O cádmio (Cd) é um metal pesado encontrado naturalmente no meio ambiente em níveis da ordem de 0,5 mg.L-1. No entanto, atividades humanas têm aumentado sua concentração na biosfera, por meio de efluentes industriais não tratados. Essa elevação pode causar estresse oxidativo nas plantas, conferindo aberrações cromossômicas, danos ao DNA e alterações nos microtúbulos das células. Pesquisas têm avaliado os efeitos do Cd em diversas espécies de plantas. Entretanto, o tomateiro ainda não tem sido alvo de tais pesquisas mesmo sendo considerada uma planta modelo em outras áreas. Dessa forma, justifica-se a condução de experimentos que avaliem a genotoxicidade do Cd nesta espécie através de abordagens baseadas na citogenética. Este estudo foi conduzido para avaliar efeitos genotóxicos do Cd em células meristemáticas de raízes de tomateiro do cultivar Micro-Tom através da investigação de aberrações cromossômicas, grau de danos causados ao DNA e anormalidades das fibras do fuso mitótico e do citoesqueleto. Evidenciou-se que a partir da dose mínima de Cd empregada (variou de 0,018 a 13 mg.L-1), foram observadas aberrações cromossômicas, tais como quebras, perdas, adesões e pontes. Ainda empregando-se as mesmas doses de Cd, constataram-se danos ao DNA por meio do ensaio de cometa. Porém, de acordo com a dose de 3,7 mg.L-1 de Cd, os microtúbulos de ?-tubulinas sofreram modificações em sua estrutura que alteram a organização do citoesqueleto celular, do fuso mitótico e da citocinese. Em geral, o tomateiro apresentou sensibilidade em baixas concentrações de Cd, o que possibilita considerá-lo como uma importante planta modelo com potencial para estudos de genotoxicidade aplicados ao monitoramento ambiental e testes de compostos tóxicos. / Cadmium (Cd) is a heavy metal found naturally in the environment at low levels (around 0.5 mg.L-1). Some human activities have increased its concentration in the biosphere due to untreated industrial effluents. This increase may induce oxidative stress in plants and potentially causing chromosomal aberrations, DNA damage and changes in the cell microtubules. Researchers have evaluated the Cd effects in several plant species. However, tomato has not been the target of these researches even though it is considered as a plant model in others areas. Therefore, experiments are needed to assess the genotoxicity of Cd in this plant species through cytogenetical approaches. The present work was carried out to assess the Cd genotoxic effects on root-meristem cells of Micro-Tom based on chromosomal aberrations, DNA damage and abnormal mitotic spindle fibers and cytoskeleton. Low Cd concentrations (ranging from 0.018 to 13 mg.L-1) were able to induce chromosomal aberrations such as breaks, losses, stickiness and bridges. At the same concentrations, DNA damage was evidenced using the comet assay. Concentrations of 3.7 mg.L-1 Cd induced structural modifications of the microtubules of ?-tubulin that altered the organization of the cytoskeleton, the mitotic spindle fibers and cytokinesis. In general, tomato presented sensitivity to low concentrations of Cd. These results suggest that tomato is also a good model for studies of genotoxicity to be applied on environmental monitoring and toxic compounds assays.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

Muitas respostas moduladas pela luz durante o desenvolvimento das plantas também são reguladas por hormônios vegetais, levando à hipótese da interação entre ambos os fatores. Uma ferramenta valiosa para testar tal interação seria o uso de mutantes fotomorfogenéticos e hormonais, bem como duplos mutantes combinando ambos. Em tomateiro, embora sejam disponíveis mutantes com alterações na biossíntese de fotorreceptores e/ou na transdução do sinal da luz, bem como mutantes no metabolismo e/ou sensibilidade hormonal, esses estão presentes em cultivares diferentes, o que pode limitar seu