Submitted by Gabriela Lopes (gmachadolopesufpel@gmail.com) on 2017-07-05T15:51:59Z No. of bitstreams: 2 license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5) TESE silvana .pdf: 1176945 bytes, checksum: 524d27f394d80efa27a599fbe733e6f3 (MD5) / Approved for entry into archive by Aline Batista (alinehb.ufpel@gmail.com) on 2017-07-11T21:11:18Z (GMT) No. of bitstreams: 2 TESE silvana .pdf: 1176945 bytes, checksum: 524d27f394d80efa27a599fbe733e6f3 (MD5) license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5) / Made available in DSpace on 2017-07-11T21:11:18Z (GMT). No. of bitstreams: 2 TESE silvana .pdf: 1176945 bytes, checksum: 524d27f394d80efa27a599fbe733e6f3 (MD5) license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5) Previous issue date: 2017-01-30 / Conselho Nacional de Pesquisa e Desenvolvimento Científico e Tecnológico - CNPq / O tomateiro é cultivado em praticamente todas as regiões brasileiras. Dentre os diversos tipos de tomates existentes, o minitomate vem se destacando, devido às suas características produtivas, pois além de ser bastante atrativo e saboroso, possui alto valor agregado estimulando os produtores a investirem no cultivo dessa hortaliça. O cultivo de minitomate vem sendo realizado, principalmente, em ambiente protegido, como uma forma de minimizar as perdas em produção e qualidade de frutos, além de proporcionar a produção antecipada ou fora de safra e assim proporcionar maior retorno ao produtor do que o obtido com o cultivo convencional a céu aberto. Assim, os objetivos do trabalho foram: avaliar o efeito da variação da densidade de plantio e do raleio de inflorescências sobre a produção e partição de massa seca da planta e as características produtivas de minitomateiros dos tipos cereja e grape em duas épocas de cultivo, em sistema hidropônico; e estudar os componentes de rendimento, e as características físico-químicas relacionadas à qualidade organoléptica de duas cultivares de minitomates, observando a influência da adoção de uma alta densidade de plantio em dois ciclos de cultivo em sistema hidropônico. Para isso, dois experimentos foram realizados em condições de estufa plástica, no Campus da Universidade Federal de Pelotas, RS. A semeadura foi efetuada no dia 24 de novembro de 2012 para o ciclo de verão-outono (2012/2013), e para o cultivo de primavera-inverno (2013/2014) foi realizada em 26 de agosto de 2013. O ciclo da cultura foi de 183 dias no cultivo de verão-outono e 298 dias no cultivo de primavera-inverno, contados a partir do transplante. As plantas foram tutoradas por fita de ráfia presa na linha de arame disposta 3,0 m acima da linha de cultivo e sustentada pela estrutura da estufa. A condução foi com haste única, fazendo-se a desbrota das hastes laterais periodicamente. Objetivando-se prolongar o período de colheita, quando as plantas atingiram a altura do arame, a base dos caules foi sistematicamente desfolhada e rebaixada, seguindo a condução do tipo “carrossel holandês”. As plantas foram avaliadas em cinco densidades de plantio: 2,6; 2,9; 3,4; 3,9; e 4,7 plantas m-2 no experimento de verão-outono; para o experimento de primavera-inverno as densidades estudadas foram 2,9; 3,9; 4,7; 5,9 e 7,8 plantas m-2 . Após a emissão das inflorescências, foi feito o raleio das mesmas nas subparcelas determinadas, deixando-se 20 flores por racemo. O crescimento foi 7 quantificado por meio da determinação da biomassa aérea (massa fresca e seca) das plantas durante o ciclo produtivo e a acumulada ao final de cada experimento, sendo incluídos os frutos colhidos durante o processo produtivo, bem como as folhas provenientes de desfolhas antecipadas e as frações de desbrota. Para as avaliações das características físico-químicas, adicionalmente, aos experimentos foram escolhidas duas densidades de plantio: 3,4; e 4,7 plantas m-2 no experimento de verão-outono; e 2,9; e 7,8 plantas m-2 no experimento de primavera-inverno. Foram realizadas avaliações físico-químicas dos frutos, como o teor de sólidos solúveis (ºBrix), acidez titulável, relação ºBrix/acidez (‘ratio’), açúcares redutores, ácido ascórbico, pH, compostos fenólicos, luminosidade (l*), vermelho (+a*), amarelo (+b*), Hue, licopeno, β-caroteno, ácido clorogênico, e a atividade antioxidante. Em relação ao aumento da densidade de plantio observou-se que houve uma redução no crescimento de todos os órgãos, no tamanho de frutos e na produção de frutos por planta, sem afetar a proporção de massa seca alocada nos frutos. Porém, aumenta linearmente o número de frutos colhidos e a produtividade por unidade de área. Já, o raleio de flores não afeta o crescimento dos frutos e a partição de massa seca para estes órgãos em ambas as cultivares e ciclos. Porém, em ciclo longo, de primaverainverno, aumenta o tamanho e a produção dos frutos; e em ciclo curto, de verãooutono, não afeta as características produtivas de ambas as cultivares. Recomendase a adoção da densidade de plantio de 2,9 plantas m-2 para ambas as cultivares em ciclo mais curto, de verão-outono; e as densidades de 2,9 e de 3,9 plantas m-2 , respectivamente, para ‘Cereja Coco’ e ‘Grape Dolcetto’ em ciclo longo de primaverainverno. A prática do raleio, do ponto de vista fitotécnico, é recomendável para ambas as cultivares em ciclo de primavera-inverno. Em relação às características físicas e químicas relacionadas à qualidade organoléptica de frutos de minitomates