• Refine Query
  • Source
  • Publication year
  • to
  • Language
  • 361
  • 131
  • 37
  • 35
  • 16
  • 5
  • 4
  • 3
  • 2
  • 2
  • 1
  • 1
  • 1
  • Tagged with
  • 637
  • 219
  • 177
  • 111
  • 100
  • 82
  • 75
  • 70
  • 70
  • 68
  • 61
  • 44
  • 39
  • 38
  • 38
  • About
  • The Global ETD Search service is a free service for researchers to find electronic theses and dissertations. This service is provided by the Networked Digital Library of Theses and Dissertations.
    Our metadata is collected from universities around the world. If you manage a university/consortium/country archive and want to be added, details can be found on the NDLTD website.
561

Caracterização agronômica e molecular de linhagens de tomateiro resistentes a tospovírus / Agronomic and molecular characterization of advanced breeding tomato lines resistant to tospovirus

Longatti, Bruna Fernanda 23 January 2017 (has links)
A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.
562

The role of arbuscular mycorrhizal fungi in sustainable tomato production.

Martin, Ashley William January 2007 (has links)
The work in this thesis aimed to demonstrate the contribution of arbuscular mycorrhizal (AM) fungi to the yield and fruit quality of field-grown processing tomatoes, and the potential to increase the sustainability of tomato production through greater fertiliser use efficiency by inoculating tomato seedlings with beneficial AM fungi. Previously, the conclusion that tomato growth is unresponsive to AM colonisation, particularly in high-P soils, has often been based on only a part of the tomato life-cycle. However, there is increasing evidence that that positive AM yield responses can occur in soils with relatively high plant-available P, and that AM responsiveness of tomato during vegetative growth may be a poor predictor of reproductive growth. A preceding industry study found that AM colonisation of field-grown processing tomatoes was very low, mostly less than 5%. The reason for the low colonisation was unclear since previous studies have shown that tomato can become relatively highly colonised by AM fungi. It was not known if farm practices, such as soil cultivation and chemical sterilisation, which have been shown to decrease AM colonisation of tomato and other crops, could have contributed to the low colonisation. Furthermore, it was unclear what contribution AM fungi were making to the yield and fruit quality of tomato in commercial production, and what their potential contribution might be if greater AM colonisation could be achieved through inoculating seedlings. Yield and fruit quality are important to tomato growers as both are used to calculate payment when the fruits are sold. Large amounts of soluble fertilisers, particularly P, are applied during tomato production with the aim of increasing yield and quality. However, fertiliser use efficiency, particularly P, on tomato farms has been identified as being low, and needing to be improved in order to increase the economic and environmental sustainability of tomato farming. Increasing P, and also other nutrients, such as Zn and Ca, in tomatoes could also help to improve agricultural sustainability by alleviating human malnutrition in developing countries and, in the case of Ca, have the potential to reduce blossom end rot, which can severely reduce marketable yield. There is considerable potential for AM fungi to assist in the supply of these nutrients to field-grown tomatoes. AM fungi are widely accepted to increase plant uptake of P. This has mostly been demonstrated in low-P soils, as increases in plant-available P are generally known to be detrimental to AM colonisation and any subsequent growth effects. However, there is increasing evidence of the ability of AM fungi to increase P uptake and yield even in high P soils. There is also good evidence of increased Zn uptake by mycorrhizal supply to plants. Evidence for increased Ca uptake in mycorrhizal plants is in comparison limited and conflicting, but has been demonstrated in some cases. It is possible that AM fungi could allow applications of these nutrients, particularly P, to be reduced while maintaining or increasing fruit yield and quality. However, the ability of indigenous or inoculated AM fungi to do so in the relatively high-P farm soils used in this project was unknown. In order to address these uncertainties a series of pot studies and a field experiment were conducted using field soils from tomato farms and an adjacent nature reserve for comparison. Data on soil characteristics from five farms, collected during the previous industry study, was analysed in conjunction with data from another farm located nearby with contrasting soil properties. Two farm soils and an unfarmed comparison were selected on the basis of their having contrasting levels of P, Zn and Ca, and pH, with the constraint that they were located within 50 km of each other to minimise travel time in the study area. The two farmed soils had a relatively high concentration of plant-available P (103 and 58 mg/kg Colwell), while plant-available P in the unfarmed soil was probably marginal to that required for healthy tomato growth (27 mg/kg Colwell). Samples of the soils were taken soon after commencement of the work and used in pot studies. Firstly, a bioassay was conducted to establish the ability of tomato to become colonised in the three field soils. AM colonisation of tomato and medic, which is known to be highly susceptible to AM colonisation, was compared between three harvests over an approx. 16 week period. Vegetative growth was also measured. The total colonisation of tomato mostly did not differ from that of medic at each harvest in any soil. Furthermore, despite the large differences in plant-available P between the three soils, colonisation and vegetative growth of tomato did not differ between soils at any harvest. In a subsequent pot experiment, the effect of colonisation by AM fungi in the three field soils on the vegetative and reproductive growth, and nutrient status of tomato was determined using the tomato mutant rmc (reduced mycorrhizal colonisation) and its progenitor 76R. A number of non-destructive vegetative and reproductive growth measurements were repeatedly measured over an approx. 24 week period. Destructive measurements were carried out at two harvests, 39 and 164 days after planting. Tomato 76R was again well colonised in all soils. Tomato rmc remained uncolonised, and was therefore an effective non-mycorrhizal control. AM colonisation had little effect on plant growth or nutrient status in any soil at the first harvest, but significant growth and nutrient responses were recorded at the second harvest. In particular, AM colonisation markedly increased vegetative growth in the unfarmed soil. AM colonisation did not affect vegetative growth in either of the farmed soils. However, AM colonisation increased reproductive growth, particularly yield over time, in all soils. AM colonisation increased shoot P concentration and content, but effects on Zn were mixed and largely inconclusive. Shoot Ca concentration and content were mostly reduced by AM colonisation. Similar patterns were observed in fruit nutrient status. The potential of pre-inoculation with AM fungi to increase AM colonisation and/or AM growth and nutrient effects in the field was considered. A commercial AM fungal inoculum was initially proposed for use, but was found to be unreliable and laboratory cultures of Scutellospora calospora and Glomus mosseae were used instead. Tomato seedlings were inoculated by amending a commercial seed-raising medium with an equal mixture of S. calospora and G. mosseae inocula. Seeds of tomato rmc, 76R and the commercial processing tomato cultivar U941 were sown and raised according to the practices followed by a commercial seedling nursery. After 9 weeks a sub-sample of inoculated seedlings of 76R and U941 had become colonised by both AM fungi, although the total colonisation was relatively low (approx. 10%). There was no difference in the shoot or root dry weights between inoculated and non-inoculated seedlings. The remaining seedlings were then used in the field experiment. Seedlings were transplanted amongst a commercial processing tomato crop on two farms and grown to maturity. A substitute farm with soil of moderate P (66 mg/kg Colwell) was used as tomatoes were no longer being grown on the initial farm with moderate P. Two P treatments, ‘normal’ and ‘reduced’ P fertilisation, were imposed in order to investigate the effect of P fertilisation on colonisation by indigenous and inoculated AM fungi, and growth and nutrient status of tomato in the field. Non-destructive growth measurements and soil core samples to assess mycorrhizal colonisation were taken mid-season (approx. 10 weeks after transplanting). Destructive growth measurements and core samples to assess colonisation were taken at harvest (approx. 19 weeks after transplanting). Colonisation of rmc was insubstantial and it again served as an effective non-mycorrhizal control to 76R. Colonisation was insubstantial in all treatments on the farm where soil had moderate plant-available P. On the other farm, where soil had relatively high plant-available P, colonisation of all plants was low mid-season, but was mostly substantial (>20%) in 76R and U941 at harvest. Low colonisation on both farms was probably the result of farming practices, particularly soil cultivation. However, a combination of inoculation and reduced P fertilisation increased colonisation. Colonisation by indigenous AM fungi had no effect on the growth or nutrient status of field grown tomatoes. In contrast, pre-inoculation with AM fungi increased fruit yield by a mean of approx. 40% in 76R and U941. This was the result of an 18% increase in the fresh weight of individual fruits and, when inoculation was combined with reduced P fertilisation, a 21% increase in the number of fruits on each plant. The increase in the number of fruits on each plant was associated with an increase in the number of flowers at the most advanced growth stage. Inoculation also increased vegetative growth, and fruit P, Zn and Ca contents. A small (4%) decrease in fruit brix was more than offset by increased yield. This study has shown that while AM fungi indigenous to tomato farm soils have the ability to substantially colonise tomato, they appear to have little effect on tomato growth, yield or nutrition in the field. In contrast, inoculation of tomato seedlings with mutualistic AM fungi during nursery production can substantially increase the growth, yield and fruit nutrient contents of field-grown tomatoes under commercial conditions. This increase could also be enhanced by a reduction in P fertilisation. Increased yield and fruit nutrient contents, and decreased P fertilisation neatly address the aims of increased agricultural sustainability. Incorporating pre-inoculation of tomato into existing farming practices has a potential to increase the productivity and sustainability of processing tomato production worldwide. / http://proxy.library.adelaide.edu.au/login?url= http://library.adelaide.edu.au/cgi-bin/Pwebrecon.cgi?BBID=1292847 / Thesis (Ph.D.) -- University of Adelaide, School of Earth and Environmental Sciences, 2007
563

