The CCCTC-binding factor (CTCF) is a versatile, multifunctional zinc-finger protein involved in a broad spectrum of cellular functions. In mammalian cells, CTCF functions together with the Cohesin complex, an essential regulator of sister chromatid cohesion. Together, CTCF and Cohesin have been shown to regulate gene expression at a genome-wide level in mammalian cells. In the yeast Saccharomyces pombe, Cohesin has been implicated in transcription termination of convergently transcribed genes, in a cell cycle dependent manner. The aim of this thesis was to investigate the possibility of direct transcriptional involvement of CTCF and Cohesin in human cells. The first model system applied for this experimental purpose was the β-globin gene with introduced canonical CTCF-binding sites replacing the endogenous Co- Transcriptional Cleavage (CoTC) element downstream of β-globin. The results obtained indicate that recruitment of CTCF to the β-globin 3` flanking region does not prevent read-through transcription. However, CTCF-binding does mediate RNA Polymerase II (Pol II) pausing at the site of recruited CTCF. This results in more efficient pre-mRNA 3` end processing and therefore rescues β-globin mRNA to wild type levels. Cohesin was not detected at the introduced CTCF-binding sites. These results are a contribution to our understanding of the spatio-temporal requirements for cotranscriptional events like 3` end pre-mRNA processing and Pol II kinetics. The second part of my thesis presents an investigation on the involvement of CTCF and Cohesin in lipopolysaccharide (LPS)-induced Tumor Necrosis Factor α (TNFα) gene expression regulation in human monocytes and differentiated M1- and M2-type macrophages. These studies provide first evidence of Cohesin recruitment to the TNFα gene body and its regulatory NFκB-binding sites. Differences in the recruitment profiles obtained indicate potential regulatory differences of TNFα among the three cell types. Preliminary data provide an insight into the effects on TNFα mRNA levels upon down-regulation of Cohesin subunits.

Agrobacterium tumefaciens est une bactérie du sol responsable de la galle du collet chez les plantes lorsqu'elle possède le plasmide Ti (Tumor inducing) dit de virulence (pTi). La bactérie transfère un morceau d’ADN du pTi dans le génome de la plante qui code d'une part la production d’hormones de plantes, à l’origine de la formation de tumeurs colonisées par les bactéries et d'autre part la production de petites molécules (opines) qui servent de nutriment à A. tumefaciens. L'opine, agrocinopine A induit la production de signaux quorum sensing à l’origine de la dissémination du plasmide de virulence vers des bactéries non pathogènes. Agrobacterium radiobacter K84, une bactérie non pathogène, produit de l’agrocine 84, un antibiotique qui tue A. tumefaciens.L’import et le catabolisme de l’agrocinopine A sont réalisés par l’opéron acc présent sur le pTi. La protéine périplasmique (PBP) AccA associée à un transporteur ABC importe l’opine dans le cytoplasme qui est ensuite dégradée par AccF et AccG. AccR régule l’expression de l’opéron acc et celle du facteur de transcription TraR, central dans la signalisation quorum sensing. AccA importe l’agrocine 84 qui est activée par AccF. Mon travail de doctorat a permis par des études structure-fonction de caractériser la spécificité d'AccA et d’AccF et d’initier l’étude du facteur de transcription AccR. L’étude structurale de la PBP en complexe avec l’agrocinopine A, l’agrocine 84 et des dérivés de ces molécules a révélé que seul le motif pyranose-2-phosphate commun aux 2 molécules était reconnu par AccA. Cela a été confirmé par microcalorimétrie et autofluorescence. Le motif pyranose-2-phosphate permettrait donc l’entrée de toute molécule qui le possède à une extrémité. La structure de l’enzyme AccF a montré que là encore seul le groupement pyranose-2-phosphate est reconnu. A partir de la structure obtenue et de modélisation du substrat dans le site actif, un mécanisme enzymatique original pour l’hydrolyse