com adoção de uma maior densidade de plantio, indicam que os componentes do rendimento são, de forma geral, semelhantes para os diferentes ciclos estudados e dependem, principalmente, do híbrido avaliado. O aumento da densidade de plantio reduz o tamanho dos frutos e aumenta o número e a produtividade de frutos por unidade de área em ambos os híbridos. O híbrido ‘Grape Dolcetto’ apresenta-se, com melhor qualidade, e é mais afetado pela adoção de uma maior densidade de plantio do que o híbrido ‘Cereja Coco’. O emprego de uma alta densidade de plantio não afeta as características de coloração dos frutos das duas cultivares. / The tomato is grown in almost all regions of Brazil. Among the different types of tomatoes, mini tomato has stood out due to their productive characteristics, as well as being very attractive and tasty, has high added value by encouraging producers to invest in the cultivation of this vegetable. The mini tomato cultivation is being carried out mainly in a protected environment, as a way to minimize losses in production and fruit quality, and provide the anticipated production or out of season and thus provide greater returns to producers than that obtained with conventional cultivation in the open. The objectives of the study were to evaluate the effect of variation of planting density and thinning of inflorescences on the production and dry matter partition of the plant and the production characteristics of mini tomato types cherry and grape in two growing seasons in hydroponic; and study the yield components, and the physical and chemical characteristics related to the organoleptic quality of two cultivars of mini tomato, noting the influence of adopting a high density planting in two crop cycles hydroponically. For this, two experiments were conducted in greenhouse conditions, on the campus of the Federal University of Pelotas, Brazil. Sowing was performed on November 24, 2012 to the summer-autumn cycle (2012/2013), and the spring-winter crop (2013/2014) was held on 26 August 2013. The crop cycle it was 183 days in the summer-autumn crop and 298 days in the spring-winter crop, counted from the transplant. The plants were stood by raffia tape, fixed in the line willing 3.0 m above the cultivation line and sustained by the greenhouse structure. Driving was single stem, becoming the thinning of the side rods periodically. Aiming to prolong the harvest period, when the plants reached the height of the wire, the base of the stems was systematically leafless and lowered, following the driving of the "Dutch Carousel". The plants were evaluated in five planting densities: 2.6; 2.9; 3.4; 3.9; and 4.7 m-2 plants in the summer-autumn experiment; for spring-winter experiment densities studied were 2.9; 3.9; 4.7; 5.9 and 7.8 plants m-2 . After the issuance of inflorescences was done thinning the same in certain subplots, leaving 20 flowers per raceme. Growth was quantified by 9 determining the biomass (fresh and dry weight) of the plants during the production cycle and accumulated at the end of each experiment, and included the fruits harvested during the production process as well as the leaves from early defoliation and the fractions of thinning. For evaluations of physical-chemical characteristics, in addition, the experiments were chosen two planting densities: 3.4; and 4.7 m-2 plants in the summer-autumn experiment; and 2.9; and 7.8 plants m-2 in spring-winter experiment. Physical and chemical evaluations of the fruits were carried out, such as soluble solids (° Brix), titratable acidity, ratio Brix / acidity (TA ratio), reducing sugars, ascorbic acid, pH, phenolics, lightness (L *), red (+ a *), yellow (+ b *), Hue, lycopene, β-carotene, chlorogenic acid, and antioxidant activity. Regarding the increase in planting density was observed that a reduction in growth of all organs in fruit size and fruit yield per plant, without affecting the dry mass proportion allocated in fruits. However, linearly increases the number of harvested fruit and the productivity per unit area. Already, the thinning of flowers does not affect the growth of fruit and dry matter partition for these organs in both cultivars and cycles. However, in long cycle, spring and winter, increases the size and production of fruits; and short cycle of summer-autumn, does not affect the traits of both cultivars. It is recommended the adoption of the 2.9 plants planting density m-2 for both varieties in shorter cycle of summer-autumn; and densities of 2.9 and 3.9 plants m-2 , respectively, to 'Cherry Coco "and" Grape Dolcetto' in long cycle of spring-winter. The practice of thinning the fitotécnico point of view, it is recommended for both cultivars in spring-winter cycle. In relation to physical and chemical characteristics related to the organoleptic quality of fruit mini tomato with the adoption of a higher plant density, indicate that yield components are, in general, similar to the different cycles studied and depend mainly on the rated hybrid . Increased planting density reduces fruit size and increase the number and fruit yield per unit area in both hybrids. The hybrid 'Grape Dolcetto' presents itself with better quality and is more affected by the adoption of a higher plant density than the hybrid 'Cherry Coco'. The use of a high planting density does not affect the fruits of staining characteristics of both cultivars.

