O papilomavirus humano (HPV) é o agente etiológico da infecção sexualmente transmissível mais comum na população mundial. A prevalência da infecção por HPV é estimada em 660 milhões de pessoas e mais de 50% das mulheres serão acometidas pela infecção ao menos uma vez na vida. O HPV é responsável por virtualmente todos os casos de câncer de colo de útero (99%), além de causar muitos outros tipos de câncer de mucosa. O câncer cervical afeta aproximadamente 1.4 milhões de mulheres e 500 mil novos casos surgem anualmente, resultando em 250 mil mortes por ano. Os maiores índices de incidência são observados na América Latina e na África. Duas vacinas contra o HPV são comercializadas desde 2006 por empresas estrangeiras. Entretanto, o custo mínimo da vacinação é superior a 600 reais. Este preço torna sua incorporação pelo sistema de saúde um processo economicamente inviável. Dessa forma, devem ser buscadas alternativas para a produção de uma vacina eficaz, de qualidade e de baixo custo no Brasil. A proteína L1, principal proteína do capsídeo do HPV, tem a propriedade de se auto agregar em partículas semelhantes às virais (VLPs), que são o principal componente das vacinas atuais e possuem muita semelhança com os vírions nativos, introduzindo inclusive, uma imunização predominantemente tipo-específica. Este projeto se propôs a construir e avaliar vetores de expressão visando à produção em larga escala da proteína L1 do HPV 16, o tipo de HPV de maior risco e incidência na população mundial. Foram construídos cinco plasmídeos para Pichia pastoris, uma das principais plataformas industriais de expressão. Eles se diferenciam pelos marcadores de seleção e pelas sequências de manutenção do vetor, mas têm exatamente o mesmo objetivo: gerar sistemas que possuam múltiplas cópias do gene da L1 e que não necessitem da utilização de antibióticos. Essa estratégia foi escolhida porque a produtividade de muitas das proteínas heterólogas tem grande dependência da dosagem gênica e porque o uso de antibióticos encarece muito o custo da produção. Na primeira etapa do projeto foi avaliado um sistema de expressão epissomal auxotrófico, mas ele não se manteve estável ao longo de 60 gerações. Na segunda parte, dois vetores de integração ao sítio do DNA ribossomal foram testados. O sistema mais estável e produtivo foi caracterizado quanto ao número de cópias integradas ao genoma da P. pastoris e ao nível de expressão. O sistema é capaz de produzir clones com mais de 30 cópias do gene da L1 e dois clones expressaram cerca de 20 a 30 miligramas/litro de L1. Adicionalmente outros dois vetores integrativos que utilizam sequências teloméricas para integração foram construídos. Ainda são necessários estudos conjuntos de fermentação em larga escala e purificação da proteína para verificar a viabilidade do sistema / The human papillomavirus (HPV) is the etiologic agent of the sexually transmitted infection most common worldwide. The prevalence of HPV infection is estimated at 660 million people and over 50% of women will be affected by the infection at least once in their lifetime. HPV is responsible for virtually all cervical cancers cases (99%), and causes many other types of mucosal cancer. Cervical cancer affects approximately 1.4 million women, and 500.000 new cases occur annually, resulting in 250.000 deaths per year. The highest incidence rates are seen in Latin America and Africa. Two HPV vaccines are marketed since 2006 by foreign companies. However, the minimum cost of vaccination is higher than 360 dollar. This price makes its incorporation by the Brazilian Health System economically unfeasible. Thus, alternatives must be found to produce an effective vaccine, with low cost and high-quality in Brazil. The L1 protein, the major capsid protein of HPV, has the ability to self aggregate into virus-like particles (VLPs) which are the main component of current vaccines. The VLPs are very similar to the native virions and can introduce an immunization predominantly type-specific. This project aimed to construct and evaluate expression vectors to produce, at large scale, the L1 protein of HPV 16, which is the HPV type at greater risk and incidence in the world. Five plasmids were constructed for Pichia pastoris, one of the major industrial expression platforms. They differ in the selection markers and the vector maintenance sequences, but they have exactly the same goal: to create systems with multiple copies of the L1 gene and that don\'t require the use of antibiotics. This strategy was chosen because the productivity of many heterologous proteins have heavy dependence on gene dosage and because the use of antibiotics is extremely expensive for its production. In the first stage of the project, it was rated an episomal auxotrophic expression system, but it was unstable after a period of 60 generations. In the second part, two vectors for integration in the ribosomal DNA locus were tested. The most stable and productive system was featured on the number of copies integrated into the P. pastoris genome and on the expression level. It was proved that the system is able to produce clones with more than 30 copies of the L1 gene and two clones expressed approximately 20-30 milligrams/liter of L1. Additionally, two other integrative vectors for integration in telomeric sequences were constructed for future testing. More studies on large-scale fermentation and protein purification will be necessary to determine the feasibility of the system.