de la liaison phosphodiester est proposé. Les mesures d’affinité par microcalorimétrie montrent que seuls l’arabinose-2-phosphate et le glucose-2-phosphate sont capables de fixer AccR. Des expériences in cellulo ont confirmé qu'ils régulent bien l'expression du QS.Mes travaux apportent un éclairage nouveau sur l’import et l'utilisation de l’agrocinopine chez A. tumefaciens. La spécificité de reconnaissance de la PBP pour une partie de la molécule importée est observée chez d’autres PBP, et ouvre la voie à la conception de molécules antibiotiques qui, à l’image de l’agrocine 84, utilisent une stratégie de type « cheval de Troie ». / Agrobacterium tumefaciens is a soil bacterium responsible of the crown gall in plants when it possesses the Tumor inducing plasmid (pTi) which is also the virulence plasmid. The bacterium transfers a piece of DNA from the pTi into the plant genome. The transferred DNA codes for plant hormone synthesis, leading to the formation of tumors which are colonized by bacteria, on one hand, and on the other hand, for the synthesis of small molecules (opines) that are used as nutrients by A. tumefaciens. The opine agrocinopine A induces the production of quorum sensing signals responsible for the spread of the virulence plasmid from pathogenic to nonpathogenic bacterium. Agrobacterium radiobacter K84, a nonpathogenic bacterium, produces the agrocin 84, an antibiotic that kills A. tumefaciens.Import and catabolism of agrocinopine A are operated by acc operon, present on the pTi. The periplasmic binding protein AccA (PBP AccA) associated with the ABC transporter imports the opine into the periplasm where it is degraded by AccF and AccG. AccR regulates the expression of the acc operon and that of the transcription factor TraR, central in quorum sensing signaling. AccA also imports agrocin 84, which is activated by AccF. My PhD work focused on AccA and AccF specificity through structure-function studies and I initiated the study of the transcription factor AccR. The structural study of AccA in complex with agrocinopine A, agrocin 84 and derivatives from these molecules revealed that only the pyranose-2-phosphate motif, common in these two molecules, was recognized. Microcalorimetry and autofluorescence measurements confirmed this conclusion. The pyranose-2-phosphate motif would allow any compound possessing this motif at one end to be transported. The structure of the enzyme AccF showed that again only the pyranose-2-phosphate group is recognized. From the structure and molecular modelling of the substrate in the active site, an original mechanism of the phosphodiester bond cleavage is proposed. Microcalorimetry affinity measures showed that only the arabinose-2-phosphate and glucose-2-phosphate are capable of interacting with AccR. In cellulo experiments confirm that both compounds regulate the expression of quorum sensing.My work sheds light on import and use of agrocinopine in A. tumefaciens. Recognition specificity of the PBP AccA for a part of the imported molecule is observed in other PBPs and opens new ways for rational design of antibiotic compounds that, similarly to agrocin 84, would use the “Trojan horse” strategy.

La diversité morphologique des muscles squelettiques permet la précision et la coordination des mouvements propres à chaque espèce animale. L'établissement du patron musculaire a lieu au cours du développement embryonnaire durant le processus de myogenèse. Il a été décomposé en quatre étapes chez la drosophile : la spécification de groupes de myoblastes équivalents (groupes promusculaires) à des positions précises du mésoderme, la sélection d'une ou plusieurs cellules progéniteurs à partir de chaque groupe, la division asymétrique des progéniteurs en cellules fondatrices des muscles, et enfin, la fusion d'une cellule fondatrice avec un nombre défini de myoblastes compétents pour la fusion qui forme une myofibre syncytiale. Ce processus aboutit à la mise en place d'un patron stéréotypé de muscles morphologiquement distincts par leur taille, orientation, forme, et