Submitted by (lucia.rodrigues@ufrpe.br) on 2017-02-17T13:39:56Z No. of bitstreams: 1 Camila Cristina Lage de Andrade.pdf: 845467 bytes, checksum: ef8d7e269cd9b79e14fc8dbcd17e8edd (MD5) / Made available in DSpace on 2017-02-17T13:39:56Z (GMT). No. of bitstreams: 1 Camila Cristina Lage de Andrade.pdf: 845467 bytes, checksum: ef8d7e269cd9b79e14fc8dbcd17e8edd (MD5) Previous issue date: 2012-02-16 / Conselho Nacional de Pesquisa e Desenvolvimento Científico e Tecnológico - CNPq / The bacterial speck caused by Pseudomonas syringae pv. tomato (Pst) (Okabe) Young, Dye & Wilkie has economic relevance to the tomato for industry in Brazil. The use of products that potentiate and/or induce plant defenses is an alternative that meets the requirements of integrated disease management. This study aimed to evaluate the effect of silicon (Si) and chemical inducers in some components of tomato resistance to bacterial speck and activity of enzymes involved in plant defense. In the first study, tomato plants were grown in: soil without calcium silicate (control) (T1), soil without calcium silicate and plants sprayed with Supa Silica® (SS) (2 mL/L SS) (T2) and soil with calcium silicate (0.38 g) (T3), being inoculated by spraying with a suspension of the pathogen. Our research evaluated the incubation period (IP), number of lesions (NL) per plant, severity estimated by the software QUANT 1.0 (SEQ) and leaf concentration of Si, as well as the activity of enzymes peroxidases (POX), polyphenoloxidases (PPO) β-1,3-glucanases (GLU), phenylalanine ammonia lyases (PAL), lipoxygenases (LOX) and concentration of malondialdehyde (MDA). It was assessed the effect of SS in the Pst growth in vitro. There was no significant difference between treatments for the IP and the foliar concentration of Si. No significant differences were found for the NL per plant and SEQ between T3 and control. T2 significantly reduced NL in 46.8 and 45.1% and SEQ in 61.5 and 56.2% when compared with control and T3, respectively. There was negative linear response of SS doses on the Pst growth in vitro. The activity of POX, PPO and GLU was significantly higher in T2 and T3. The activity of FAL and LOX was significantly higher in T3. The MDA concentration was significantly higher in T2 compared to control, in non-inoculated plants and at 7 days after inoculation (d.a.i.), being significantly lower at 10 d.a.i. In the second study, three experiments were conducted to evaluate the effect of jasmonic acid (JA; 0.1 mM), ethephon (ET, 0.5 mM) and acibenzolar-S-methyl (Bion®, ASM; 300 mg/L) sprayed 48 h before inoculation with Pst, evaluating the IP and NL per plant, and the activity of enzymes POX, PPO, GLU and LOX. It was also assessed the effect of JA and ET in the growth of Pst in vitro. Only in experiment 3 incubation period increased significantly by one day in the plants sprayed with ASM compared with control. In all experiments, NL per plant was significantly reduced by JA, ET e ASM in relation to the control reaching values of 38.9, 45.3 and 68.1%, respectively, in experiment 2. The growth of Pst in vitro was not significantly influenced. In some evaluation times JA has significantly raised the activity of POX, PPO and GLU; ASM has elevated the activity of PPO, GLU and LOX, while ET only significantly raised the activity of GLU and LOX compared to the control. The results of these studies suggest that spraying tomato plants with SS and the inducers JA, ET and ASM affected some components of tomato resistance to bacterial speck, and activated the enzymes POX, PPO, GLU, PAL and LOX, involved in defense responses of tomato plants to Pst. / A pinta bacteriana causada por Pseudomonas syringae pv. tomato (Pst) (Okabe) Young, Dye & Wilkie tem importância econômica para a cultura do tomateiro industrial no Brasil. O uso de agentes potencializadores e/ou indutores das defesas das plantas é uma alternativa que atende aos requisitos do manejo integrado de doenças. Este estudo avaliou o efeito do silício (Si) e de indutores químicos em alguns componentes de resistência do tomateiro à pinta bacteriana e na atividade de enzimas envolvidas na defesa das plantas. No primeiro estudo plantas de tomateiro foram cultivadas em: solo sem silicato de cálcio (controle) (T1), solo sem silicato de cálcio e plantas pulverizadas com Supa Sílica® (SS) (2 mL/L de SS) (T2) e solo com silicato de cálcio (0,38 g) (T3), sendo inoculadas por pulverização com suspensão do patógeno. Foram avaliados o período de incubação (PI), número de lesões (NL) por planta, severidade estimada pelo software QUANT 1.0 (SEQ) e concentração foliar de Si, bem como a atividade das enzimas peroxidases (POX), polifenoloxidases (PFO), β-1,3-glucanases (GLU), fenilalanina amônia-liases (FAL), lipoxigenases (LOX) e concentração de aldeído malônico (MDA). Também foi avaliado o efeito do SS no crescimento de Pst in vitro. Não houve diferença significativa entre os tratamentos para o PI e para a concentração foliar de Si. Não houve diferença significativa para o NL por planta e a SEQ entre o tratamento T3 e o controle. O tratamento T2 reduziu significativamente o NL 46,8 e 45,1% e a SEQ 61,5 e 56,2%, em relação ao controle e ao tratamento T3, respectivamente. Houve resposta linear negativa das doses de SS no crescimento da Pst in vitro. A atividade das POX, PFO e GLU foi significativamente maior nos tratamentos T2 e T3. A atividade das FAL e das LOX foi significativamente maior no T3. A concentração de MDA foi significativamente maior no tratamento T2 em relação ao controle, nas plantas não inoculadas com Pst e aos 7 dias após inoculação (d.a.i.); sendo significativamente menor aos 10 d.a.i. No segundo estudo, três experimentos foram realizados para avaliar o efeito dos indutores ácido jasmônico (AJ; 0,1 mM), ethephon (ET; 0,5 mM) e acibenzolar-S-metil (Bion®, ASM; 300 mg/L) pulverizados 48 h antes da inoculação da Pst, avaliando-se o PI e o NL por planta, além da atividade das enzimas POX, PFO, GLU e LOX. Também foi avaliado o efeito do AJ e do ET no crescimento da Pst in vitro. Apenas no experimento 3 o PI aumentou significativamente em 1 dia nas plantas pulverizadas com ASM em relação ao controle. O NL por planta foi significativamente reduzido pelos tratamentos AJ, ET e ASM em relação ao controle para todos os experimentos, atingindo valores de 38,9, 45,3 e 68,1%, respectivamente, no experimento 2. O crescimento da Pst in vitro não foi influenciado significativamente pelo AJ ou ET. Em determinadas épocas de avaliação, o AJ elevou significativamente a atividade das POX, PFO e GLU; ASM elevou a atividade das PFO, GLU e LOX e o ET elevou a atividade das GLU e LOX em relação ao controle. Os resultados desses estudos evidenciam que a pulverização com SS e com indutores AJ, ET e ASM afetaram alguns dos componentes de resistência do tomateiro à pinta bacteriana, além de potencializar as enzimas POX, PFO, GLU, FAL e LOX, relacionadas com a defesa das plantas em resposta à Pst.