uso de modo integrado e a construção de duplos mutantes. No presente trabalho, foram introgredidas em uma única cultivar de tomateiro, Micro-Tom (cv. MT), dezenove mutações afetando a biossíntese ou a resposta a fitocromo, bem como aos hormônios auxina (AUX), citocinina (CK), giberelina (GA), ácido abscísico (ABA), etileno (ET) e brassinoesteróides (BR). Tomando-se vantagem de tal coleção, duas respostas notadamente controladas tanto pela luz quanto por hormônios foram estudadas: alongamento e acúmulo de antocianinas em hipocótilos. Para tal, foram utilizadas as seguintes abordagens: i) tratamentos exógenos de diferentes classes hormonais em mutantes fotomorfogenéticos, ii) observação de hipocótilos de mutantes hormonais crescidos na luz e no escuro, iii) observação de duplos mutantes combinando mutações hormonais e fotomorfogenéticas. Assim, o acúmulo de antocianinas foi promovido pela CK e ABA e inibido pela GA, concordando com a redução no mutante deficiente em ABA (notabilis ou not) e no mutante hipersensível à GA (procera ou pro). Apesar do mutante com baixa sensibilidade à AUX (diageotropica ou dgt) acumular exageradamente antocianinas, a aplicação exógena não evidenciou o papel da AUX, sendo, porém, coerente com a sugestão de que esse mutante possui um balanço AUX/CK voltado para CK. Tanto a aplicação exógena quanto a avaliação nos mutantes epinastic (epi), super produção de ET, e Never ripe (Nr), baixa sensibilidade ao ET, sugerem uma função limitada desse hormônio na biossíntese de antocianinas. Na luz e no escuro, AUX, CK, ABA e ET exógenos resultaram na inibição do alongamento do hipocótilo, sendo coerente com a promoção em dgt (luz), promoção em sit (luz), inibição em epi (luz e escuro). Por outro lado, GA promoveu o alongamento corroborando a promoção em pro. Contrariando o efeito exógeno da CK, brt reduziu o alongamento na luz e no escuro. No escuro, o único mutante que apresentou alongamento do hipocótilo superior a MT foi o mutante deficiente na biossíntese do phy (aurea ou au). A utilização de duplos mutantes combinando phy- e alterações hormonais mostrou uma interação aditiva (au epi, au Nr, au dgt e au sit), sinergística (au pro) e epinástica (au brt) no acúmulo de antocianinas e alongamento do hipocótilo na luz, porém nessa última resposta, au dgt e au sit indicaram uma interação sinergística. Juntos, esses resultados indicam que, embora phy possui vias distintas da AUX, ET, ABA e GA no controle do acúmulo de antocianinas e alongamento do hipocótilo, parece que esse fotorreceptor partilha vias comuns com CK em ambas as respostas. / Many responses regulated by light during plant development are also regulated by plant hormones, suggesting an interaction between these factors. One important approach to test this hypothesis is the use of photomorphogenic and hormonal mutants and double mutant analysis. Mutants with altered photoreceptor biosynthesis, light signal transduction, hormonal metabolism and hormonal sensitivity are available in tomato. However, since they are in different cultivars, this can be a limitation for their use in a comprehensive study, as well as, for the construction of double mutants. In this work we performed the introgression of nineteen mutations in a single cultivar of tomato, Micro- Tom (cv. MT). These mutations affect biosynthesis or response to phytochrome (phy), auxin (AUX), cytokinin (CK), gibberellin (GA), abscisic acid (ABA), ethylene (ET) and brassinosteroid (BR). Using this collection of hormone mutants, we studied two responses which are controlled by light and hormones: elongation and anthocyanin accumulation in hypocotyls. For this purpose, we used three approaches: i) hormonal treatment in the photomorphogenic mutants, ii) measurement of hypocotyl lengths from hormonal mutants grown under light and dark conditions and iii) double mutant (photomorphogenic-hormonal) analysis. Anthocyanin