sites d'attachement au squelette ; ces caractères définissant l'identité du muscle. Chez la drosophile, chacun des 30 muscles par hémisegment de la larve est constitué d'une seule myofibre. Il a été proposé que l'identité morphologique de cette fibre soit contrôlée par une combinatoire de facteurs de transcription identitaires (FTi) exprimés par la cellule fondatrice. Mon projet de thèse a porté sur le contrôle transcriptionnel de l'identité musculaire, avec comme modèle d'étude, un muscle dorso-latéral de la larve de drosophile, le muscle DA3 dont un FTi est Collier/EBF (Col). La transcription de col est activée dans un groupe promusculaire, puis transitoirement dans les quatre progéniteurs issus de ce groupe, avant d'être maintenue spécifiquement dans la myofibre DA3. Dans des embryons mutants pour col, le DA3 est transformé en muscle plus dorsal, DA2. Les travaux précédents de l'équipe ont montré que la transcription de col dans le lignage DA3 est contrôlée par deux modules cis-régulateurs, EarlyCRM et LateCRM, séparés physiquement sur le chromosome et agissant séquentiellement. Leur chevauchement temporel d'activité restreint au progéniteur DA3 et l'autorégulation directe du LateCRM ont mené à l'hypothèse d'un mécanisme de " passage de témoin " entre ces deux CRM, spécifique au progéniteur DA3. L'objectif de ma thèse était de tester cette hypothèse et de comprendre comment une information temporelle et spatiale intégrée par un CRM est transmise à un autre CRM, pour définir une identité cellulaire, une question fondamentale au-delà du cas d'espèce que constitue le muscle DA3.[...] / The morphological diversity of skeletal muscles allows the precision and coordination of movements specific to each animal species. Establishment of a stereotypic pattern of muscles takes places during the process of myogenesis. Studies in Drosophila, an insect model, have identified four steps in this process: the specification of equivalence groups of myoblasts (promuscular clusters) at defined positions within the somatic mesoderm, the selection of progenitor(s) from each group, asymmetric division of each progenitor into post-mitotic muscle founder cells, and finally the fusion of each founder cell with a given number of fusion competent cells to form a syncytial myofiber. This dynamic, integrated process leads to establishing a stereotyped pattern of morphologically distinct muscles which can each be distinguished, based on size, orientation, shape, sites of attachment to the skeleton, all properties defining muscle identity. In the Drosophila larva, each of the about 30 different muscles per hemisegment is made of a single myofiber. It has been proposed that final morphology of a myofiber reflects the combinatorial code of identity Transcription Factors (iTF) expressed by its founder cell, although many questions remain unanswered. My thesis project aimed at better understanding the mechanism of specification of muscle identity, using as model a dorso-lateral muscle of the Drosophila larva, the DA3 muscle whose identity is controlled by the Collier/EBF (Col) iTF. col transcription is activated in one promuscular cluster, transient in the 4 progenitors issued from this cluster and stably maintained in the DA3 myofiber. In col mutant embryos, the DA3 muscle is transformed into a more dorsal, DA2-like muscle. Previous work has shown that col transcription in the DA3 lineage is controlled by two cis-regulatory modules (EarlyCRM and LateCRM), physically distant on the chromosome and acting sequentially. The temporal overlap of EarlyCRM and LateCRM in the DA3 progenitor and direct col autoregulation via the LateCRM led to hypothesize a handover between the two CRM in the DA3 progenitor. One goal of my thesis project was to challenge this hypothesis and understand how positional and temporal information integrated by EarlyCRM could be memorized via LateCRM, in order to specify cell identity, a fundamental question of developmental biology beyond the specific case of the Drosophila DA3 muscle. [...]