As propriedades físicas do solo são preponderantes para a qualidade e produtividade da cultura da batata. Assim, o objetivo do presente trabalho foi avaliar algumas propriedades físicas do solo e a produtividade e qualidade dos tubérculos de batata. O experimento foi instalado em áreas de produção de batata na Chapada Diamantina (BA), de abril a agosto de 2005. O solo foi preparado pelo sistema convencional e pelo sistema alternativo MAFES, ambos associados ou não com a aplicação de Microrganismos Eficazes (EM). Foram avaliadas: a densidade do solo, a estabilidade de agregados, a resistência do solo à penetração, a taxa de infiltração de água e a retenção de água no solo. Também foi avaliada a alteração dessas propriedades do solo em relação à área antes do preparo, que estava sob pastagem de Brachiaria brizantha. A massa de torrões e touceiras colhidas juntamente com os tubérculos, bem como os danos mecânicos verificados durante a colheita mecanizada e a porcentagem de tubérculos com danos causados por larva alfinete, sarna e podridões foram quantificados. A produtividade nos diferentes tratamentos foi avaliada dentro da classificação comercial. Em relação ao pasto, os preparos convencional e MAFES alteraram a maioria das propriedades físicas avaliadas. Na área preparada pelo sistema MAFES foi observado, em relação ao preparo convencional, menor resistência à penetração em profundidades de 20 a 45 cm e entre os camalhões. A taxa de infiltração de água foi semelhante entre as áreas preparadas pelos dois sistemas, porém no sistema convencional a infiltração é mais superficial ocorrendo de forma lateral ao longo do perfil. No sistema MAFES a infiltração ocorreu verticalmente no perfil do solo. Menor porcentagem de tubérculos com danos mecânicos foi obtida na área preparada pelo sistema MAFES, devido, principalmente, a menor massa de torrões e touceiras colhidas juntamente com os tubérculos nessa área. A aplicação de EM teve pouca influência nas propriedades físicas do solo, mas propiciou condições que favoreceram o ataque de larva alfinete e sarna aos tubérculos. Apesar da utilização de EM ter reduzido a produção de tubérculos na área preparada pelo sistema MAFES, a produtividade e qualidade dos tubérculos nessa área foi superior a da área preparada pelo sistema convencional. / The physical soil properties have a relevant role on the yield and quality of potato crop. Thus, the purpose of the present research was to evaluate the effects on some soil physical properties on productivity and quality of potato tubers. The trial was set up in a commercial potato production field located in the Chapada Diamantina, BA, from April to August, 2000. Two distinct soil preparation systems (conventional and MAFES system), either associated or not with application of EM, have been trialed. The following soil properties were evaluated: bulk density, aggregate stability, soil penetration resistance, soil water retention and water infiltration rate. In addition, were evaluated the changes of such soil properties in comparison with the area cultivated with the grass Brachiaria brizantha, prior soil preparation. Other evaluations were performed such as the clod mass and clump of roots harvested together with potato tubers, the level of damage to the tubers caused by mechanical harvesting, and the amount of tubers affected by potato tuber moth, rots, and common scab. The yields of the different treatments were evaluated and tubers graded according to commercial patterns. Compared to the grass, both conventional and MAFES soil preparation systems have changed the physical soil properties studied. MAFES system outperformed the conventional preparation giving lesser resistance to penetration at 20 to 45 cm deep and between hills. The water infiltration rate was similar for both soil preparation systems; however for the conventional system the infiltration pattern is superficial occurring laterally in the soil profile. Regarding MAFES systems, the infiltration occurred vertically. The area prepared MAFES system also gave a fewer percentage of tubers exhibiting mechanical damage, due to smaller clod mass and clump of roots harvested together with potato tubers. EM application did not benefit physical soil properties, however influenced a higher attack of potato tuber moth and common scab. Although the yield decrease in the area prepared with MAFES system when the EM was applied, in this area the productivity and tuber quality outperformed the conventional system.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

