Submitted by Maria Beatriz Vieira (mbeatriz.vieira@gmail.com) on 2017-03-29T13:15:52Z No. of bitstreams: 2 license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5) dissertacao_vania_marques_gehling.pdf: 823705 bytes, checksum: bb9a04c4074928df8353da917cbc35a4 (MD5) / Approved for entry into archive by Aline Batista (alinehb.ufpel@gmail.com) on 2017-04-05T17:44:43Z (GMT) No. of bitstreams: 2 dissertacao_vania_marques_gehling.pdf: 823705 bytes, checksum: bb9a04c4074928df8353da917cbc35a4 (MD5) license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5) / Approved for entry into archive by Aline Batista (alinehb.ufpel@gmail.com) on 2017-04-05T17:45:44Z (GMT) No. of bitstreams: 2 dissertacao_vania_marques_gehling.pdf: 823705 bytes, checksum: bb9a04c4074928df8353da917cbc35a4 (MD5) license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5) / Made available in DSpace on 2017-04-05T17:45:54Z (GMT). No. of bitstreams: 2 dissertacao_vania_marques_gehling.pdf: 823705 bytes, checksum: bb9a04c4074928df8353da917cbc35a4 (MD5) license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5) Previous issue date: 2015-09-03 / Sem bolsa / O objetivo deste trabalho foi avaliar o desempenho fisiológico de sementes e plântulas de pimenta e de tomateiro sob influência de diferentes temperaturas. Foram conduzidos, separadamente, dois experimentos no Laboratório Didático de Análise de Sementes – FAEM - UFPel. No primeiro experimento foram utilizadas sementes de pimenta Cayenne Long Slim®, e no segundo experimento foram empregadas sementes de tomateiro Gaúcho®. Em ambos os experimentos, os tratamentos consistiram de temperaturas constantes, sendo: 18; 20; 22; 24 e 26ºC. Para a determinação do desempenho fisiológico das sementes e plântulas foram empregadas as avaliações de germinação, primeira contagem de germinação, índice de velocidade de germinação, envelhecimento acelerado, teste de frio, comprimento de parte aérea e de raiz primária, massa da matéria seca de parte aérea e de raízes, emergência de plântulas aos 14 e 21 dias após a semeadura e índice de velocidade de emergência. Os resultados demonstraram que a germinação de sementes de pimenta não é afetada de maneira marcante pelas temperaturas de 18 a 24oC, assim como sementes de tomateiro sob temperatura de 18 a 26oC, que não apresentaram diferença significativa na germinação. A primeira contagem de germinação, o índice de velocidade de germinação e os valores de envelhecimento acelerado foram incrementados linearmente com o aumento da temperatura, em pimenta e tomateiro. Todavia, o teste de frio e de emergência, tanto aos 14 como aos 21 dias após a semeadura, foram influenciados positivamente, até a temperatura aproximada de 22ºC, para ambas as culturas. Deste modo, a expressão do vigor de sementes, de ambas as espécies, é afetada negativamente pela redução da temperatura de desenvolvimento, sendo resultados marcantes obtidos nas temperaturas de 18 e 20oC. / The objective of this study was to evaluate the physiological performance of seeds and pepper and tomato seedlings under the influence of different temperatures. They were conducted separately in two experiments in the Didactic Laboratory of Seed Analysis - FAEM - UFPel. In the first experiment pepper seeds were used Cayenne Long Slim®, and in the second experiment Gaúcho® tomato seeds were employed. In both experiments, the treatments consisted of constant temperatures, as follows: 18; 20; 22; 24 and 26ºC. To determine the physiological performance of the seeds and seedlings were employed germination assessments, first count, germination speed index, accelerated aging, cold test, shoot length and primary root mass of dry matter air and root, seedling emergence at 14 and 21 days after sowing and emergence speed index. The results show that the pepper seed germination is not affected markedly by the temperature from 18 to 24ºC, as well as tomato seeds at a temperature of 18 to 26ºC, which showed no significant difference in germination. The first count, germination speed index and the accelerated aging values were increased linearly with increasing temperature in pepper and tomato. However, the cold test and emergency, both at 14 and at 21 days after sowing, were influenced positively to the approximate temperature of 22°C, for both crops. Thus, the expression of seed vigor of both species is adversely affected by reducing the growth temperature, with remarkable results obtained at temperatures of 18 to 20ºC.