accumulation was promoted by CK and ABA and inhibited by GA. This is in accordance with the reduction of anthocyanin accumulation in the ABA deficient mutant (not) and in the GA hypersensitive mutant (pro). Although the diageotropica (dgt), auxin-insensitive mutant, showed a high anthocyanin accumulation, the addition of auxin did not supported a role for this hormone in anthocyanin accumulation. On the other hand, this could be due to a low auxin-tocytokinin ratio presented by dgt. Data from mutants with altered metabolism and sensitivity of ethylene, epinastic (epi) and Never ripe (Nr) respectively, and from plants treated with this hormone suggest a limited role of ethylene in the anthocyanin biosynthesis. Exogenous AUX, CK, ABA and ET inhibited the hypocotyl elongation. This is coherent with the promotion of hypocotyl elongation in dgt and sit mutants under light conditions and inhibition of hypocotyl elongation in the epi mutant in the light and dark. On the other hand, GA promoted the hypocotyl elongation corroborating the same effect seen in pro. The brt mutant showed a reduced hypocotyl elongation in light and dark conditions, which contradicts the effect of exogenous cytokinin. The phytochromedeficient aurea (au) mutant was the only one to show an enhanced hypocotyl elongation in the dark compared to the wild type (MT). The combination between photomorphogenic and hormonal mutants (double mutants) showed additive (au epi, au Nr, au dgt e au sit), synergistic (au pro) and epistatic (au brt) interactions considering the anthocyanin accumulation and hypocotyl elongation. Synergistic interaction was observed in the elongation hypocotyl of the au dgt and au sit double mutants. These results indicate that phy and CK may share some signaling/metabolic pathways in the control of anthocyanin accumulation and hypocotyl elongation. On the other hand, our data do not support an interaction between phy and the hormones AUX, ET, ABA and GA in the control of hypocotyls elongation or anthocyanin accumulation.

A bioatividade de nanoformulações de nim e de extratos de outras Meliaceae foi avaliada, em tomateiro, em laboratório e em casa de vegetação, visando ao controle de Tuta absoluta (Meyrick). Incialmente foram testadas 22 nanoformulações (incluindo nanocápsulas e nanoesferas) e os extratos em hexano, em diclorometano e em etanol de folhas e ramos de Trichilia pallida Swartz, Trichilia catigua A. Juss, Trichilia claussenii C. DC, Guarea guidonia (L.) Sleumer e Toona ciliata M. Roemer. O óleo de nim Organic Neem® também foi utilizado nos bioensaios com as nanoformulações e como controle foram utilizadas água destilada e/ou acetona. A partir desses bioensaios, selecionaram-se as nanoformulações NC40 aquoso e NC40 pó (NC40=nanocápsulas de poli- -hidroxibutirato) e os extratos etanólicos de T. ciliata e de T. catigua, que foram avaliados em relação ao efeito sobre o desenvolvimento e longevidade do inseto e em relação aos modos de ação (translaminar, sistêmico e de contato) e ao poder residual. O efeito dos tratamentos selecionados sobre os entomopatógenos Beauveria bassiana (Bals.) Vuill. e Phothorimaea operculella granulovírus (PhopGV) foram avaliados in vitro e in vivo, respectivamente. A seguir, foi avaliada a possível interação dos derivados vegetais com os entomopatógenos. Finalmente, foi avaliada a seletividade ao parasitoide de ovos Trichogramma pretiosum Riley, segundo as recomendações da IOBC. Os resultados obtidos demonstraram que, entre os tratamentos testados, constatou-se bioatividade com oito nanoformulações e com os extratos de G. guidonia em diclorometano; T. ciliata em hexano, em diclorometano e em etanol; T. catigua em hexano, em diclorometano e em etanol; T. claussenii em etanol e T. pallida em hexano. A fase do inseto mais afetada foi a larval, no entanto a oviposição das fêmeas foi diminuída quando as plantas foram tratadas com o