DEFENCE GENE EXPRESSION IN THE TOMATO-VERTICILLIUM PATHOSYSTEM

Castroverde, Christian Danve 22 April 2010 (has links)
In tomato (Solanum lycopersicum), race-specific resistance against the fungal wilt pathogen Verticillium dahliae race 1 (Vd1) is established in the stem. However, the molecular factors and mechanisms leading to this resistance response are still unknown. In this study, Craigella resistant (CR) and susceptible (CS) tomato plants were successfully infected with Vd1 and this was verified by fungal quantification and symptom score assays. Previous microarray results showed interesting patterns of defence gene expression that correlated with biological phenomena. Plant defence genes code for proteins that are responsible for or associated with the plant resistance response. Through RT-PCR, this thesis set out to confirm these microarray observations and also to generate expression data for genes in which sensitivity was an issue in the microarray. The standard RT-PCR data confirmed a number of the microarray results, but some conflicts remained. From the defence genes investigated, there was agreement between the microarray data and the RT-PCR data for pre-mRNA processing factor 8, class IV chitinase, cyclin-dependent kinase inhibitor and IMP dehydrogenase/GMP reductase. Partial agreement was observed for genes coding for ethylene response factor 2, phenylalanine ammonia lyase and P6 protein. However, there was total disagreement for 14-3-3, beta-glucanase, P1a, RNA-binding protein, calcium-binding protein and S-Adenosyl-L-methionine: hydroxide adenosyltransferase. Real-time RT-PCR was attempted to clarify the remaining issues but further discrepancies arose, particularly in the Ve resistance genes. To resolve these discrepancies, two approaches were designed: (1) one based on the use of a universal internal control and (2) another based on restriction enzyme digestion. In general, the results were more consistent with standard RT-PCR. Overall, this study showed that standardization of a system involving vascular pathogens, leading to reproducible analysis, was possible but only with proper controls and additional validation. Standard RT-PCR appeared to offer a more accurate picture of the expression of defence genes in the tomato-Verticillium pathosystem. The defence gene expression results confirmed in this study remain as potential insights into the molecular mechanisms for Verticillium resistance in tomato plants.
564