Chez les plantes comme chez les animaux, les protéines du groupe Polycomb (PcG) jouent des rôles essentiels dans les processus développementaux par la répression de l'expression des gènes. Ces protéines fonctionnent en complexes multi-protéiques; dont les mieux caractérisés sont Polycomb Repressive Complex 1 (PRC1) et PRC2. Bien que PRC2 a été étudié extensivement chez Arabidopsis, ce n’est que récemment que des composants de PRC1 ont été identifiés chez les plantes et leur mécanisme de fonctionnement reste peu conclusif. Dans mes travaux de thèse, j’ai caractérisé AtRING1, un sous-unité essentiel du PRC1, et AtZRF1, une protéine proposée comme lecteur de l’histone H2A monoubiquitinée (H2Aub1) en aval du fonctionnement du PRC1. Mes résultats montrent qu’une perte-de-fonction totale de AtRING1A, par ‘CRISPR/Cas9 gene-editing’, causes une létalité partielle embryonnaire et la dédifférenciation cellulaire de la plantule d’Arabidopsis. Les mutations du domaine RAWUL au C-terminal de AtRING1A sont plus tolérées mais induisent certains défauts sur la croissance végétative, la floraison, l’organogénèse, et la production des graines. Mes analyses moléculaires révèlent que ces mutations du domaine RAWUL réduisent H2Aub1 et augmentent l’expression de plusieurs gènes essentiels dans la régulation du développement de la plante. Ainsi, mes données ont permis à établir une fonction primordiale de AtRING1 et à attribuer un rôle de son domaine RAWUL dans la déposition de H2Aub1 et répression des gènes in vivo. Nos analyses sur AtZRF1 ont permis à détailler son rôle sur la division and différenciation cellulaire. / In plants as in animals, the Polycomb Group (PcG) proteins play key roles in diverse developmental processes by repressing the expression of genes. These proteins work in multi-protein complexes, among them the best characterized ones are Polycomb Repressive Complex 1 (PRC1) and PRC2. Although PRC2 was extensively studied in Arabidopsis, it is only recently that components of PRC1 were identified in plants and their function mechanism remains largely elusive. My thesis work focused on the characterization of AtRING1A, one of the PRC1 core subunits, and of AtZRF1, a protein proposed as a reader of the histone H2A-monoubiquitin (H2Aub1) downstream to the PRC1 function. My results show that a total loss-of-function of AtRING1A, by CRISPR/Cas9 gene editing, leads to partial embryonic lethal and callus-formation of seedlings in Arabidopsis. Several mutations within the RAWUL domain at the C-terminus of AtRING1A are better tolerated and induce several defects in plant vegetative growth, flowering time, floral organ formation and seed production. My molecular data indicate a role of the RAWUL domain in H2Aub1 deposition in vivo and suppression of several key developmental genes. Our characterization of loss-of-function of AtZRF1 provides important detailed information about its function in the regulation of cell division and cell differentiation.

<p>In every living cell, millions of different types of molecules constantly interact and react chemically in a complex system that can adapt to fluctuating environments and extreme conditions, living to survive and reproduce itself. The information required to produce these components is stored in the genome, which is copied in each cell division and transferred and mixed with another genome from parent to child. The regulatory mechanisms that control biological systems, for instance the regulation of expression levels for each gene, has evolved so that global robustness and ability to survive under harsh conditions is a strength, at the same time as biological tasks on a detailed molecular level must be carried out with good precision and without failures. This has resulted in systems that can be described as a hierarchy of levels of complexity: from the lowest level, where molecular mechanisms control other components at the same level, to pathways of coordinated interactions between components, formed to carry out particular biological tasks, and up to large-scale systems consisting of all components, connected in a network with a topology that makes the system robust and flexible. This thesis reports on work that model and analyze complex biological systems, and the signals and noise that regulate them, at all different levels of complexity. Also, it shows how signals are transduced vertically from one level to another, as when a single mutation can cause errors in low level mechanisms, disrupting pathways and create systemwide imbalances, such as in type 2 diabetes. The advancement of our knowledge of biological systems requires both that we go deeper and towards more detail, of single molecules in single cells, as well as taking a step back to understand the organisation and dynamics in the large networks of all components, and unite the different levels of complexity.</p>