extrato etanólico de T. ciliata. Constatou-se efeito translaminar e sistêmico para as nanoformulações e para o óleo de nim. A ação de contato variou com o modo de exposição e com a idade das lagartas. O efeito residual do óleo de nim e da nanoformulação NC40 aquoso foi de sete dias, enquanto para NC40 pó foi de três dias. As nanoformulações e os extratos etanólicos de T. ciliata e de T. catigua foram compatíveis com o fungo e com o granulovírus. Quando os entomopatógenos foram misturados aos derivados vegetais observou-se que o nim reduziu drasticamente a sobrevivência larval na mistura com os dois entomopatógenos, sendo o maior efeito causado pelo derivado vegetal. Na mistura dos entomopatógenos com o extrato de T. ciliata, observou-se maior redução da sobrevivência larval com PhopGV. No bioensaio de seletividade a T. pretiosum, constatou-se que apenas o óleo de nim afetou a capacidade de parasitismo, sendo levemente nocivo. Para NC40 aquoso e extrato de T. ciliata não foram constatados efeitos sobre o parasitismo e sobre o desenvolvimento do parasitoide. / The bioactivity of neem nanoformulations and extracts of other Meliaceae was evaluated in tomato plants in the laboratory and in greenhouse aiming to control Tuta absoluta (Meyrick, 1917). Initially, 22 nanoformulations were tested (including nanocapsules and nanospheres) in addition to the hexane, dichloromethane and ethanol extracts of leaves and branches of Trichilia pallida Swartz, Trichilia catigua A. Juss, Trichilia claussenii C. DC, Guarea guidonia (L.) Sleumer and Toona ciliata M. Roemer. The neem oil Organic Neem® was also used in the bioassays with the nanoformulations and distilled water and/or acetone were used as controls. From these bioassays the aqueous NC40 and powdered NC40 (NC40 = Poly- -hydroxibutirate nanocapsules) nanoformulations as well as the ethanolic extracts of Toona ciliata and Trichilia catigua were selected. These treatments were evaluated regarding their effect on insect development and longevity, mode of action (translaminar, systemic and contact) and residual action. The effects of the selected treatments on the entomopathogens Beauveria bassiana (Bals.) Vuill. and Phthorimaea operculella granulovirus (PhopGV) were evaluated in vitro and in vivo, respectively. Then the possible interaction between plant derivates and entomopathogens was evaluated. Finally, a selectivity bioassay to the egg parasitoid Trichogramma pretiosum Riley was evaluated according to IOBC recommendations. The results obtained demonstrate that among these treatments eight nanoformulations and the extracts of G. guidonia in dichloromethane; T. ciliata in hexane, dichloromethane and ethanol; T. catigua in hexane, dichloromethane and ethanol; T. claussenii in ethanol and T. pallida in hexane showed bioactivity on the insect. The most affected insect stage was the larva, but oviposition was reduced when these plants were treated with T. ciliata ethanolic extract. The nanoformulations and neem oil presented translaminar and systemic effect. Contact action varied with exposure mode and caterpillar age. The residual effect of neem oil and aqueous NC40 nanoformulations was seven days while for powdered NC40 was three days. The nanoformulations and the ethanolic extracts of T. ciliata and T. catigua were compatible with the fungus and the granulovirus. When the entomopathogens were mixed to the plant derivates, neem drastically reduced larval survival in the mixture with both entomopathogens and the plant derivate produced a greater effect than the entomopathogen. In the mixture of entomopathogens with T. ciliata extract there was a greater reduction of larval survival with PhopGV. In the T. pretiosum selectivity bioassay only the neem oil was slightly harmful and affected parasitism capacity. For aqueous NC40 and T. ciliata extract no effects over parasitism or parasitoid development were seen.