Analyse fonctionnelle et étude de la régulation de gènes candidats sous-jacents au QTL GpaVspl impliqué dans la résistance au nématode à kyste Globodera pallida chez la pomme de terre

Castro Quezada, Patricio Salvador 31 May 2013 (has links) (PDF)
Les nématodes à kystes sont l'un des bioagresseurs causant le plus de dégâts sur les cultures de pommes de terre. La résistance trouvée chez l'accession spl88S.329.18, issue de l'espèce Solanum sparsipilum est caractérisée par un déterminisme oligogénique avec un QTL à localisé sur le chromosome V (GpaVspl) et un QTL mineur localisé sur le chromosome XI(GpaXIspl). Pour obtenir une résistance de haut niveau, l'effet du QTL GpaVspl, doit êtrecomplémenté par celui du QTL à effet faible GpaXIspl. Par génomique comparative, le locusGpaV a été localisé dans un intervalle compris entre 16 et 60 kb sur les génomes de la tomateet des espèces apparentées à la pomme de terre, Solanum demissum et Solanum phureja. Deuxgènes ont été annotés dans cet intervalle sur les génomes de la tomate et de S. demissum : lepremier appartient à la famille des TIR-NBS-LRR (TNL), famille de gènes de résistanceclassiques, et le second appartient à la famille des " mitochondrial, transcription terminationfactor " (mTERF), dont l'implication dans des mécanismes de résistance n'a jamais étédémontrée.Les objectifs de ma thèse étaient d'identifier le(s) gène(s) responsable(s) de la résistance àG. pallida, conférée par le locus GpaVspl, et d'étudier sa régulation. Suite à la publication de laséquence du génome de S. phureja, en 2011, nous avons mis en évidence que le locus GpaVétait dupliqué chez S. phureja et que cette duplication était également présente chezS. sparsipilum. Les quatre gènes annotés au locus GpaVspl ont été nommésSpl_mTERF18430, Spl_TNL18429, Spl_mTERF18453 et Spl_TNL18428.L'effet des deux gènes Spl_mTERF18430 et Spl_TNL18428 sur la résistance à G. pallida aété analysé via des expériences de transformation génétique suivies par des tests de résistancesur les plantes transformées. Un effet partiel du gène Spl_TNL18428 sur la résistance àG. pallida a été mis en évidence par complémentation de plantes sensibles. Aucun effetsignificatif n'a été détecté pour le gène Spl_mTERF18430. Des expériences d'extinctiongénique suggèrent que le deuxième gène TIR-NBS-LRR, Spl_TNL18429, qui est égalementexprimé dans les racines et qui présente un fort pourcentage d'identité de séquence avec legène Spl_TNL18428, pourrait également être impliqué dans la résistance à G. pallida.L'expression du gène rapporteur GFP, placé sous le contrôle du promoteur du gèneSpl_TNL18428, est fortement induite dans les cellules situées autour du syncytium. Cecirenforce l'hypothèse d'une implication du gène Spl_TNL18428 dans la résistance à G. pallida,car la localisation de l'expression de la GFP est similaire à celle de la nécrose, qui estcaractéristique de la réaction développée par les plantes résistantes autour du syncytium induitpar les nématodes.En tenant compte des données bibliographiques récentes, montrant que plusieurs gènes NBSLRRpeuvent être indispensables à l'expression d'une résistance, nos résultats suggèrent queles deux gènes Spl_TNL18428 et Spl_TNL18429 sont nécessaires à l'expression de larésistance à G. pallida
565

Irrigação subsuperficial deficitária no cultivo de tomateiro em casa de vegetação