Skin is the largest organ in the body that protects the organism from environmental, chemical and physical traumas of each passing day. The protective skin epidermal permeability barrier (EPB) is formed within the exterior layers of the epidermis, which are regularly sloughed off and repopulated by movement of inner cells. The epidermal permeability barrier is established during in utero development and maintained through lifetime. Impaired epidermal barrier formation is one of the major features of several dermatoses such as psoriasis and atopic dermatitis. Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting protein 2 (Ctip2), also known as Bcl11b, is a C���H��� zinc finger protein expressed in many organs and tissues. It has been shown to regulate the development of thymocyte, tooth and corticospinal motor neurons. Ctip2 is highly expressed in mouse epidermis during skin organogenesis and in adulthood. It is crucial for epidermal homeostasis and protective barrier formation in developing mouse embryos. Germline (Ctip2- null mice) and selective ablation of Ctip2 in mouse epidermis (Ctip2[superscript ep-/-] mice) leads to increased transepidermal water loss (TEWL), impaired epidermal proliferation and terminal differentiation as well as altered lipid distribution during embryogenesis. Sphingolipids account for ~50% of total skin lipids by weight and are crucial components of epidermal barrier. We have recently identified Ctip2 as a key regulator of skin lipid metabolism. Germline deletion of Ctip2 in mouse embryos leads to altered lipid composition in the developing mouse epidermis by modulating the expression levels of key enzymes involved in lipid metabolism (bio-synthesis and catabolism). We also demonstrated that Ctip2 is recruited to the promoter regions of several genes involved in the ceramide and sphingomyelin biosynthesis pathways and could directly regulate their expression. Thus, we have identified Ctip2 as a key regulator of several lipid metabolizing genes and hence epidermal sphingolipid biosynthesis during skin development. To study the role of Ctip2 in adult skin homeostasis, we have utilized Ctip2[superscript ep-/-] mouse model in which Ctip2 is selectively deleted in epidermal keratinocytes. We showed that keratinocytic ablation of Ctip2 leads to atopic dermatitis (AD)-like skin inflammation, characterized by alopecia, pruritus and scaling, as well as high infiltration of T lymphocytes and immune cells. We have also observed increased expression of Th2-type cytokines and chemokines in the mutant skin, as well as systemic immune responses that share similarity with human AD patients. Furthermore, we discovered that thymic stromal lymphopoietin (TSLP) expression is significantly upregulated in the mutant epidermis as early as postnatal day 1 and Ctip2 was recruited to the promoter region of the TSLP gene in mouse epidermal keratinocytes. The results suggest that upregulation of TSLP expression in the Ctip2[superscript ep-/-] epidermis could be due to a derepression of gene transcription in absence of Ctip2. Thus, our data demonstrated a cell-autonomous role of Ctip2 in barrier maintenance and epidermal homeostasis in adult skin, as well as a non-cell autonomous role of keratinocytic Ctip2 in suppressing skin inflammatory responses by regulating the expression of Th2-type cytokines in adult mouse skin. Present results establish an initiating role of epidermal TSLP in AD pathogenesis via a novel repressive regulatory mechanism mediated by Ctip2 in mouse epidermal keratinocytes. Altogether, our study indicates that Ctip2 could be involved in a diverse range of biological events in skin including barrier formation, maintenance and epidermal homeostasis. Ctip2 appears to be a master regulator in skin barrier functions by directly regulating the transcription of a subset of genes involved in lipid metabolism and inflammatory responses. / Graduation date: 2013

In every living cell, millions of different types of molecules constantly interact and react chemically in a complex system that can adapt to fluctuating environments and extreme conditions, living to survive and reproduce itself. The information required to produce these components is stored in the genome, which is copied in each cell division and transferred and mixed with another genome from parent to child. The regulatory mechanisms that control biological systems, for instance the regulation of expression levels for each gene, has evolved so that global robustness and ability to survive under harsh conditions is a strength, at the same time as biological tasks on a detailed molecular level must be carried out with good precision and without failures. This has resulted in systems that can be described as a hierarchy of levels of complexity: from the lowest level, where molecular mechanisms control other components at the same level, to pathways of coordinated interactions between components, formed to carry out particular biological tasks, and up to large-scale systems consisting of all components, connected in a network with a topology that makes the system robust and flexible. This thesis reports on work that model and analyze complex biological systems, and the signals and noise that regulate them, at all different levels of complexity. Also, it shows how signals are transduced vertically from one level to another, as when a single mutation can cause errors in low level mechanisms, disrupting pathways and create systemwide imbalances, such as in type 2 diabetes. The advancement of our knowledge of biological systems requires both that we go deeper and towards more detail, of single molecules in single cells, as well as taking a step back to understand the organisation and dynamics in the large networks of all components, and unite the different levels of complexity.