A malária é um problema de saúde pública no Brasil e no mundo. Em 2016, o número de casos estimado pela Organização Mundial de Saúde foi de 216 milhões. Plasmodium falciparum é a espécie mais prevalente e responsável pelo maior número de mortes no mundo, sobretudo no continente africano. Por outro lado, o Plasmodium vivax é conhecido por sua ampla distribuição geográfica, sendo a espécie que predomina nas Américas, incluindo o Brasil. Nos últimos 20 anos, nosso grupo tem gerado e caracterizado diversas proteínas recombinantes baseadas em antígenos imunodominantes de P. vivax que podem servir como base para o desenvolvimento de uma vacina contra malária. Entre os antígenos de merozoítas, uma das principais proteínas em estudo pelo nosso grupo é o Antígeno 1 de Membrana Apical de P. vivax (PvAMA-1), caracterizado previamente como altamente imunogênico em infecções naturais e em camundongos imunizados, na presença de diferentes adjuvantes. O objetivo do presente estudo foi investigar o efeito da diversidade antigênica dessa proteína no reconhecimento por anticorpos específicos e na indução de imunidade contra o parasita. Para isso, foram geradas seis novas proteínas representando diferentes alelos descritos na natureza: PvAMA-1-Belem, PvAMA-1-Sal-I, PvAMA-1-Chesson-I, PvAMA-1-SK0814-apical, PvAMA-1-Indonesia-XIX e PvAMA-1-PNG_62_MU. As proteínas recombinantes foram expressas em leveduras Pichia pastoris e purificadas em duas etapas cromatográficas. Em seguida, as imunizações em camundongos C57BL/6 foram realizadas com as proteínas administradas de forma isolada, ou em combinação, na presença do adjuvante agonista de TLR3 (Poly I:C). Por ELISA, observamos que todas as formulações foram capazes de induzir anticorpos IgG contra as proteínas homólogas e heterólogas, o que sugere que a diversidade antigênica entre as formas alélicas não compromete o reconhecimento. Os dados gerados no presente trabalho sugerem que uma formulação contendo mistura de diferentes alelos representando a proteína AMA-1 pode ser explorada para o desenvolvimento de uma vacina de ampla cobertura contra o P. vivax. / Malaria is a public health problem in Brazil and throughout the world. In 2016, the World Health Organization estimated there were 216 million cases of malaria. Plasmodium falciparum is the most prevalent species and is responsible for the largest number of deaths, especially in the African continent. However, Plasmodium vivax is known for its wide geographic distribution, being the species that prevails in the Americas, including Brazil. In the last 20 years, our group has generated and characterized several recombinant proteins based on immunodominant antigens of P. vivax that can serve as a basis for the development of a malaria vaccine. Among the merozoite antigens, one of the main proteins studied by our group is P. vivax apical membrane antigen-1 (PvAMA-1), previously characterized as highly immunogenic in natural infections and immunized mice, in the presence of different adjuvants. The objective of this study was to investigate the effect of antigenic diversity of this protein in the recognition of specific antibodies and the induction of immunity against the parasite. For this, six new proteins were generated representing different alleles described in nature: PvAMA-1-Belem, PvAMA-1-Sal-i, PvAMA-1-Chesson-i, PvAMA-1-SK0814-apical, PvAMA-1-Indonesia-XIX, and PvAMA-1-PNG_62_MU. Recombinant proteins were expressed in Pichia pastoris yeast and purified by two chromatographic stages. Then, C57BL/6 mice were immunized with these proteins administered in isolation or in combination, in the presence of the TLR3 agonist adjuvant, Poly I:C. Using an enzyme-linked immunosorbent assay, we observed that all formulations induced IgG antibodies against homologous and heterologous proteins. This indicates that antigenic diversity between allele forms does not compromise recognition. This finding suggests that a formulation containing a mixture of different alleles representing the PvAMA-1 protein can be exploited for developing of a wide coverage vaccine against P. vivax.