Mendonça, Thaís Grandizoli 17 April 2017 (has links)
Submitted by Ronildo Prado (ronisp@ufscar.br) on 2017-08-16T20:20:29Z No. of bitstreams: 1 DissTGM.pdf: 2889804 bytes, checksum: c55eea68163f4e92468140f7d3ced089 (MD5) / Approved for entry into archive by Ronildo Prado (ronisp@ufscar.br) on 2017-08-16T20:20:36Z (GMT) No. of bitstreams: 1 DissTGM.pdf: 2889804 bytes, checksum: c55eea68163f4e92468140f7d3ced089 (MD5) / Approved for entry into archive by Ronildo Prado (ronisp@ufscar.br) on 2017-08-16T20:20:43Z (GMT) No. of bitstreams: 1 DissTGM.pdf: 2889804 bytes, checksum: c55eea68163f4e92468140f7d3ced089 (MD5) / Made available in DSpace on 2017-08-16T20:20:49Z (GMT). No. of bitstreams: 1 DissTGM.pdf: 2889804 bytes, checksum: c55eea68163f4e92468140f7d3ced089 (MD5) Previous issue date: 2017-04-17 / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) / The tomato is a demanding crop in regards to water and is among the most consumed vegetables in Brazil. The search for alternatives to improve tomato productivity, as well as reduce the water use in the crop cycle, is essential for agricultural production and environment. The objectives of this work were to evaluate the contribution of subsurface drip irrigation to yield and fruit quality of Grape tomatoes and to estimate the water use efficiency (EUA). The experiment was carried out in the CCA / UFSCar and consisted of three treatments with four randomized blocks. Irrigation management considered the storage soil water capacity (CAD), the soil moisture being high according to the water content reference of the treatment, 0.33 (T1), 0.29 (T2) and 0.25 m3 m-3 (T3), corresponding to 100 % replacement of CAD, and deficit irrigations of 75 and 50 % of CAD, respectively. Water content was monitored by TDR probes and the roots depth obtained through a root images scanner. The Grape tomatoes were transplanted under drip lines installed at 0.20 m depth. Quantitative and qualitative characteristics of the fruits were evaluated in relation to the proposed treatments, being: fruits number per plant, average fruit mass and productivity, quantitative characteristics and; Diameter, length, soluble solids, fruit pH and dry mass of leaves and stem, qualitative characteristics. The total water applied was 1297 mm in T1, 471 mm in T2 (36 % of water applied in T1) and 234 mm in T3 (18 % of T1). Among the characteristics evaluated, the T2 did not differ from the T1 treatment, except in the diameter and pH. The T3 treatment was equal to T1 only in the fruits number per plant. The average fruit mass was different among all treatments and there was no difference between soluble solids values. The T3 treatment obtained higher EUA, followed by T2 and T1, but did not have higher productivity nor better results in other evaluated attributes. Deficit subsurface irrigation of 75 % of CAD did not interfere in Grape tomato productivity and fruit quality, being the most recommended because of qualitative and quantitative attributes similar to full irrigation and to increase the EUA. It is concluded that deficit subsurface irrigation had productivity and fruit quality of Grape tomatoes like full irrigation when used 75 % of CAD, increased the water use efficiency and contributed with water use reduction in crop cycle. / O tomateiro é uma cultura exigente em água e está entre as hortaliças mais consumidas no Brasil. A busca por alternativas que melhorem sua produtividade, bem como reduzam o uso da água no ciclo da cultura, é essencial para a produção agrícola e para o meio ambiente. Este trabalho teve o objetivo avaliar a contribuição da irrigação subsuperficial deficitária na produtividade e qualidade dos frutos de tomateiros Grape e estimar a eficiência no uso da água (EUA). O experimento foi realizado no CCA/UFSCar e consistiu de três tratamentos com doze parcelas em blocos casualizados. O manejo da irrigação levou em consideração a capacidade de água disponível no solo (CAD), sendo a umidade do solo elevada de acordo com a umidade de referência do tratamento, 0,33 (T1), 0,29 (T2) e 0,25 m3 m-3 (T3), correspondendo à reposição de 100 % da CAD, e irrigações deficitárias de 75 e 50 % da CAD, respectivamente. A umidade do solo foi monitorada por sondas TDR e o crescimento das raízes por imagens obtidas através de scanner de raízes. As mudas de tomateiro Grape foram transplantadas sob linhas de gotejamento instaladas a 0,20 m de profundidade. Foram avaliados atributos quantitativos e qualitativos dos frutos em relação aos tratamentos propostos, sendo eles: número de frutos por planta, massa média dos frutos e produtividade como atributos quantitativos; diâmetro, comprimento, sólidos solúveis, pH dos frutos e massa seca das folhas e caule como atributos qualitativos. A lâmina total de água aplicada foi 1297 mm em T1, 471 mm em T2 (36 % da lâmina aplicada em T1) e 234 mm em T3 (18 % de T1). Entre os atributos avaliados, o diâmetro e pH dos frutos do tratamento T2 diferiram do T1. Já o tratamento T3 foi igual ao T1 apenas no número de frutos por planta. A massa média dos frutos foi diferente entre todos os tratamentos e não houve diferença no valor de sólidos solúveis. O tratamento T3 obteve maior EUA, seguido por T2 e T1, porém não teve maior produtividade e nem melhores resultados em outros atributos avaliados. A irrigação subsuperficial deficitária de 75 % da CAD não interferiu na produtividade do tomateiro Grape e na qualidade dos frutos, sendo a mais recomendada por apresentar atributos qualitativos e quantitativos similares à irrigação plena e aumentar a EUA. Conclui-se com este trabalho que irrigação subsuperficial deficitária teve produtividade e qualidade de frutos de tomateiro Grape semelhante à irrigação plena quando utilizado 75 % da CAD, aumentou a eficiência no uso da água e contribuiu com a redução no uso da água no ciclo da cultura.
566

Temperatura, embalagem e radiação gama na conservação pós-colheita de maná cubiu /