Made available in DSpace on 2015-04-22T22:17:32Z (GMT). No. of bitstreams: 1 Moacir Couto.pdf: 1480768 bytes, checksum: 4fb4ab95fcee8af72518a1e8af1c3f37 (MD5) Previous issue date: 2006-05-30 / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior / O cúbio (Solanum sessiliflorum Dunal) é um fruto com elevado potencial agroindustrial devido à sua alta produtividade anual e características nutricionais (alto teor em fibras dietéticas). Além disso, as fibras estão contidas nos alimentos vegetais e têm funções preventivas de doenças crônico-degenerativas, a exemplo do diabetes mellitus e (ou) das dislipidemias, o que as situa na categoria de alimentos funcionais ou nutracêuticos. Não obstante, se, por um lado, algum conhecimento acerca do ciclo de vida do cúbio já foi desvendado (sobretudo no estádio de fruto maduro), assim como de sua utilidade na produção de diversos gêneros alimentícios (bebidas, geléias), por outro lado, há precariedade nos conhecimentos científicos relativos tanto à sua maturação fisiológica pré- e pós-colheita, quanto ao seu potencial toxicológico (produção de glicoalcalóides). Deste modo, neste trabalho pretendeu-se, primeiramente, verificar outros estádios de maturação viáveis do cúbio e, com isso, aumentar o seu potencial de utilização alimentar, com base em parâmetros abióticos (temperatura), na aparência (coloração em especial) dos frutos, em índices físicos de maturação (peso do fruto, diâmetros), e na manutenção, ou não, de seu frescor, utilizando frutos verdes provenientes da área de plantio da Estação Experimental de Olericultura Tropical (EEOT) do Instituto Nacional de Pesquisas da Amazônia (INPA), em Manaus, AM, Brasil, com características geológicas de terra firme. Uma segunda etapa experimental foi constituída de análises físico-químicas: umidade, pH, acidez titulável, sólidos solúveis (ºBrix), relação Brix/acidez, carotenóides totais, açúcares redutores e não-redutores, lipídios, proteínas, cinza, fibras totais, sólidos insolúveis em álcool e pectina, com frutos oriundos de outra área de plantio situada no Ariaú, município de Iranduba, AM, Brasil, pertencente ao INPA e com características geológicas de várzea. Objetivou-se, então, verificar as mudanças dos índices físico-químicos de maturação de quatro estádios dos frutos colhidos (verde, de vez, maduro e muito maduro). Considerando que a textura dos frutos é grandemente influenciada pela atividade das enzimas pectinolíticas pectinesterases (EC 3.1.1.11) e poligalacturonases (EC 3.2.1.15), sobre os constituintes da parede celular substâncias pécticas, como a pectina sua análise constituiu uma parcela de grande interesse no presente trabalho. Enfim, uma análise qualitativa preliminar do teor de alcalóides totais nos diferentes estádios de maturação do cúbio serviu para melhor avaliar a relação risco/benefício de seu consumo diário. Os modelos de análise de regressão foram padronizados para 95% de confiança ou P (0,05). O formato predominante do cúbio foi cordiforme (1,2), mostrando-se um fruto resistente em atmosfera ambiente sem fatores estressantes no período pós-colheita, dado ter perdido o frescor só no sexto dia e mudado de cor a partir do sétimo dia. O estádio de fruto verde não se mostrou, todavia, adequado para a colheita, demonstrando ser o cúbio um fruto inteiramente dependente da planta para o seu perfeito amadurecimento em atmosfera ambiente. O fruto maduro mostrou-se crítico na manutenção da umidade, considerando que a partir desse estádio a perda de água tornou-se evidente (91,72% no fruto maduro para 91,42% no fruto muito maduro). Todos os índices físico-químicos de sabor mostraram tratar-se de um fruto ácido com baixo grau de doçura. Os carotenóides totais alcançaram um valor máximo de 0,217 mg% no estádio de fruto muito maduro. Os açúcares redutores alcançaram o maior nível (2,91 g por 100 g) no estádio de vez, justificando a classificação do cúbio dentre os frutos hipocalóricos (açúcares ≤ 5 g por 100 g). As outras macromoléculas com valor energético, como os lipídios e proteínas, elevaram-se do fruto verde ao muito maduro, sem, no entanto, atingirem um valor dietético significativo ≥ 1 g por 100 g. Os sólidos solúveis em álcool mostraram os níveis mais elevados nos estádios de fruto verde e de vez (4,0 g por 100 g), com um perfil paralelo àquele da pectina, cujo nível máximo situou-se no fruto verde de 2,54 g por 100 g, diminuindo até o muito maduro (1,57 g por 100 g), correlacionando-se fortemente com a atividade da pectinesterase (100%) e com aquela da poligalacturonase (100%). O pico de atividade da pectinesterase situou-se no estádio de fruto de vez, ao passo que o pico da poligalacturonase situou-se no estádio de fruto muito maduro, assemelhando-se esse perfil de atividade enzimática àquele de outras solanáceas muito consumidas, como o pimentão (Capsicum annum L.). As análises qualitativas dos alcalóides totais, com solução de MAYER, mostraram a resposta maior (+++/3) no fruto verde do que em outros estádios, confirmando o consenso da literatura especializada, segundo o qual a maior produção de alcalóides se encontra nas partes imaturas da planta. Com esse conjunto de informações correlatas pretendeu-se fornecer as bases bioquímicas que caracterizam a maturação do cúbio e, por conseguinte, a sua qualidade pós-colheita, com a finalidade de aprimorar o seu aproveitamento alimentar.