No experimento 1, avaliou-se os efeitos da leptina exógena na concentração sérica de leptina e na expressão do gene LEP no tecido adiposo de novilhas zebuínas pré-púberes. Amostras de tecido adiposo (mesentérico, perirenal e subcutâneo) e de sangue foram obtidas de 36 novilhas, distribuídas nos tratamentos: A) dieta de alta energia; B) dieta de baixa energia; BL) dieta de baixa energia + 4,8 g/kg PV de oLeptin subcutânea, duas vezes ao dia, por 56 dias. A concentração de leptina foi determinada com kit comercial ELISA (Cusabio) específico. Amostras de sangue de quatro novilhas por grupo foram coletadas em seis pontos no tempo, sendo um antes e um após o tratamento hormonal. Dois dias após a obtenção da puberdade, oito novilhas por grupo foram abatidas para coleta de tecido. A expressão gênica foi quantificada nos depósitos de gordura por PCR em tempo real. A oLeptina aumentou transitoriamente a concentração de leptina do grupo BL, com pico (11,1 ± 1,4 ng/mL) após 7 dias do início do tratamento. A leptina sérica do grupo A aumentou linearmente no tempo, enquanto no grupo B, manteve-se constante (4,0 ± 2,0 ng/mL). A dieta A aumentou a expressão de leptina no tecido adiposo em 2,4 vezes; e a administração de oLeptina diminuiu a expressão do gene LEP em cerca de 2,5 vezes, comparando com o grupo controle. A redução na expressão do gene LEP explica a redução na leptina sérica do grupo BL após 30 dias de tratamento hormonal. O objetivo do experimento 2 foi clonar a região codificadora da leptina bovina, transformar leveduras Pichia pastoris KM71H e expressar a proteína no meio de cultura. O gene da leptina foi amplificado em reação de PCR, a partir de amostra de tecido adiposo subcutâneo de novilha do grupo A. Os primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (senso) e 5\' - ATTGTCGACGCACCCGGGACTGAGGT - 3\' (antisenso), contendo sítios EcoRI e SalI, foram desenhados com base na sequência do mRNA da leptina bovina (NM 173928.2), substituindo a sequência sinal de secreção nativa pela sequência do Fator do Saccharomyces cereviasiae. O inserto foi clonado nos vetores de expressão pPICZαA e pGAPZαA (Invitrogen), sendo as leveduras transformadas por eletroporação. Clones com múltiplas cópias do gene foram selecionados em meio YPD + 500 μg/mL de zeocina, e 22 colônias recombinantes foram selecionadas para análise de expressão em pequena escala. Colônias pPICbLep foram inicialmente cultivadas em meio de crescimento (BMGY), sendo transferidas para meio de indução (BMMY), contendo metanol. A indução durou 144 horas. Alíquotas de 200 μl de sobrenadante foram coletadas diariamente, para análise da presença da bLeptina por SDS-PAGE. As colônias pGAPbLep foram cultivadas em meio YPD por 96 h, com coleta de sobrenadante a cada 24 h. As leveduras foram transformadas com sucesso, com os plasmídeos pPICbLep e pGAPbLep, entretanto, apenas as colônias pGAPbLep expressaram uma proteína de 35 kDa, o dobro do tamanho esperado para a bLeptina (17 kDa), provavelmente por ocorrência de dimerização. Mais estudos são necessários sobre os processos de produção de leptina recombinante bovina em Pichia pastoris. / In experiment 1, the effects of exogenous leptin were evaluated on serum leptin levels and on LEP gene expression in the adipose tissue of prepubertal zebu heifers. Adipose tissue (mesenteric, perirenal and subcutaneous) and blood samples were collected from 36 heifers, distributed among treatments: A) high energy diet; B) low energy diet; BL) low energy diet + 4,8 g/kg BW subcutaneous oLeptin, twice daily, for 56 days. Leptin concentration was determined with specific commercial ELISA kit (Cusabio). Blood from four heifer per group was sampled in six time points, one before and one after the hormonal treatment. Two days after puberty attainment , eight heifers per group were slaughter for tissue sampling. Gene expression was quantified in fat depots by real time PCR. The oLeptin increased transiently leptin concentration in group BL, with a peak (11,1 ± 1,4 ng/mL) after 7 days of treatment. Serum leptin in group A increased linearly in time, while in group B it remained constant (4,0 ± 2,0 ng/mL). Diet A enhanced leptin expression in the adipose tissue 2.4-fold, and oLeptin administration decreased de expression 2.5-fold, comparing to the control group. The decrease in LEP gene expression explains the reduction in serum leptin from group BL after 30 d of hormonal treatment. The objective with experiment 2 was to clone de codifying region of bovine leptin, transform KM71H Pichia pastoris yeasts, and express the protein in culture media. The leptin gene was amplified by PCR, from subcutaneous adipose tissue sample from a heifer in group A. Primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (forward) and 5\' - ATTGTCGACGCACCCGGGACTGAGGT 3 (reverse), containing EcoRI and SalI restriction sites, were designed based in the mRNA sequence from bovine leptin (NM 173928.2), replacing the native secretion signal sequence by the -factor sequence from Saccharomyces cereviasiae. The insert was cloned in the expression vectors pPICZαA and pGAPZαA (Invitrogen), and yeasts were transformed by electroporation. Clones with multiple copies of the gene were selected in YPD + 500 μg/mL zeocina, and 22 recombinant colonies were selected for a small-scale expression analysis. pPICbLep colonies were initially cultivated in growth media (BMGY), and then transferred to the induction media (BMMY), containing methanol. The colonies were inducted for 144 h. Supernatant aliquots (200 μl) were collected daily, for bLeptin analysis in SDS-PAGE. pGAPbLep colonies were cultivated in YPD media for 96 h, collecting supernatant samples each 24 h. Yeasts were successfully transformed with the plasmids pPICbLep and pGAPbLep, however, only pGAPbLep colonies expressed a protein with 35 kDa, twice the size expected for the bovine leptin (17 kDa), probably because of dimerization. More studies are necessary about the recombinant bovine leptin production processes in Pichia pastoris.