Fujita, Erika, January 2011 (has links)
Orientador: Rogério Lopes Vieites / Banca: João Carlos Cury Saad / Banca: Regina Marta Evangelista / Banca: Ben-Hur Mattiuz / Banca: André José de Campos / Resumo: O presente trabalho teve o objetivo de avaliar os efeitos de temperaturas, embalagem (com ou sem filme de PVC) e de doses de radiação gama na qualidade e conservação do fruto de Maná cubiu (Solanum sessiflorum Dunal) verificando suas características físico-químicas e enzimáticas. Os frutos foram colhidos no município de Iguape-SP e levados para o Laboratório de Frutas e Hortaliças do Departamento de Gestão e Tecnologia Agroindustrial da Universidade Estadual Paulista "Julio de Mesquita Filho", Campus de Botucatu - SP, onde foi instalado o experimento e realizado as análises. O trabalho foi dividido em 2 experimentos: Experimento 1: diferentes temperaturas de armazenamento (ambiente 24 ± 3°C, 6°C, 8°C e 10°C) e embalados em bandejas de polietileno expandido depois cobertos ou não por filme esticável de PVC. A melhor temperatura e embalagem foram utilizadas no Experimento 2: 5 doses diferentes de irradiação (0,0, 0.2 kGy, 0.4 kGy, 0.6 kGy e 0.8 kGy). Nos dois experimentos os frutos foram avaliados quanto: perda de massa fresca, respiração, firmeza, sólidos solúveis, acidez titulável, índice de maturação "Ratio", pH, teor de açúcar redutor e atividade enzimática da pecinametilesterase, poligalacturonase, polifenoloxidase e peroxidase. O delineamento experimental foi inteiramente casualizado em esquema fatorial. No Experimento 1, utilizou-se 4 x 2 x 6 (temperaturas x embalagem x dias de armazenamento) e no Experimento 2, 5 x 6 (doses de irradiação x dias de armazenamento). As médias dos tratamentos e as interações, comparadas utilizando-se Teste de Tukey a 5% de probabilidade. Os frutos a 10°C e cobertos por filme PVC esticável foram o que ofereceram... (Resumo completo, clicar acesso eletrônico abaixo) / Abstract: This study aims to evaluate the effects of temperature, packaging (with or without PVC film) and gamma radiation on fruit quality and conservation of Maná-Cubíu (Solanum sessiflorum Dunal). The fruit were harvested in Iguape-SP and taken to the Fruit and Vegetable Laboratory, Department of Agribusiness Management and Technology, State University Paulista "Julio de Mesquita Filho", Campus the Botucatu - SP, where an experiment was conducted and analysis. The work was divided into two experiments: Experiment 1: different storage temperatures (environment, 24 ± 3°C, 6°C, 8°C e 10°C) and packaged in trays of polyethylene foam then covered or not by the stretchable film PVC. The best temperature and packaging were used in Experiment 2: 5 different doses of irradiation (0,0, 0,2 kGy, 0,4 kGy, 0,6 kGy and 0,8 kGy). In both experiments, fruits were evaluated: weight loss, respiration, firmness, soluble solids, acidity, maturation index, "Ratio", pH, reducing sugar and enzyme activity pecinametilesterase, polygalacturonase, peroxidase and polyphenoloxidase.. The experimental design was completely randomized factorial. In Experiment 1, we used 4 x 2 x 6 (temperatures x packaging x days of storage) and in Experiment 2, 5 x 6 (irradiation doses x days of storage). The treatment means and interactions were compared using Tukey test at 5% probability. The fruits at 10 ° C and covered with stretchable PVC film were what gave the best results with the smallest weight loss for the mana cubiu and 0,6 kGy the radiation doses applied to the fruit that have the best results while maintaining the postharvest quality... (Complete abstract click electronic access below) / Doutor
567

Hormetic UV treatments for control of plant diseases on protected edible crops

Scott, George January 2017 (has links)
Hormesis is a dose response phenomenon where low doses of a stress bring about a positive response in the organism undergoing treatment. UV-C hormesis has been known for over three decades and has a broad range of benefits on postharvest produce. Benefits include increased nutritional content, delayed chlorophyll degradation and disease resistance. The beneficial effects have been observed on many varieties of fresh produce including climacteric and non-climacteric fruit, tubers, salads and brassicas. The majority of previous studies have used low-intensity (LIUV) UV-C sources. LIUV sources require lengthy treatment times, which are in the region of 6 minutes for tomato fruit. This has, in part, prevented the commercial application of this technique. High-intensity, pulsed polychromatic light (HIPPL) sources, however, have recently been developed. HIPPL sources may have the potential to drastically reduce treatment times and increase their commercial viability. It was shown, here, that the use of HIPPL can control disease (reduce disease progression) caused by Botrytis cinerea and Penicillium expansum and also delay ripening on tomato fruit. Both disease control and delayed ripening were at similar levels for LIUV and HIPPL treatments on mature green fruit. The HIPPL treatments used in these studies can reduce treatment times for tomato fruit by 97.3%. Both HIPPL and LIUV treatments elicit local responses irrespective of the treatment orientation and tomato fruit, therefore, require full surface irradiation. Furthermore, UV-C in the HIPPL source is not required for disease control or delayed ripening. It does, however, contribute approximately 50% towards the total observed effects. Investigations into the mechanisms underpinning postharvest HIPPL and LIUV hormesis, on tomato fruit, identified that the expression of genes involved in plant hormone biosynthesis, defence, secondary metabolism and ripening were affected. This indicates that disease control is achieved through induced resistance. Changes to expression, following treatment, were highly similar for both HIPPL and LIUV treatments and were mediated by salicylic acid, jasmonic acid and ethylene. This may lead to broad range resistance against necrotrophic and biotrophic pathogens as well as abiotic stresses and herbivorous pests. Recently, the exposure of foliage to UV-C has been shown to induce resistance against B. cinerea on Arabidopsis thaliana. The horticultural applications of such treatments, however, have not been explored. Pre-harvest treatments of lettuce in the glasshouse showed variation in damage threshold and optimal treatment to control disease following LIUV and HIPPL treatment. Further sources of variation included the cultivar, pathogen of interest and the point that treatment was applied during the year. Using a controlled environment allowed seasonal variation to be mitigated and both HIPPL and LIUV treatments controlled disease against B. cinerea. For pre-harvest treatments to be a success in the glasshouse, further studies into how both biotic and abiotic factors influence treatment is required. To circumvent the problems associated with pre-harvest treatments and environmental variation in the glasshouse, LIUV seed treatments were performed on tomato. Control of B. cinerea was established with an approximately 10% reduction in incidence and disease progression with a 4 kJ/m2 treatment. When monitoring the effect of treatment on germination and early seedling development it was also identified that an 8 kJ/m2 treatment led to biostimulation of germination and root and shoot growth.
568