Submitted by Erika Demachki (erikademachki@gmail.com) on 2014-10-08T19:32:10Z No. of bitstreams: 2 Dissertação - Carlos de Melos e Silva Neto - 2013.pdf: 671422 bytes, checksum: 7774a52856834c1b8270fa6218029c99 (MD5) license_rdf: 23148 bytes, checksum: 9da0b6dfac957114c6a7714714b86306 (MD5) / Approved for entry into archive by Luciana Ferreira (lucgeral@gmail.com) on 2014-10-09T11:23:41Z (GMT) No. of bitstreams: 2 Dissertação - Carlos de Melos e Silva Neto - 2013.pdf: 671422 bytes, checksum: 7774a52856834c1b8270fa6218029c99 (MD5) license_rdf: 23148 bytes, checksum: 9da0b6dfac957114c6a7714714b86306 (MD5) / Made available in DSpace on 2014-10-09T11:23:41Z (GMT). No. of bitstreams: 2 Dissertação - Carlos de Melos e Silva Neto - 2013.pdf: 671422 bytes, checksum: 7774a52856834c1b8270fa6218029c99 (MD5) license_rdf: 23148 bytes, checksum: 9da0b6dfac957114c6a7714714b86306 (MD5) Previous issue date: 2013-09-16 / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - CAPES / Pollinators provide an essential service to the ecosystem and bring numerous benefits to society, through its role in the production of food in agriculture and the conservation of biological diversity. In tomato, anthers are poricidal, thus the release of pollen grains requires the presence of pollinators that vibrate these anthers. Thus, pollinators of tomatoes are actually bees that perform buzz pollination. Here, we observed aspects of floral biology, quantity and viability of pollen grains and ovules, and pollinators behavior and richness. To evaluate the effects of pollination in the amount of pollen on the stigmas, we selected 37 plants and bagged an inflorescence and let another available to pollinators. Each marked inflorescence had three stigmas removed the pollen grains on their surfaces were quantified. For comparison of fruit production, fruit development were followed in inflorescences bagged and not bagged for 40 days, and then the fruits were counted, weighed, measured, and had their seeds counted. The anthesis is at 6:30 am. The flower remains open until 6:00 pm, closing and reopening in the next day at the same time, lasting up to 73 hours. The greatest amount of pollen in the anther is in the early hours of the flower opening, with reduction and stabilization of the number of pollen grains around noon, coinciding with increased pollinator visitation. We found 25 species of bees in pollinating tomato crops. The abundance of bees coinciding with hours of availability and depletion of pollen suggests efficient removal of pollen from the anthers by the native bees The amount of pollen on the stigma of flowers available to pollinators was higher than on the stigma of bagged flowers. Fruit production was higher in open inflorescences than in bagged inflorescences. Native bees pollinate tomato flowers, increasing the pollen load on the stigma and fruit production. / Os polinizadores fornecem um serviço essencial ao ecossistema e trazem inúmeros benefícios à sociedade, através do seu papel na produção de alimento na agricultura e na conservação da diversidade biológica. No tomateiro, as anteras têm abertura poricida, assim, para liberação dos grãos de pólen é necessária a presença de polinizadores efetivos que realizam a vibração dessas anteras. Sendo assim, os polinizadores de fato dos tomateiros são abelhas que realizam polinização vibrátil. Na realização deste trabalho, foram observados aspectos da biologia floral como duração da flor, a quantidade e viabilidade de grãos de pólen e óvulos, além dos aspectos ecológicos dos polinizadores, como observação e coleta dos visitantes florais. Para avaliar os efeitos da polinização na quantidade de pólen do estigma, selecionamos 37 plantas, ensacamos uma inflorescência e deixamos outra disponível aos polinizadores. De cada inflorescência marcada, retiramos três estigmas e quantificamos os grãos de pólen em suas superfícies. Para a comparação da produção de frutos, acompanhamos o desenvolvimento dos frutos nas inflorescências ensacadas e não ensacadas durante 40 dias, e posteriormente os frutos foram contados, pesados, medidos e tiveram suas sementes contadas. A antese floral inicia às 6h30 da manhã. A flor permanece aberta até às 18h, fechando e no dia seguinte reabrindo no mesmo horário, durando até 73h. A maior oferta de pólen é nas primeiras horas da abertura da flor, com redução e estabilização do número de grãos de pólen por volta do meio dia, coincidindo com o aumento da visitação dos polinizadores. Foram encontradas 25 espécies de abelhas polinizadoras nos cultivos de tomateiro. A abundância das abelhas coincidindo com os horários de disponibilidade e esgotamento do pólen sugere eficiência na retirada dos grãos de pólen das anteras, muitos dos quais se aderem provavelmente ao estigma da própria flor, ocorrendo o posterior desenvolvimento dos frutos. A quantidade de grãos de pólen no estigma das flores disponíveis para os polinizadores foi maior do que no estigma das flores ensacadas. A produção de frutos foi maior em inflorescências não ensacadas que em inflorescências ensacadas. Os frutos não ensacados apresentaram mais sementes que os ensacados. As abelhas nativas polinizam as flores do tomateiro, aumentando a carga de pólen no estigma e a produção de frutos.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

The work in this thesis aimed to demonstrate the contribution of arbuscular mycorrhizal (AM) fungi to the yield and fruit quality of field-grown processing tomatoes, and the potential to increase the sustainability of tomato production through greater fertiliser use efficiency by inoculating tomato seedlings with beneficial AM fungi. Previously, the conclusion that tomato growth is unresponsive to AM colonisation, particularly in high-P soils, has often been based on only a part of the tomato life-cycle. However, there is increasing evidence that that positive AM yield responses can occur in soils with relatively high plant-available P, and that AM responsiveness of tomato during vegetative growth may be a poor predictor of reproductive growth. A preceding industry study found that AM colonisation of field-grown processing tomatoes was very low, mostly less than 5%. The reason for the low colonisation was unclear since previous studies have shown that tomato can become relatively highly colonised by AM fungi. It was not known if farm practices, such as soil cultivation and chemical sterilisation, which have been shown to decrease AM colonisation of tomato and other crops, could have contributed to the low colonisation. Furthermore, it was unclear what contribution AM fungi were making to the yield and fruit quality of tomato in commercial production, and what their potential contribution might be if greater AM colonisation could be achieved through inoculating seedlings. Yield and fruit quality are important to tomato growers as both are used to calculate payment when the fruits are sold. Large amounts of soluble