Os frutos do tomateiro (Solanum lycopersicum) apresentam elevada diversidade fenotípica, grande parte da qual deve-se a mutações em cinco genes, SUN (SUN), OVATE (O), LOCULE NUMBER (LC), FRUIT SHAPE 8.1 (FS8.1) e FASCIATED (FAS). Enquanto mutações em LC, O e FAS são responsáveis pela alteração no número de lóculos no fruto, mutações em FS8.1, SUN e O resultam em frutos mais alongados, sendo a última mutação o foco de estudo do presente trabalho. Apesar de ovate ser uma mutação importante tanto do ponto de vista agronômico quanto biológico, não é conhecido ainda o efeito exato da nova classe de gene regulatório codificado por esse locus. Por promover a drástica alteração no formato do fruto, característica esta que pode influenciar a preferência do consumidor, essa mutação é de grande interesse agronômico. Sob o ponto de vista biológico, o maior conhecimento da função desse gene resultaria em um maior entendimento do processo de frutificação. A análise de duplos mutantes ovate DR5::GUS e ovate ARR5::GUS mostrou que essa mutação altera o padrão de resposta a auxina e citocinina, respectivamente, durante o desenvolvimento do fruto. Além disso, foram realizados estudos que mostraram seu impacto no teor de sólidos solúveis, produtividade, tempo de prateleira, teor de matéria seca, peso das sementes e partenocarpia. Tais resultados não somente contribuíram para um melhor entendimento do efeito gênico da nova classe de genes regulatórios codificado por OVATE, como também fornecem importantes implicações agronômicas, já que a mutação ovate vem sendo utilizada na obtenção de variedades e híbridos do tipo \"grape\". / The fruits of tomato (Solanum lycopersicum) present a high phenotypic diversity, most of which can be attributed to mutations in five genes: SUN (SUN), OVATE (O), LOCULE NUMBER (LC), FRUIT SHAPE 8.1 (FS8.1) and FASCIATED (FAS). Whereas mutations in LC, O and FAS alter fruit locule number, mutations in FS8.1, SUN and O result in elongated fruits. The latter is the focus of the present work. ovate is a biologically and agronomically relevant mutation, however, the exact effect of the new class of regulatory gene it represents is unknown. The drastic alteration in fruit shape produced by the mutation can influence consumer preference, thus rendering it agronomically important. Biologically, a thorough characterization of its gene function would result in deeper understanding of fruit formation. Crosses to the marker lines DR5::GUS and ARR5::GUS showed that ovate alters the response pattern of auxin and cytokinin, respectively, during fruit development. Furthermore, studies are described showing its effect on total soluble solids content, yield, shelf life, dry mass rate, seed weight and parthenocarpy. The results contribute not only to a better understanding of the effect of the new class of regulatory genes encoded by OVATE, but also have important agronomic implications, given that the ovate mutation has been used in the obtention of \'grape/plum\' tomato varieties and hybrids.

La connaissance de la diversité génétique de R. solanacearum autant que la connaissance du déterminisme génétique de la résistance sont importantes pour établir une stratégie de lutte contre cette bactérie ubiquiste. Elles permettent de choisir et d'orienter des méthodes de lutte et le développement d'outils de contrôle de quarantaine adaptés. Dans un contexte scientifique de plus en plus tourné en génétique par l'approche plante modèle et dans lequel les Solanacées occupent la place de plante pionnière d'une part, et d'autre part par l'émergence de contournement des résistances liées à la grande diversité génotypique et phénotypique de R. solanacearum (au point où on parle ici de complexe d'espèce), l'objectif de cette thèse est de contribuer à établir les bases d'un programme d'amélioration des Solanacées contre cette phytobactériose majeure au Cameroun. En recourant à une approche moléculaire, notamment la méthode de caractérisation phylophasique qui décrit la diversité génétique des souches de R. solanacearum en quatre phylotypes et séquevars, nous avons révélé l'existence de trois phylotypes dans ce pays d'Afrique dont la diversité agro-climatique lui vaut le surnom d'" Afrique en miniature ". Ces phylotopes sont le I (Asiaticum), II (Americanum) et III (Africanum). Les