Os mastócitos, em associação com outras células inflamatórias se acumulam em locais de tumor. Entretanto, pouco é conhecido sobre o papel exato dos mastócitos e de seus mediadores na progressão tumoral e angiogênese. Resultados recentes do nosso laboratório mostraram que a expressão das triptases específicas de mastócitos está correlacionada com a progressão tumoral (de Souza, Jr, PLosOne 7(7): e40790). Além do mais, existe uma associação entre mastócitos e a angiogênese tumoral. Então, tornou-se interessante investigar o papel das quimases específicas de mastócitos (mMCP-4 e -5) neste processo. Visto que estas quimases não são disponíveis comercialmente, a primeira etapa deste estudo foi produzir as quimases mMCP-4 e -5 recombinantes. Assim, as sequências dos genes respectivos para mMCP-4 e -5, além das sequências para seis resíduos de His e do sítio suscetível a enteroquinase foram clonadas no vetor de expressão pPIC9. A cepa GS115 de Pichia pastoris foi transformada com o respectivo vetor para mMCP-4 ou -5. Os clones transformados foram crescidos em meio BMMY e induzidos com várias concentrações de metanol para a produção de mMCP-4 ou -5 recombinantes. Depois de 96 horas, o meio foi centrifugado e as quimases mMCP-4 ou -5 foram purificadas do sobrenadante usando resina de níquel. A identidade das proteínas foi confirmada por Western Blotting usando o anticorpo anti-his, assim como os anticorpos anti-mMCP-4 e -5. As proteases foram ativadas pela clivagem do sítio suscetível a enteroquinase por cinco horas, a 22°C. A ativação das enzimas foi confirmada através da degradação de seus substratos específicos. Estes resultados mostram que P. pastoris é um organismo eficiente para a expressão de ambas as proteases. Estas proteases recombinantes se constituem em ferramentas importantes para se elucidar o papel da mMCP-4 ou -5 na angiogênese. / Mast cells, in association with other inflammatory cells, are known to accumulate at tumor sites. However, little is known about the exact role that mast cells and their mediators play in tumor progression and angiogenesis. Recent results from our laboratory have shown that expression of mast cell specific tryptases correlates with tumor progression (de Souza, Jr, PLosOne 7(7): e40790). Furthermore, there is an association between mast cells and tumor angiogenesis. It then became of interest to investigate the role of mast cell specific chymases (mMCP-4 and -5) in this process. Since these chymases are not commercially available, the first step in this study was to produce recombinant mMCP-4 and -5. The gene sequences for these chymases along with the sequence for six His residues and an enterokinase susceptible peptide were cloned into the expression vector pPIC9. The GS115 strain of Pichia pastoris was transformed with the respective vector for either rmMCP-4 or -5. The transformed clones were grown in BMMY media and induced to produce rmMCP-4 or -5 with various concentrations of methanol. After 96 hours, the medium was centrifuged and rmMCP-4 or -5 was purified from the supernatant using nickel-nitrilotriacetic acid agarose beads. The identity of the proteins was confirmed by Western blotting using an anti-his antibody as well as anti-mMCP-4 and -5. These results show that P. pastoris is an efficient organism in which to express both proteases.