fertilisers, particularly P, are applied during tomato production with the aim of increasing yield and quality. However, fertiliser use efficiency, particularly P, on tomato farms has been identified as being low, and needing to be improved in order to increase the economic and environmental sustainability of tomato farming. Increasing P, and also other nutrients, such as Zn and Ca, in tomatoes could also help to improve agricultural sustainability by alleviating human malnutrition in developing countries and, in the case of Ca, have the potential to reduce blossom end rot, which can severely reduce marketable yield. There is considerable potential for AM fungi to assist in the supply of these nutrients to field-grown tomatoes. AM fungi are widely accepted to increase plant uptake of P. This has mostly been demonstrated in low-P soils, as increases in plant-available P are generally known to be detrimental to AM colonisation and any subsequent growth effects. However, there is increasing evidence of the ability of AM fungi to increase P uptake and yield even in high P soils. There is also good evidence of increased Zn uptake by mycorrhizal supply to plants. Evidence for increased Ca uptake in mycorrhizal plants is in comparison limited and conflicting, but has been demonstrated in some cases. It is possible that AM fungi could allow applications of these nutrients, particularly P, to be reduced while maintaining or increasing fruit yield and quality. However, the ability of indigenous or inoculated AM fungi to do so in the relatively high-P farm soils used in this project was unknown. In order to address these uncertainties a series of pot studies and a field experiment were conducted using field soils from tomato farms and an adjacent nature reserve for comparison. Data on soil characteristics from five farms, collected during the previous industry study, was analysed in conjunction with data from another farm located nearby with contrasting soil properties. Two farm soils and an unfarmed comparison were selected on the basis of their having contrasting levels of P, Zn and Ca, and pH, with the constraint that they were located within 50 km of each other to minimise travel time in the study area. The two farmed soils had a relatively high concentration of plant-available P (103 and 58 mg/kg Colwell), while plant-available P in the unfarmed soil was probably marginal to that required for healthy tomato growth (27 mg/kg Colwell). Samples of the soils were taken soon after commencement of the work and used in pot studies. Firstly, a bioassay was conducted to establish the ability of tomato to become colonised in the three field soils. AM colonisation of tomato and medic, which is known to be highly susceptible to AM colonisation, was compared between three harvests over an approx. 16 week period. Vegetative growth was also measured. The total colonisation of tomato mostly did not differ from that of medic at each harvest in any soil. Furthermore, despite the large differences in plant-available P between the three soils, colonisation and vegetative growth of tomato did not differ between soils at any harvest. In a subsequent pot experiment, the effect of colonisation by AM fungi in the three field soils on the vegetative and reproductive growth, and nutrient status of tomato was determined using the tomato mutant rmc (reduced mycorrhizal colonisation) and its progenitor 76R. A number of non-destructive vegetative and reproductive growth measurements were repeatedly measured over an approx. 24 week period. Destructive measurements were carried out at two harvests, 39 and 164 days after planting. Tomato 76R was again well colonised in all soils. Tomato rmc remained uncolonised, and was therefore an effective non-mycorrhizal control. AM colonisation had little effect on plant growth or nutrient status in any soil at the first harvest, but significant growth and nutrient responses were recorded at the second harvest. In particular, AM colonisation markedly increased vegetative growth in the unfarmed soil. AM colonisation did not affect vegetative growth in either of the farmed soils. However, AM colonisation increased reproductive growth, particularly yield over time, in all soils. AM colonisation increased shoot P concentration and content, but effects on Zn were mixed and largely inconclusive. Shoot Ca concentration and content were mostly reduced by AM colonisation. Similar patterns were observed in fruit nutrient status. The potential of pre-inoculation with AM fungi to increase AM colonisation and/or AM growth and nutrient effects in the field was considered. A commercial AM fungal inoculum was initially proposed for use, but was found to be unreliable and laboratory cultures of Scutellospora calospora and Glomus mosseae were used instead. Tomato seedlings were inoculated by amending a commercial seed-raising medium with an equal mixture of S. calospora and G. mosseae inocula. Seeds of tomato rmc, 76R and the commercial processing tomato cultivar U941 were sown and raised according to the practices followed by a commercial seedling nursery. After 9 weeks a sub-sample of inoculated seedlings of 76R and U941 had become colonised by both AM fungi, although the total colonisation was relatively low (approx. 10%). There was no difference in the shoot or root dry weights between inoculated and non-inoculated seedlings. The remaining seedlings were then used in the field experiment. Seedlings were transplanted amongst a commercial processing tomato crop on two farms and grown to maturity. A substitute farm with soil of moderate P (66 mg/kg Colwell) was used as tomatoes were no longer being grown on the initial farm with moderate P. Two P treatments, ‘normal’ and ‘reduced’ P fertilisation, were imposed in order to investigate the effect of P fertilisation on colonisation by indigenous and inoculated AM fungi, and growth and nutrient status of tomato in the field. Non-destructive growth measurements and soil core samples to assess mycorrhizal colonisation were taken mid-season (approx. 10 weeks after transplanting). Destructive growth measurements and core samples to assess colonisation were taken at harvest (approx. 19 weeks after transplanting). Colonisation of rmc was insubstantial and it again served as an effective non-mycorrhizal control to 76R. Colonisation was insubstantial in all treatments on the farm where soil had moderate plant-available P. On the other farm, where soil had relatively high plant-available P, colonisation of all plants was low mid-season, but was mostly substantial (>20%) in 76R and U941 at harvest. Low colonisation on both farms was probably the result of farming practices, particularly soil cultivation. However, a combination of inoculation and reduced P fertilisation increased colonisation. Colonisation by indigenous AM fungi had no effect on the growth or nutrient status of field grown tomatoes. In contrast, pre-inoculation with AM fungi increased fruit yield by a mean of approx. 