The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)

Major Histocompatibility Complex (MHC) class II molecules are indispensable arms of the im-mune system that present extracellular antigens to CD4+T cells and initiate the adaptive immune response. MHC class II expression requires recruitment of a master regulator, the class II trans-activator (CIITA). How this master transcriptional regulator is recruited, stabilized and degraded is unknown. The 26S proteasome, a master regulator of protein degradation, is a multi-subunit complex composed of a 20S core particle capped on one or both ends by 19S regulatory particles. Previous findings have linked CIITA and MHC class II transcription to the ubiquitin proteasome system (UPS) as mono-ubiquitination of CIITA increases its transactivity whereas poly-ubiquitination targets CIITA for degradation. Increasing evidence indicates individual ATPase subunits of the 19S regulator play non-proteolytic roles in transcriptional regulation and histone modification. Our initial observations indicate proteasome inhibition decreases CIITA transac-tivity and MHC class II expression without affecting CIITA expression levels. Following cyto-kine stimulation, the 19S ATPase Sug1 associates with CIITA and with the MHC class II enhan-ceosome complex. Absence of Sug1 reduces promoter recruitment of CIITA and proteasome inhibition fails to restore CIITA binding, indicating Sug1 is required for CIITA mediated MHC class II expression. Furthermore, we identify a novel N-terminal 19S ATPase binding domain (ABD) within CIITA. The ABD of CIITA lies within the Proline/Serine/Threonine (P/S/T) re-gion of CIITA and encompasses a majority of the CIITA degron sequence. Absence of the ABD increases CIITA half-life, but blocks MHC class II surface expression, indicating that CIITA requires interaction with the 19S ATPases for both its deployment and destruction. Finally, we identify three degron proximal lysine residues, lysines (K): K315, K330 and K333, and a phosphorylation site, serine (S), S280, located within the CIITA degron, that regulate CIITA ubiquitination, stability and MHC class II expression. These are the first lysine residues identified as sites of CIITA ubiquitination that are essential for MHC class II expression. These observations increase our understanding of the role of the UPS in modulating CIITA mediated MHC class II transcription and will facilitate the development of novel therapies involving manipulation of MHC class II gene expression.

Major Histocompatibility Complex Class-II (MHC-II) molecules are critical regulators of adaptive immunity that present extracellular antigens required to activate CD4+ T cells. MHC-II are regulated at the level of transcription by master regulator, the Class II Transactivator (CIITA), whose association with the MHC-II promoter is necessary to initiate transcription. Recently, much research focused on novel mechanisms of transcriptional regulation of critical genes like MHC-II and CIITA; findings that the macromolecular complex of the 26S-proteasome is involved in transcription have been perhaps the most exciting as they impart novel functions to a well studied system. Proteasome is a multi-subunit complex composed of a 20S-core particle capped by a 19S-regulatory particle. The 19S contains six ATPases which are required for transcription initiation and elongation. We demonstrate that 19S ATPase-S6a inducibly associates with CIITA promoters. Decreased expression of S6a negatively impacts recruitment of the transcription factors STAT-1 and IRF-1 to the CIITA due to significant loss in histone H3 and H4 acetylation. S6a is robustly recruited to CIITA coding regions, where S6a binding coordinates with that of RNA polymerase II. RNAi mediated S6a knockdown significantly diminishes recruitment of Pol II and P-TEF-b components to CIITA coding regions, indicating S6a plays important roles in transcriptional elongation. Our research is focused on the ways in which accessibility to and transcription of DNA is regulated. While cancers are frequently linked to dysregulated gene expression, contribution of epigenetics to cancers remains unknown. To achieve metastatic ability, tumors alter gene expression to escape host immunosurveilance. MHC-II and CIITA expression are significantly downregulated in highly metastatic MDA-MB-435 breast cancer cells. This suppression correlates with elevated levels of the silencing modification H3K27me3 at CIITA and a significant reduction in Pol II recruitment. We observe elevated binding of the histone methyltransferase to CIITApIV and demonstrate this enzyme is a master regulator of CIITA gene expression. EZH2 knockdown results in significant increases in CIITA and MHC-II transcript levels in metastatic cells. In sum, transcriptional regulation by the 19S-proteasome and histone modifying enzymes represents novel mechanisms of control of mammalian gene expression and present novel therapeutic targets for manipulating MHC expression in disease.