Orientadores: Francisco Maugeri Filho, Gonçalo Amarante Guimarães Pereira / Tese (doutorado) - Universidade Estadual de Campinas, Faculdade de Engenharia de Alimentos / Made available in DSpace on 2018-08-25T00:15:25Z (GMT). No. of bitstreams: 1 Andrade_CristianeContePaimde_D.pdf: 8118229 bytes, checksum: e37327c8c0a8a32ecfc89552e46cbd0d (MD5) Previous issue date: 2014 / Resumo: Xilanases são enzimas que hidrolisam as ligações glicosídicas entre as unidades de xilose que compõem a xilana, o principal constituinte hemicelulósico. Devido à grande disponibilidade desse tipo de material na natureza, as xilanases podem ser empregadas em diversos ramos, como nas indústrias têxtil, de alimentos e de rações, na bioconversão de resíduos lignocelulósicos, no clareamento de papel e polpa, e no tratamento de resíduos. Visando descrever novas enzimas para futuras aplicações, este trabalho teve como objetivo purificar e caracterizar a xilanase produzida pelo basidiomiceto Cryptococcus sp. LEB-AY10, uma levedura previamente isolada da Mata Atlântica e selecionada pela produção de enzima termoestável. Para tanto, o micro-organismo foi inicialmente identificado em nível de espécie e depositado como C. flavescens LEB-AY10 (CCT 7725); em sequência, foi estudada a produção da enzima utilizando, como substrato, bagaço de cana-de-açúcar, pré-tratado por explosão a vapor em três diferentes condições, bem como suas respectivas frações solúveis, e suplementados com melaço ou componentes sintéticos. Tendo sido definida a metodologia de tratamento do bagaço, técnicas de planejamento experimental foram utilizadas para estudar a influência das variáveis de cultivo e aumentar a atividade da xilanase produzida. Nas condições otimizadas, obteve-se aumento de 5,6 vezes na atividade em relação aos testes iniciais, atingindo 4,67 U/mL (a 50°C) ou 8,33 U/mL (a 80°C) em 96 h de incubação. Posteriormente, realizou-se a purificação da xilanase em duas etapas cromatográficas (troca iônica e permeação em gel), sendo possível recuperar 45% da atividade inicial. A massa molecular média foi estimada em 48 kDa. A enzima apresentou atividade ótima a 77,5°C e maior estabilidade em pH próximo a 5,3. Neste pH, as meias-vidas desta enzima foram estimadas em 9,2 minutos a 77,5°C e 33,74 h a 67°C. Os parâmetros cinéticos Km e vmax utilizando xilana de bétula (birchwood) como substrato foram 4,13 g/L e 2,32 U/mL, respectivamente. A xilanase purificada apresentou baixas atividades de ?-xilosidase em 4-nitrofenil-?-D-xilopiranosídeo (0,02 U/mg) e de celulase em carboximetilcelulose (0,99 U/mg). Os produtos de hidrólise da xilana de faia (beechwood) pela xilanase de C. flavescens LEB-AY10 foram, principalmente, xilobiose e xilotriose. Para identificação do gene responsável pela produção da xilanase, foram utilizadas três estratégias: amplificação com primers degenerados, identificação de peptídeos por espectrometria de massas e sequenciamento do genoma da levedura. Um único gene (1265 pb) denominado Xyn10Cf foi identificado e o correspondente cDNA (1035 pb) foi clonado em Escherichia coli DH10B. O gene é interrompido por 6 íntrons, codifica um peptídeo sinal composto por 13 aminoácidos e a proteína madura é formada por 331 aminoácidos, tendo sua massa molecular estimada em 37,1 kDa (podendo conter cerca de 11 kDa de glicosilação). Com base na sequência de nucleotídeos e na caracterização da enzima purificada, a proteína foi classificada como membro da família GH10. Por fim, para comprovar a funcionalidade do gene identificado Xyn10Cf foi realizada a expressão na linhagem de Pichia pastoris GS115 sob o controle dos promotores álcool oxidase 1 (AOX1) ou gliceraldeído-3-fosfato desidrogenase (GAPDH), atingindo 5,66 U/mL e 7,67 U/mL, respectivamente, para 84 h de indução em frascos agitados / Abstract: Xylanases are enzymes that hydrolyze the glycosidic bonds between the xylose units of xylan, the main hemicellulosic compound. Due to the high availability in nature of this kind of material, the xylanases may be used in a wide range of industrial plants, including: textile, food and feed industries, bioconversion of lignocellulosic wastes, biobleaching of paper and pulp, and waste treatment. In order to describe novel enzymes for future applications, the goal of this work is to purify and characterize the xylanase produced by the basidiomycete Cryptococcus sp. LEB-AY10, a yeast previously isolated in the Atlantic Forest and selected by the production of a thermostable enzyme. First, the microorganism was identified at the species level and deposited as C. flavescens LEB-AY10 (CCT 7725); then, enzyme production was studied using the substrate sugarcane bagasse, pretreated by steam explosion in three different conditions, as well their corresponding soluble fractions, and supplemented with molasses or synthetic compounds. After selection of the treatment, experimental design techniques were used to assess the influence of cultivation variables and to increase the activity of produced xylanase. At optimized conditions, it was possible to increase activity by 5.6 times from initial assays, reaching 4.67 U/mL (at 50°C) or 8.33 U/mL (at 80°C) after 96 h of incubation. Later, the purification of the xylanase was performed in two chromatographic steps (ion exchange and gel permeation), in which it was possible to recover 45% of initial activity. The average molecular weight was estimated at 48 kDa. The enzyme showed optimal activity at 77.5°C and it was most stable at pH values near 5.3. At this pH, the half-lives of this enzyme were 9.2 min at 77.5°C and 33.74 h at 67°C. The kinetic parameters Km and vmax for Birchwood xylan were 4.13 g/L and 2.32 U/mL, respectively. The purified xylanase showed low activity of ?