Estresse mineral induzido por fertilizantes potássicos em plantas de beringela (Solanum melogena L.) e seu efeito sobre parâmetros agronômicos e metabólicos

Marques, Douglas José [UNESP] 10 February 2009 (has links) (PDF)
Made available in DSpace on 2014-06-11T19:26:40Z (GMT). No. of bitstreams: 0 Previous issue date: 2009-02-10Bitstream added on 2014-06-13T20:15:26Z : No. of bitstreams: 1 marques_dj_me_botfca.pdf: 1236525 bytes, checksum: b3e82023e001449560012288e4ba0ba8 (MD5) / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) / A cultura da berinjela vem se destacando muito, principalmente na Europa, Estados Unidos e também no Brasil, com aumento da demanda por hortaliças. Dentre os fertilizantes potássios mais utilizados no Brasil, o cloreto de potássio, é responsável por 95% do consumo. Entre os fatores que afetam a resposta à adubação potássica, destacam-se salinidade e acidez do solo. O experimento foi divido em duas fases, sendo a primeira desenvolvida no Departamento de Produção Vegetal – Horticultura – UNESP, Campus de Botucatu, São Paulo. A segunda fase, compreendendo as análises bioquímicas, foram conduzidas no Departamento de Química e Bioquímica do Instituto de Biociências - UNESP, Campus de Botucatu, São Paulo. Utilizou-se a variedade de berinjela denominada de Embu, adotando-se delineamento em blocos casualizados, em esquema fatorial 2 x 4, com cinco repetições, com duas fontes de potássio (cloreto e sulfato de potássio) e quatro doses crescentes dos fertilizantes (250, 500, 750 e 1000 kg K2O ha-1) Observou-se que as plantas cultivadas com doses elevadas de ambas as fontes potássicas, induziram maior atividade das enzimas superoxido dismutase e catalase, além do aumento da concentração de L-prolina. Estas alterações indicam que estes parâmetros podem ser adotados como indicadores de estresse mineral na cultura da berinjela. Além dos fatores bioquímicos, observou-se que as variações das fontes potássicas influenciaram nos parâmetros biométricos e agronômicos da berinjela, notadamente quando aplicados em excesso. Avaliando-se os resultados do experimento, concluiu-se que a fonte KCl apresentou efeito salino superior, quando comparado com a fonte K2SO4 baseado no efeito mais pronunciado deste adubo, os parâmetros avaliados. Para ambas as fontes potássicas aplicadas, observou-se que o excesso de potássio afetou os parâmetros biométricos, produção e atividade enzimática das plantas. / Eggplant cultivation has extensively developed, mainly in Europe, United States and Brazil due to the increase in the demand for vegetables. Of the potassium fertilizers most frequently used in Brazil, potassium chloride satisfies 95% of the needs. Among the factors affecting the response to potassium fertilization are soil salinity and acidity. This experiment was divided into two steps: the first was conducted in the facilities of the Department of Plant Production, Horticulture, São Paulo State University – UNESP, Botucatu Campus, São Paulo State, Brazil. The second step which consisted of biochemical analyses was carried out in the Department of Chemistry and Biochemistry, Institute of Biosciences, UNESP, Botucatu Campus. The eggplant variety Embu was used, and the experimental design was in randomized blocks, 2 x 4 factorial arrangement, with five replicates, including 2 potassium sources (potassium chloride and sulfate) and four increasing doses of the fertilizers (250, 500, 750, and 1000 kg K2O ha-1). Elevated doses of both potassium sources led to higher activity of the enzymes superoxide dismutase and catalase in plants, as well as to an increasing L-proline concentration. Based on such alterations, those parameters can be used as indicators of mineral stress in eggplant culture. Besides biochemical factors, biometric and agronomical parameters were also influenced by variations in the potassium sources, mainly when applied in excess. The present experiment demonstrated that KCl source had higher saline effect, compared with K2SO4 source, considering the higher effect of the former on the evaluated parameters. As regards both potassium sources, the excess of potassium affected biometric parameters, yield and enzymatic activity.
569

Uso de paclobutrazol na produção de mudas, no crescimento, produção e qualidade de frutos de tomateiro em ambiente protegido

