória das proteínas em P. pastoris. O rendimento das proteínas neste sistema foi de 276 mg/L para LigANI e 285 mg/L para LipL32. As proteínas recombinantes foram glicosiladas e mantiveram-se antigênicas. O potencial imunoprotetor das proteínas foi avaliado em modelo hamster desafiado com cepa virulenta de L. interrogans sorovar Copenhageni. Ambas as proteínas induziram altas taxas de anticorpos (P < 0,001). Os animais imunizados com LigANI e LipL32, utilizando hidróxido de alumínio como adjuvante, não apresentaram proteção contra o desafio, mas demonstraram um aumento significativo na sobrevida (P < 0,001). Em conclusão, a levedura P. pastoris demonstrou ser um eficiente sistema de expressão heterólogo das proteínas LigANI e LipL32 de L. interrogans. A proteína LigANI secretada e glicosilada pode ser utilizada no controle da leptospirose, embora estudos adicionais sejam necessários.