-xylosidase on 4-nitrophenyl-?-D-xilopiranosídeo (0.02 U/mg) and also showed some cellulase activity on carboxymethylcellulose (0.99 U/mg). The hydrolysis products of Beechwood xylan by the xylanase from C. flavescens LEB-AY10 were mainly xylobiose and xylotriose. For identification of the gene responsible for xylanase production, three strategies were used: amplification of degenerated primers, identification of peptides by mass spectrometry and yeast genome sequencing. A single gene (1265 pb) named Xyn10Cf was identified and the corresponding cDNA (1035 pb) was cloned into Escherichia coli DH10B. The gene is interrupted by 6 introns, it codifies a signal peptide of 13 amino acids and the mature protein is composed by 331 amino acids, with an estimated molecular mass of 37.1 kDa (it may contain around 11 kDa of glycosilation). Based on nucleotide sequencing and on characterization of the purified enzyme, the protein was classified as a member of GH10 family. Finally, to prove the functionality of the identified gene Xyn10Cf, the expression in Pichia pastoris GS115 strain was performed under the control of alcohol oxidase 1 (AOX1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoters, reaching 5.66 U/mL and 7.67 U/mL, respectively, after 84 h of incubation in shaker flasks / Doutorado / Engenharia de Alimentos / Doutora em Engenharia de Alimentos

Made available in DSpace on 2014-08-20T13:32:56Z (GMT). No. of bitstreams: 1 tese_daiane_drawanz_hartwig.pdf: 4007239 bytes, checksum: 7d50e5824c8c66e23049bd005ad56ea6 (MD5) Previous issue date: 2010-12-20 / Leptospirosis is a serious infectious disease caused by pathogenic spirochetes of the genus Leptospira, it is classified as a zoonosis of worldwide distribution. This disease results morbidity and mortality in humans and animals, justifying the application of prophylactic strategies. Current vaccines against leptospirosis are composed of inactivated bacteria and do not stimulate cross-protection. Thus, there is need to develop a safe and effective vaccine. In this study, we used the outer membrane proteins LigANI e LipL32, because they have been identified as vaccinogens. These, in their recombinant form, are usually expressed in Escherichia coli and as subunit vaccines have shown variable efficacy. We describe in this work the use of Pichia pastoris as an alternative expression system. The genes ligANI and lipL32 were cloned into vector pPICZαB, which allowed the secretory expression of proteins in P. pastoris. The protein yield in this system was 276 mg/L for LigANI and 285 mg/L for LipL32. The recombinant proteins were glycosylated and remained antigenic. The immunoprotective potential was evaluated in the hamster model, challenged with virulent L. interrogans serovar Copenhageni. Both proteins induced high levels of antibodies (P < 0.001). The animals immunized with LigANI and LipL32 using aluminium hydroxide as adjuvant, showed no protection against challenge, but showed a significant increase in survival (P < 0.001). In conclusion, the yeast P. pastoris has proved an efficient heterologous expression system of LigANI and LipL32 L. interrogans proteins. The secreted and glycosylated LigANI protein may be used in the control of leptospirosis, although additional studies are needed. / Leptospirose é uma doença infecciosa grave causada por espiroquetas patogênicas do gênero Leptospira, sendo classificada como uma zoonose de ampla distribuição mundial. Esta doença resulta morbidade e mortalidade em humanos e animais, justificando a aplicação de estratégias profiláticas. As vacinas atuais contra a leptospirose são compostas por bactérias inativadas e não estimulam proteção cruzada. Assim, existe a necessidade de desenvolver uma vacina efetiva. No presente estudo, as proteínas de membrana externa LigANI e LipL32 foram utilizadas, pois são apontadas como potenciais vacinógenos. Estas, em sua forma recombinante, costumam ser expressas em Escherichia coli e, como vacina de subunidade tem apresentado eficiência variável. Nós descrevemos neste trabalho a utilização da levedura Pichia pastoris como sistema de expressão alternativo. Os genes ligANI e lipL32 foram clonados no vetor pPICZαB, que permitiu a expressão secretória das proteínas em P. pastoris. O rendimento das proteínas neste sistema foi de 276 mg/L para LigANI e 285 mg/L para LipL32. As proteínas recombinantes foram glicosiladas e mantiveram-se antigênicas. O potencial imunoprotetor das proteínas foi avaliado em modelo hamster desafiado com cepa virulenta de L. interrogans sorovar Copenhageni. Ambas as proteínas induziram altas taxas de anticorpos (P < 0,001). Os animais imunizados com LigANI e LipL32, utilizando hidróxido de alumínio como adjuvante, não apresentaram proteção contra o desafio, mas demonstraram um aumento significativo na sobrevida (P < 0,001). Em conclusão, a levedura P. pastoris demonstrou ser um eficiente sistema de expressão heterólogo das proteínas LigANI e LipL32 de L. interrogans. A proteína LigANI secretada e glicosilada pode ser utilizada no controle da leptospirose, embora estudos adicionais sejam necessários.