40% in 76R and U941. This was the result of an 18% increase in the fresh weight of individual fruits and, when inoculation was combined with reduced P fertilisation, a 21% increase in the number of fruits on each plant. The increase in the number of fruits on each plant was associated with an increase in the number of flowers at the most advanced growth stage. Inoculation also increased vegetative growth, and fruit P, Zn and Ca contents. A small (4%) decrease in fruit brix was more than offset by increased yield. This study has shown that while AM fungi indigenous to tomato farm soils have the ability to substantially colonise tomato, they appear to have little effect on tomato growth, yield or nutrition in the field. In contrast, inoculation of tomato seedlings with mutualistic AM fungi during nursery production can substantially increase the growth, yield and fruit nutrient contents of field-grown tomatoes under commercial conditions. This increase could also be enhanced by a reduction in P fertilisation. Increased yield and fruit nutrient contents, and decreased P fertilisation neatly address the aims of increased agricultural sustainability. Incorporating pre-inoculation of tomato into existing farming practices has a potential to increase the productivity and sustainability of processing tomato production worldwide. / http://proxy.library.adelaide.edu.au/login?url= http://library.adelaide.edu.au/cgi-bin/Pwebrecon.cgi?BBID=1292847 / Thesis (Ph.D.) -- University of Adelaide, School of Earth and Environmental Sciences, 2007

In tomato (Solanum lycopersicum), race-specific resistance against the fungal wilt pathogen Verticillium dahliae race 1 (Vd1) is established in the stem. However, the molecular factors and mechanisms leading to this resistance response are still unknown. In this study, Craigella resistant (CR) and susceptible (CS) tomato plants were successfully infected with Vd1 and this was verified by fungal quantification and symptom score assays. Previous microarray results showed interesting patterns of defence gene expression that correlated with biological phenomena. Plant defence genes code for proteins that are responsible for or associated with the plant resistance response. Through RT-PCR, this thesis set out to confirm these microarray observations and also to generate expression data for genes in which sensitivity was an issue in the microarray. The standard RT-PCR data confirmed a number of the microarray results, but some conflicts remained. From the defence genes investigated, there was agreement between the microarray data and the RT-PCR data for pre-mRNA processing factor 8, class IV chitinase, cyclin-dependent kinase inhibitor and IMP dehydrogenase/GMP reductase. Partial agreement was observed for genes coding for ethylene response factor 2, phenylalanine ammonia lyase and P6 protein. However, there was total disagreement for 14-3-3, beta-glucanase, P1a, RNA-binding protein, calcium-binding protein and S-Adenosyl-L-methionine: hydroxide adenosyltransferase. Real-time RT-PCR was attempted to clarify the remaining issues but further discrepancies arose, particularly in the Ve resistance genes. To resolve these discrepancies, two approaches were designed: (1) one based on the use of a universal internal control and (2) another based on restriction enzyme digestion. In general, the results were more consistent with standard RT-PCR. Overall, this study showed that standardization of a system involving vascular pathogens, leading to reproducible analysis, was possible but only with proper controls and additional validation. Standard RT-PCR appeared to offer a more accurate picture of the expression of defence genes in the tomato-Verticillium pathosystem. The defence gene expression results confirmed in this study remain as potential insights into the molecular mechanisms for Verticillium resistance in tomato plants.

Les nématodes à kystes sont l'un des bioagresseurs causant le plus de dégâts sur les cultures de pommes de terre. La résistance trouvée chez l'accession spl88S.329.18, issue de l'espèce Solanum sparsipilum est caractérisée par un déterminisme oligogénique avec un QTL à localisé sur le chromosome V (GpaVspl) et un QTL mineur localisé sur le chromosome XI(GpaXIspl). Pour obtenir une résistance de haut niveau, l'effet du QTL GpaVspl, doit êtrecomplémenté par celui du QTL à effet faible GpaXIspl. Par génomique comparative, le locusGpaV a été localisé dans un intervalle compris entre 16 et 60 kb sur les génomes de la tomateet des espèces apparentées à la pomme de terre, Solanum demissum et Solanum phureja. Deuxgènes ont été annotés dans cet intervalle sur les génomes de la tomate et de S. demissum : lepremier appartient à la famille des TIR-NBS-LRR (TNL), famille de gènes de résistanceclassiques, et le second appartient à la famille des " mitochondrial, transcription terminationfactor " (mTERF), dont l'implication dans des mécanismes de résistance n'a jamais étédémontrée.Les objectifs de ma thèse étaient d'identifier le(s) gène(s) responsable(s) de la résistance àG. pallida, conférée par le locus GpaVspl, et d'étudier sa régulation. Suite à la publication de laséquence du génome de S. phureja, en 2011, nous avons mis en évidence que le locus GpaVétait dupliqué chez S. phureja et que cette duplication était également présente chezS. sparsipilum. Les quatre gènes annotés au locus GpaVspl ont été nommésSpl_mTERF18430, Spl_TNL18429, Spl_mTERF18453 et Spl_TNL18428.L'effet des deux gènes Spl_mTERF18430 et Spl_TNL18428 sur la résistance à G. pallida aété analysé via des expériences de transformation génétique suivies par des tests de résistancesur les plantes transformées. Un effet partiel du gène Spl_TNL18428 sur la résistance àG. pallida a été mis en évidence par complémentation de plantes sensibles. Aucun effetsignificatif n'a été détecté pour le gène Spl_mTERF18430. Des expériences d'extinctiongénique suggèrent que le deuxième gène TIR-NBS-LRR, Spl_TNL18429, qui est égalementexprimé dans les racines et qui présente un fort pourcentage d'identité de séquence avec legène Spl_TNL18428, pourrait également être impliqué dans la résistance à G. pallida.L'expression du gène rapporteur GFP, placé sous le contrôle du promoteur du gèneSpl_TNL18428, est fortement induite dans les cellules situées autour du syncytium. Cecirenforce l'hypothèse d'une implication du gène Spl_TNL18428 dans la résistance à G. pallida,car la localisation de l'expression de la GFP est similaire à celle de la nécrose, qui estcaractéristique de la réaction développée par les plantes résistantes autour du syncytium induitpar les nématodes.En tenant compte des données bibliographiques récentes, montrant que plusieurs gènes NBSLRRpeuvent être indispensables à l'expression d'une résistance, nos résultats suggèrent queles deux gènes Spl_TNL18428 et Spl_TNL18429 sont nécessaires à l'expression de larésistance à G. pallida