Seleguini, Alexsander [UNESP] 05 November 2007 (has links) (PDF)
Made available in DSpace on 2014-06-11T19:35:17Z (GMT). No. of bitstreams: 0 Previous issue date: 2007-11-05Bitstream added on 2014-06-13T19:24:51Z : No. of bitstreams: 1 seleguini_a_dr_ilha.pdf: 1010511 bytes, checksum: eb32bdc0873ccf57c670095c19e87ff7 (MD5) / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) / O objetivo do presente trabalho foi avaliar os efeitos de três concentrações (0, 50 e 100 mg L-1) e dois métodos de aplicação (embebição de sementes e rega de plântulas) de paclobutrazol (PBZ) na produção de mudas, no desenvolvimento e produção de plantas, bem como na qualidade físico-química e vida de prateleira de frutos de tomateiro, híbrido longa vida AF 7631. O trabalho foi conduzido na Universidade Estadual Paulista (UNESP), campus de Ilha Solteira, Estado de São Paulo, Brasil, de setembro de 2006 a março de 2007. As embebições de sementes com 50 e 100 mg L-1 de PBZ inibiram e atrasaram a emergência de plântulas, mas foram ineficientes na redução da altura das plântulas. Entretanto, a aplicação do regulador, via rega, nas mesmas concentrações, aos 15 dias após a semeadura, controlou o desenvolvimento da parte aérea, como demonstrado pelos menores valores médios de altura, área foliar e massa de matéria seca de parte aérea das plântulas, determinando, ainda, o aumento do diâmetro da haste e do desenvolvimento do sistema radicular das plântulas. Após o transplantio das mudas em ambiente protegido, observou-se que os métodos de aplicação e o incremento das concentrações de PBZ não influenciaram significativamente a produtividade. O tratamento das mudas via rega, com concentrações crescentes de PBZ, reduziu linearmente a altura das plantas, a taxa de crescimento absoluto, a altura de inserção da primeira inflorescência e a massa de matéria seca de folhas e hastes. Independentemente do método de aplicação de PBZ, o aumento das concentrações reduziu significativamente o vigor das brotações laterais e aumentou a produção de frutos pequenos. Ainda, as regas das mudas com 50 e 100 mg L-1 de PBZ, aos 15 dias após a semeadura, não alteraram a vida de prateleira dos frutos, porém, com o aumento... / The aim of the present work was to evaluate the effects of three solution concentrations (0, 50, 100 mg L-1) and two methods of application (seed imbibition and drench of seedlings) of paclobutrazol (PBZ), on seedlings production, plant development and yield, as well as physico-chemical quality and shelf-life of tomato fruits, hybrid AF 7631. The experiment was conducted out at São Paulo State University, UNESP, campus of Ilha Solteira, São Paulo State, Brazil, from September of 2006 to March of 2007. It was found that the seeds imbibitions with PBZ, at 50 and 100 mg L-1, inhibited or delayed the seedlings emergence, as well as it was ineffective in reducing the height of the seedlings. However, the use of growth regulator drenches, in the same concentrations, at the 15th day after the sowing, was effective in controlling the plant development, as showed by the lowest means of seedlings height, leaf area and dry mass, and it still contributed to the increase in the stem diameter, measured at the base of the hypocotyls, and in the development of seedlings roots of tomatoes. After the seedlings transplant to the greenhouse, it was observed that the methods of application, as well as plant growth regulator concentration, did not affected significantly the yield. The seedling drenches, with increasing PBZ concentrations, induced linear decrease in the plant height, in the absolute growth rate, in the height of the first inflorescence and in the dry matter mass of leaves, shoots and stem. It was also observed that, independently of the method of application, the increase in PBZ solution concentrations significantly reduced the side shoots vigour and increased the yield of fruits classifield as small size. Further more, the drenches of PBZ on tomato seedlings, in concentrations of 50 and 100 mg L-1, did not ...(Complete abstract click electronic access below)
570

Efeitos dos extratos de Solanum guaraniticum e Syzygium jambos sobre parâmetros bioquímicos e de estresse oxidativo em modelos in vitro e in vivo / Effects of Solanum guaraniticum and Syzygium jambos extracts on biochemical and oxidative stress parameters in in vitro and in vivo models