Pichia pastoris, a popular protein expression system, is limited in its ability to secrete heterologous proteins. The PMR1 gene, the disruption of which is known to improve the secretion of prochymosin, human prourokinase, and human tissue plasminogen activator in Saccharomyces cerevisiae, was cloned from P. pastoris. The pmr 1 mutant in S. cerevisiae also displayed a slow growth phenotype when grown on low Ca2+ medium. The putative P. pastoris PMR1 gene, encoding for a 924 amino acid P-type Ca2+ ATPase, was disrupted in P. pastoris and the secretion of horseradish peroxidase (HRP) and β-galactosidase (β-gal) analyzed. Secreted HRP activity was determined using 3,3',5,5' tetramethylbenzidine (TMB) colorimetric assay and western analysis. β-gal expression and secretion was determined by western analysis. Secretion in P. pastorius Δpmr1 for both heterologous proteins showed no appreciable difference compared to wild type, nor did P. pastoris Δpmr1 display the slow growth phenotype seen in S. cerevisiae Δpmr1 (Rudolph H. et al., 1989).

Made available in DSpace on 2014-07-29T15:16:31Z (GMT). No. of bitstreams: 1 Dissertacao Lorena Cardoso Cintra.pdf: 4143916 bytes, checksum: 422ca8b39c01e66c797228b6083cedf8 (MD5) Previous issue date: 2010-08-27 / The termodimorphic fungus Paracoccidioides brasiliensis is the etiological agent of paracoccidioidomycosis, a human systemic mycosis of high prevalence in Latin America. P. brasiliensis is exposed to oxidative stress (OS) caused by reactive oxygen species (ROS) produced by the defense cells of the human host. When the invasion by pathogens occurs, the host defense system generates ROS to fight the invader. Inside the human host, P. brasiliensis is phagocytosed by macrophages, facing an extremely hostile environment due to nitric oxide and hydrogen peroxide. The Trx1 is an intracellular redox protein, which participates in the maintenance of cell redox homeostasis, both in terms of OS as reducer. It is ubiquitous and is characterized by typical CXXC active site, responsible for oxidation, reduction, or isomerization of proteins disulfide bonds. In a previous work, it was isolated, characterized and cloned into expression vector pGEX-4T-3 cDNA coding for TRX1 of P. brasiliensis (accession number AY376435). The recombinant protein (recPbTRX1) was produced and partially purified and the yeast cells of P. brasiliensis showed increased expression of the gene coding for PbTRX1 in response to OS. This study aimed the heterologous expression of cDNA of a thioredoxin of the fungus P. brasiliensis in Pichia pastoris, in order to obtain it in larger amounts for their subsequent biochemical characterization and application in biotechnological processes. The P. brasiliensis thioredoxin 1 (trx1) cDNA was obtained via PCR using the plasmid pGEX-Trx1 as template and cloned into expression vector pHIL-D2 and pPIC9 (for intracellular and extracellular expression). The insertion of the interested gene in the correct orientation was verified by sequencing and the homology was observed with Trx1 P. brasiliensis. These vectors were used to transform the P. pastoris yeast strain SMD1168 with his4- genotype. The presence of the cassette s expression was confirmed in the yeast s genome. No transformants able to secrete the protein from the building with the vector pPIC9 were detected and the intracellular production was carried from the pHIL-D2 vector. / O fungo termodimórfico Paracoccidioides brasiliensis é agente etiológico da paracoccidioidomicose, uma micose sistêmica humana, com alta prevalência na América Latina. P. brasiliensis está sujeito a estresse oxidativo (EO) causado pelas espécies reativas de oxigênio (EROs), produzidas pelas células de defesa do hospedeiro humano. O sistema de defesa do hospedeiro quando da invasão por patógenos gera EROs para combater este invasor. P. brasiliensis ao penetrar no hospedeiro humano é fagocitado pelos macrófagos, enfrentando um ambiente extremamente hostil devido ao oxido nítrico e peróxido de hidrogênio. A Trx1 é uma proteína redox, intracelular, que participa da manutenção da homeostase redox da célula, tanto em condições de EO quanto redutor. É ubiquitária e caracterizada pelo sítio ativo típico CXXC, responsável pela oxidação, redução, ou isomerização das pontes dissulfeto de proteínas. Em