souches du phylotype III du Cameroun se sont révélées génétiquement distinctes des souches africaines de référence originaires du Zimbabwe et de l'Océan Indien. Les souches isolées sur pomme de terre dans les hauts plateaux de l'Ouest du Cameroun se classent dans les deux phylotypes, à savoir le II (r3-bv2) et le III. Ces souches du phylotype II et III des hauts plateaux de l'Ouest infectent aussi bien la pomme de terre que la tomate, et pourraient constituer une menace économique pour ces cultures dans cette région. Dans cette étude, les souches du phylotype I émergent en zone forestière humide comme une contrainte majeure à la culture des Solanacées. Ce constat a orienté le choix d'une souche de ce phylotype (CMR143) dans les travaux de la cartographie génétique de la résistance chez le piment. Pour ce faire, deux géniteurs de résistance différents CM334 et PM687 ont été considérés. Ces études génétiques ont montré une forte héritabilité de la résistance au flétrissement bactérien chez le piment. La détection de QTL par analyse de variance (ANOVA), par cartographie d'intervalle, simple (SIM) et composite (CIM), ont révélé l'existence de 3 à 6 QTLs et d'interactions digéniques dans le contrôle de la résistance du piment au flétrissement bactérien. Ces résultats confirment le caractère oligogénique de la résistance du piment au flétrissement bactérien. En mettant ensemble ces QTLs et ces interactions digéniques, 47 à 64 % de la variance phénotypique sont expliqués selon le caractère de résistance considéré. Par ailleurs, il est montré que la résistance du piment au flétrissement bactérien est fortement associée à la limitation de l'envahissement de la tige par la bactérie. De plus, cette étude a mis en évidence le caractère phylotype-spécifique de la résistance, car seulement 33% de facteurs génétiques contribuent au contrôle du flétrissement bactérien lors de tests avec le phylotype 2. La localisation de ces derniers permet de conclure en validant partiellement l'hypothèse de synténie entre la tomate et le piment.

Le poids et la teneur en sucres du fruit sont deux caractères complexes, importants pour la qualité de la tomate. L'objectif de cette thèse est de disséquer ces deux caractères par une démarche pluridisciplinaire, impliquant des approches écophysiologiques, génétiques et moléculaires. Une population de 20 lignées d'introgression de Solanum chmielewskii dans le fonds génétique de S. lycopersicum a été cultivée en 2006 et en 2007 sous deux conditions de charges en fruits afin de moduler sa disponibilité en carbone : une forte charge où tous les fruits sont conservés sur les bouquets, et une faible charge constituée par un unique fruit par bouquet. Des indicateurs de processus écophysiologiques impliqués dans le poids et la teneur en sucres du fruit ont été mesurés ou estimés. Ils ont permis de caractériser les principaux processus écophysiologiques sous-jacents aux QTL de qualité, notamment la division et l'expansion cellulaire, la transpiration du fruit, et l'allocation carbonée pour la synthèse de composés structuraux. Un fort effet de la charge en fruits a été mis en évidence sur l'expression des QTL pour la plupart des caractères observés, indiquant l'occurrence d'interactions génotype x charge en fruits. L'utilisation d'un modèle écophysiologique prédisant la teneur en sucres d'un fruit de tomate à maturité, combiné à une détection de QTL, a permis d'identifier des colocalisations entre QTL de qualité et QTL de variables de fonctionnement du fruit telles que la fourniture du fruit en assimilats, la transformation métabolique des sucres en d'autres composés, ou la dilution des composés par l'entrée d'eau dans le fruit. Enfin, une lignée d'introgression portant des QTL de poids frais et de sucres avec des allèles aux effets opposés ainsi que la lignée conférant le fonds génétique ont été étudiées au niveau moléculaire par une analyse du transcriptome en phase d'expansion cellulaire. Des gènes candidats dont le niveau d'expression serait associé aux variations de poids et de teneurs en sucres du fruit, engendrées par une modification de la charge en fruits ont été identifiés. L'analyse en cinétique de l'expression de quelques gènes candidats a permis de mettre en évidence des liens entre variables écophysiologiques et moléculaires.