Bonfanti, Gabriela 22 January 2014 (has links)
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior / The use of medicinal plants for the treatment and prevention of disease is a common practice, despite their effects are few studied scientifically. Solanum guaraniticum, also known as false jurubeba, is a medicinal plant widely distributed in Rio Grande do Sul and used for the treatment of gastric and hepatic disorders. Similarly, Syzygium jambos has its leaves, seeds and fruits used for the treatment of diabetes mellitus. Therefore, considering the popularity of the species mentioned above and the lack of data on their pharmacological and toxicological profiles, the aim of this study was to evaluate the effect of leaf extracts of S. jambos and S. guaraniticum on biochemical and oxidative stress parameters in in vitro and in vivo models.The extracts showed vitamin C and phenolic compounds, among which were identified gallic, chlorogenic and ellagic acids, catechin, epicatechin, rutin, quercitrin, isoquercitrin, quercetin and kaempferol in both extracts and caffeic acid only in S. jambos extract. In models of oxidative stress induction, both extracts exhibited anti-hemolytic effect on human erythrocytes and were capable of decrease the process of lipid peroxidation, and this last effect was also observed in kidney, liver and brain tissues of rats, in vitro. In these tissues, both extracts were also able to protect the thiol groups. The extracts showed H2O2 and NO scavenging ability, Fe2+ chelating activity and reducing capacity, proving its antioxidant action. In all assays, the extract of S. jambos was more potent as an antioxidant and also showed tiol-peroxidase - like activity. We observed an inhibition of the activity of δ-aminolevulinic acid dehydratase (δ-ALA-D) in human erythrocytes by both extracts, and the S. guaraniticum was more potent in this assay. It is possible to suggest an involvement of zinc ions of the active site of this enzyme in this inhibition mechanism. The extract of S. guaraniticum administered in vivo, was not able to cause changes in the activity of the enzyme δ-ALA-D, as well as enzymes acetilcholinesterase and N-acetyl-b-D-glucosaminidase. The Artemia salina lethality test showed that both extracts are biologically active. In lymphocytes, in vitro, the extract of S. jambos altered mitochondrial activity and inhibit AChE activity, suggesting an immunomodulatory effect, while the extract of S. guaranticium shows cytotoxic effects. In the acute toxicity evaluation of the extract of S. guaraniticum was possible to identify that the LD50 is greater than 5000 mg/kg and, therefore, this extract can be considered non-toxic for human consumption. Furthermore, although the animals did not show significant bodily, hematological and biochemical changes, the treatment with the extract of S. guaraniticum was able to cause an alteration in the open field test. The reduction in the number of crossing and rearing may indicate a depressant effect, which seems to be delayed and short-lasting. Therefore, the vegetal species studied can be recognized as sources of natural antioxidants and have prospective use in preventive medicine against oxidative stress related diseases, although its popular use should be done with caution until further studies regarding the toxicological profile of the extracts is performed. / O uso de plantas medicinais no tratamento e prevenção de doenças é pratica comum, apesar de poucas terem seus efeitos estudados cientificamente. A Solanum guaraniticum, conhecida também como falsa jurubeba, é uma planta amplamente distribuída no Rio Grande do Sul e utilizada para o tratamento de distúrbios gástricos e hepáticos. Já o Syzygium jambos,conhecido popularmente como jambolão , tem suas folhas, sementes e frutos utilizados para o tratamento do diabetes mellitus. Assim, considerando a popularidade das espécies acima citadas e a escassez de dados sobre os seus perfis farmacológico e toxicológico, o objetivo desse estudo foi avaliar o efeito dos extratos de folhas de S. jambos e S. guaraniticum sobre parâmetros bioquímicos e de estresse oxidativo em modelos in vitro e in vivo. Os extratos apresentaram vitamina C e compostos fenólicos, dentre os quais foram identificados: ácido gálico, elágico e clorogênico, catequina e epicatequina, rutina, quercitina quercitrina, isoquercitrina e canferol em ambos os extratos, e ácido cafeico somente no extrato de S. jambos. Em modelos de indução de estresse oxidativo, os extratos apresentaram efeito anti-hemolítico em eritrócitos humanos, e foram capazes de diminuir o processo de lipoperoxidação, efeito também observado em tecido renal, cerebral e hepático de ratos, in vitro. Nesses tecidos, ambos os extratos também foram capazes de proteger os grupos tióis. Os extratos apresentaram capacidade removedora de H2O2 e NO, atividade quelante de íons Fe2+ e capacidade redutora, comprovando sua ação antioxidante. Em todos os testes realizados, o extrato de S. jambos se mostrou mais potente como antioxidante e ainda apresentou atividade mimética às enzimas tiolperoxidades. Observou-se uma inibição da atividade da δ-aminolevulinato desidratase (δ-ALA-D) em eritrócitos humanos por ambos os extratos, sendo que o de S. guaraniticum foi mais potente nesses ensaios. É possível sugerir um envolvimento dos íons zinco do sítio ativo da enzima nesse mecanismo de inibição. O extrato de S. guaraniticum administrado in vivo, não foi capaz de provocar alterações na atividade da enzima δ-ALA-D, assim como nas enzimas aceticolinesterase (AChE) e N-acetyl-b-D-glucosaminidase. O teste de letalidade da Artemia salina demonstrou que ambos os extratos são bilogicamente ativos. Em linfócitos, in vitro, o extrato de S. jambos alterou a atividade mitocondrial e inibiu a atividade da AChE, sugerindo um efeito imunomodulatório enquanto que o extrato de S. guaranticium apresentou efeitos citotóxicos. Na avaliação da toxicidade aguda do extrato de S. guaraniticum foi possível identificar que a DL50 é superior a 5000 mg/kg e, portanto, esse extrato pode ser considerado não tóxico para o consumo humano. Além disso, apesar de os animais não terem apresentado alterações corporais, hematológicas e bioquímicas significativas, o tratamento com o extrato de S. guaraniticum foi capaz de causar uma alteração no teste do campo aberto. A redução no número de cruzamentos e levantadas pode indicar um efeito depressor, que parece ser tardio e não permanente. Portanto, as espécies vegetais estudadas podem ser reconhecidas como fonte de antioxidantes naturais e tem uso prospectivo na medicina preventiva contra doenças relacionadas ao estresse oxidativo, mas seu uso popular deve ser feito com cautela até que uma maior investigação em relação ao perfil toxicológico dos extratos seja realizada.

Page generated in 0.0501 seconds