trabalho realizado anteriormente, foi isolado, caracterizado e clonado em vetor de expressão pGEX4T-3 o cDNA codificante para Trx1 de P. brasiliensis (número de acesso AY376435). A proteína recombinante (recPbTRX1) foi produzida e parcialmente purificada e as células leveduriformes de P. brasiliensis apresentaram expressão aumentada do gene codificante para Pbtrx1 em condições de EO. O presente trabalho teve como objetivo a expressão heteróloga de uma tiorredoxina do fungo P. brasiliensis em Pichia pastoris, visando sua obtenção em maior quantidade para sua a posterior caracterização bioquímica e aplicação em processos biotecnológicos. O cDNA do gene da tiorredoxina 1 (trx1) de P. brasiliensis foi obtido via PCR utilizando como molde o plasmídeo pGEX-Trx1 e clonado no vetor de expressão pHIL-D2 e pPIC9 (para expressão intracelular e extracelular). A inserção do gene de interesse na orientação correta foi verificada por seqüenciamento, apresentando homologia com a Trx1 de P. brasiliensis. Estes vetores foram utilizados para transformar a linhagem SMD1168 da levedura P. pastoris com genótipo his4-. A presença do cassete de expressão foi confirmada no genoma da levedura. Não foram detectados transformantes capazes de secretar a proteína a partir da construção com o vetor pPIC9 e a produção intracelular foi realizada a partir do vetor pHIL-D2.

Thesis (MSc)--Stellenbosch University, 2015. / ENGLISH ABSTRACT: This study describes: • The UPLC-MS/MS analyses and quantification of novel 5α-reduced steroids using response factors. • The kinetic characterisation of human steroid 5α-reductase type 1 (SRD5A1), expressed in HEK-293 cells, towards 11OHA4 and 11OHT and their keto derivatives by progress curve analysis. • The subcloning, transformation and functional expression of SRD5A1 in the yeast expression system, P. pastoris. • The conversion of 11OHA4 and 11OHT and their keto derivatives by SRD5A1 expressed in P. pastoris. • The endogenous enzymatic activity in P. pastoris towards the 5α-reduced metabolites in the 11OHA4- and alternate 5α-dione pathways. • The potential application of P. pastoris as a biocatalyst in the production of 5α- reduced C19 steroids. / AFRIKAANSE OPSOMMING: Hierdie ondersoek beskryf: • Die UPLC-MS/MS analise en kwantifisering van nuut-ondekte 5α-gereduseerde steroïede met behulp van responsfaktore. • Die kinetiese karakterisering van menslike steroïed 5α-reduktase tipe 1 (SRD5A1), uitgedruk in HEK-293 selle, vir 11OHA4 en 11OHT en hul ketoderivate deur middel van progressiekurwe-analise. • Die subklonering, transformasie en funksionele uitdrukking van SRD5A1 in die gis P. pastoris. • Die omsetting van 11OHA4 en 11OHT en hul ketoderivate deur SRD5A1 uitgedruk in P. pastoris. • Die omsetting van 5α-gereduseerde steroïede in die 11OHA4 en alternatiewe 5α-dioon paaie deur endogene ensieme in P. pastoris • ‘n Ondersoek na die toepassing van die gisuitdrukkingstelsel as ‘n moontlike OR potensiële biokatalis vir die produksie van 5α-gereduseerde C19 steroïede.

NK (natural killer) cells, with their ability to identify antigens and extraneous substances, available in the organism through various moleculary receptors, are an important component of the immune system. The NKR-P1A and NKR-P1B proteins belong to the lectin receptors of natural killer cells. Primary ligands of lectin receptors comprise terminal oligosaccharides of glycoproteins on the surface of target (e.g. tumor) cells. The interaction between carbohydrate structures on the surface of antigens and their binding partners on NK receptors is followed by triggering the effector function of NK cells against the targets. The NK cells and NK receptors findings and their interactions with ligands are greatly utilized in the treatment of cancer, viral and autoimmune diseases. Heterologous protein production in the eukaryotic organism brings a lot of advantages. Unlike the prokaryotic organism, the methylotrophic yeast Pichia pastoris has the capability of performing many posttranslational modifications resulting in production of biological active protein molecule. Usually, the P. pastoris expression system disposes of high level protein expression and is also generally regarded as being faster, easier, and less expensive to use than expression systems derived from other eukaryotes. In this thesis, I...