The advent of large-scale and high-throughput technologies has recently caused a shift in focus in contemporary biology from decades of reductionism towards a more systemic view. Alongside the availability of genome sequences the exploration of organisms utilizing such approach should give rise to a more comprehensive understanding of complex systems. Domestication and intensive breeding of crop plants has led to a parallel narrowing of their genetic basis. The potential to improve crops by conventional breeding using elite cultivars is therefore rather limited and molecular technologies, such as marker assisted selection (MAS) are currently being exploited to re-introduce allelic variance from wild species. Molecular breeding strategies have mostly focused on the introduction of yield or resistance related traits to date. However given that medical research has highlighted the importance of crop compositional quality in the human diet this research field is rapidly becoming more important. Chemical composition of biological tissues can be efficiently assessed by metabolite profiling techniques, which allow the multivariate detection of metabolites of a given biological sample.<br><br> Here, a GC/MS metabolite profiling approach has been applied to investigate natural variation of tomatoes with respect to the chemical composition of their fruits. The establishment of a mass spectral and retention index (MSRI) library was a prerequisite for this work in order to establish a framework for the identification of metabolites from a complex mixture. As mass spectral and retention index information is highly important for the metabolomics community this library was made publicly available. Metabolite profiling of tomato wild species revealed large differences in the chemical composition, especially of amino and organic acids, as well as on the sugar composition and secondary metabolites. Intriguingly, the analysis of a set of <i>S. pennellii</i> introgression lines (IL) identified 889 quantitative trait loci of compositional quality and 326 yield-associated traits. These traits are characterized by increases/decreases not only of single metabolites but also of entire metabolic pathways, thus highlighting the potential of this approach in uncovering novel aspects of metabolic regulation. Finally the biosynthetic pathway of the phenylalanine-derived fruit volatiles phenylethanol and phenylacetaldehyde was elucidated via a combination of metabolic profiling of natural variation, stable isotope tracer experiments and reverse genetic experimentation. / Die Einführung von Hochdurchsatzmethoden zur Analyse von biologischen Systemen, sowie die umfangreiche Sequenzierung von Genomen haben zu einer Verlagerung der Forschung „im Detail“ zu einer ganzheitlicheren Betrachtungsweise auf Systemebene geführt. Aus einer jahrhundertlangen, intensiven Züchtung und Selektion von Nutzpflanzen resultierte gleichzeitig eine Abnahme der genetischen Varianz. Daraus resultierend sind Nutzpflanzen anfälliger gegenüber Stressfaktoren, wie Pathogenen, hohen Salzkonzentrationen oder Trockenheit, als ihre Wildarten. Das Potential konventioneller Züchtung scheint somit heute an seine Grenzen gekommen zu sein. Daher versucht man mittels moderner Molekulartechnik, wie zum Beispiel Marker-gestützte Selektion, Gene oder ganze Genombereiche von Wildarten mit hoher genetischer Variation in Nutzpflanzen einzukreuzen, vornehmlich mit dem Ziel einer Ertrags- bzw. Resistenzsteigerung. Neueste medizinische Studien belegen, dass die Ernährung eine wesentliche Rolle für die menschliche Gesundheit spielt. Besonders wichtig sind hierbei die gesundheitsfördernden Substanzen in pflanzlichen Nahrungsmitteln. Aus diesem Grund kommt der Erforschung der biochemischen Zusammensetzung von biologischen Proben eine immer größere Bedeutung zu. Diese Untersuchung kann elegant durch Metabolitenprofile, welche die multivariate Analyse komplexer biologischer Proben erlauben, durchgeführt werden.<br><br> In dieser Arbeit wurde zur Untersuchung der biochemischen Zusammensetzung von Tomatenwildarten und interspezifischen <i>S. pennellii</i> Tomatenintrogressionslinien (IL) eine GC/MS basierte Metabolitenanalyseplattform verwendet. Hierzu war es zunächst notwendig eine Massenspektrenbibliothek, zur Annotierung von Massenspektren und Retentionsindices von, in pflanzlichen Proben vorkommenden, Metaboliten anzulegen. Die Analyse der Tomatenwildarten ergab große Unterschiede gegenüber der Kulturtomate im Hinblick auf den Gehalt an Amino- und organischen Säuren, sowie der Zuckerzusammensetzung und den Gehalt an Sekundärmetaboliten. Die darauf folgende Analyse der ILs, von den jede ein genau definiertes genomisches Segment von <i>S. pennellii</i> beinhaltet, bestätigte diese enorme Variation mit 889 metabolischen und 326 ertragsassozierten-Veränderungen in den ILs. Die metabolischen Veränderungen zeichneten sich durch abnehmende bzw. steigende Gehalte von einzelnen Metaboliten, aber auch durch eine koordinierte Änderung aus. In dieser Arbeit wurde weiterhin der Biosyntheseweg der Volatilenstoffe Phenylethanol und Phenylacetaldehyd mit Hilfe einer IL untersucht. Hierbei konnten durch stabile Isotopenmarkierung und eines „reverse genetics“-Ansatzes Gene bzw. Enzyme identifiziert werden, die für die Dekarboxylierung des Eduktes Phenylalanin verantwortlich sind. Diese Arbeit beschreibt erstmals die umfassende Analyse von biochemischen Komponenten auf Genombasis in Tomatenintrogressionslinien und zeigt damit ein Werkzeug auf zur Identifizierung von qualitativen biochemischen Merkmalen in der modernen molekularen Züchtung.

No description available.

L'amélioration de la qualité du fruit de tomate dépend largement de la variation génétique. A la suite de la domestication et de la sélection moderne, la diversité moléculaire chez la tomate a été profondément réduite, limitant les possibilités d'amélioration. De nouveaux marqueurs moléculaires révélant les polymorphismes nucléotidiques (SNP) constituent des outils précieux pour saturer les cartes génétiques et identifier des QTL (quantitative trait loci) et des associations chez une espèce peu polymorphe comme la tomate. Les objectifs de cette étude étaient de caractériser la diversité génétique de la tomate au niveau moléculaire et de tenter d'identifier des QTL, des gènes et des protéines responsables de la variation de caractères de qualité du fruit. Pour cela, trois études indépendantes ont conduit à (1) la découverte de nouveaux marqueurs SNP, (2) leur utilisation en génétique d'association et (3) l'analyse de la diversité du protéome en relation avec des caractères physiologiques du fruit.Dans la première étude, nous avons comparé deux plateformes de reséquençage pour reséquencer des zones ciblées couvrant environ 0.2% du génome de deux accessions contrastées. Plus de 3000 SNP sont été identifiés. Nous avons ensuite validé 64 SNPs en développant des marqueurs CAPS. Nous avons ainsi montré l'intérêt des techniques de reséquençage pour la découverte de SNP chez la tomate et produit des marqueurs simples qui peuvent être utiles pour caractériser de nouvelles ressources.Nous avons ensuite développé un ensemble de 192 SNPs et génotypé une collection de 188 accessions comportant des accessions cultivées, des types "cerise" et des formes sauvages apparentées et recherché des associations avec 10 caractères de qualité du fruit. Une quarantaine d'associations a été détectée dans des régions où des QTL avaient été préalablement identifiés. D'autres associations ont été identifiées dans de nouvelles régions. Nous avons ainsi confirmé le potentiel de la génétique d'association pour la découverte de QTL chez la tomate. Finalement une approche combinant l'analyse du protéome, du métabolome et de traits phénotypiques a été mise en oeuvre pour étudier la variabilité naturelle de la qualité du fruit de huit lignées contrastées et de quatre de leurs hybrides, à deux stades de développement (expansion cellulaire et orange-rouge). Nous avons identifié 424 spots protéiques variables en combinant électrophorèse bidimensionnelle et nano LC MS/MS et construit une carte de référence du protéome de fruit de tomate. En parallèle, nous avons mesuré la variation de teneurs en 34 métabolites, les activités de 26 enzymes et cinq caractères phénotypiques. La variabilité génétique et les modes d'hérédité ont été décrits. L'intégration des données a été réalisée par construction de réseaux de corrélations et régression sPLS. Plusieurs associations ont été détectées intra et inter niveau d'expression, permettant une meilleure compréhension de la variation de la qualité des fruits de tomate