Submitted by (ana.araujo@ufrpe.br) on 2017-02-07T16:48:16Z No. of bitstreams: 1 Daniel Oliveira Jordao do Amaral.pdf: 1158857 bytes, checksum: e7a95fb82b8780bf1c190ef328318925 (MD5) / Made available in DSpace on 2017-02-07T16:48:16Z (GMT). No. of bitstreams: 1 Daniel Oliveira Jordao do Amaral.pdf: 1158857 bytes, checksum: e7a95fb82b8780bf1c190ef328318925 (MD5) Previous issue date: 2007-06-14 / To identify tomato plant (Lycopersicon esculentum Mill), cv. BRH, genes which answer to plant pathogen Fusarium oxysporum f. sp. lycopersici and salicylic acid, the carrier molecule for activation of responses of plant defense, it was used the suppression subtractive hybridization (SSH) technique, from leaf cDNAs, 24h after salicylic acid, library denominated AS, and root cDNA, 72h after inoculation with F. oxysporum f. sp. lycopersici, incompatible interaction, library denominated FO. This work represents the first report of global gene expression of tomato plant induced by salicylic acid and F. oxysporum f. sp. lycopersici, using SSH technique; it was identified a total of 307 clones in the two subtractive libraries, being 143 obtained in the AS library and 164 in the FO library. Probable functions for genes were obtained by sequencing of clones and subsequent homology research at datas. These isolated genes are involved in several processes related to resistance against plant pathogen such as: hypersensitive response, programmed cell death, synthesis and transport of antimicrobial metabolites, signal perception and transduction, synthesis of pathogenesis-related proteins, lipid metabolism and selective degradation of proteins. It was identified in FO library a higher number of defense-related genes (26%) than in AS library (24%). In relation to the number of genes encoding antimicrobial proteins, they were only found in FO library (7%). However, genes involved in secondary compound metabolism were higher in AS library (13%) in relation to FO library (4%). These genes related to controlled degradation of proteins were also higher in AS library (3%) than in FO library (1%). The results suggest that the resistance of tomato plant induced by salicylic acid and by plant pathogen occur by distinct mechanisms. / Com o propósito de identificar genes no tomateiro (Lycopersicon esculentum Mill), cv. BRH, que respondem ao fitopatógeno Fusarium oxysporum f. sp. lycopersici e ao ácido salicílico, molécula mensageira na ativação de resposta de defesa em plantas, foi utilizada a técnica de hibridização subtrativa por supressão (HSS), a partir de cDNAs de folhas, 24h após o tratamento com ácido salicílico, biblioteca denominada (AS), e cDNAs de raízes, 72h após a inoculação com Fusarium oxysporum f. sp. lycopersici, interação incompatível, biblioteca denominada (FO). Esse trabalho representa o primeiro relato da expressão gênica global no tomateiro induzido pelo ácido salicílico e pelo F. oxysporum f. sp. lycopersici, utilizando a técnica HSS. Foram identificados um total de 307 clones nas duas bibliotecas subtraídas, sendo 143 clones obtidos na biblioteca (AS) e 164 clones na biblioteca FO. As prováveis funções dos genes foram obtidas pelo sequenciamento dos clones e subseqüente pesquisa de homologia em bancos de dados. Os genes encontrados estão envolvidos em diversos processos relacionados à resistência contra fitopatógenos como: resposta de hipersensibilidade, morte celular programada, síntese e transporte de metabólicos antimicrobianos, percepção e transdução de sinal, síntese de proteínas relacionadas à patogênese, metabolismo de lipídeos e degradação controlada de proteínas. Foram identificados na biblioteca FO um número maior de genes implicados em mecanismos de defesa (26%), do que na biblioteca AS (24%). Em relação ao número de genes codificadores de proteínas antimicrobianas foram encontrados apenas na biblioteca FO (7%). Entretanto, os genes envolvidos no metabolismo de compostos secundários foi maior na biblioteca AS (13%) em relação a biblioteca FO (4%). Os genes relacionados a degradação controlada de proteínas também foi maior na biblioteca AS (3%) do que na biblioteca FO (1%). Os resultados obtidos sugerem que a resistência no tomateiro induzido pelo ácido salicílico e pelo patógeno ocorre por mecanismos distintos.

L’amélioration de la qualité du fruit de tomate dépend largement de la variation génétique. A la suite de la domestication et de la sélection moderne, la diversité moléculaire chez la tomate a été profondément réduite, limitant les possibilités d’amélioration. De nouveaux marqueurs moléculaires révélant les polymorphismes nucléotidiques (SNP) constituent des outils précieux pour saturer les cartes génétiques et identifier des QTL (quantitative trait loci) et des associations chez une espèce peu polymorphe comme la tomate. Les objectifs de cette étude étaient de caractériser la diversité génétique de la tomate au niveau moléculaire et de tenter d’identifier des QTL, des gènes et des protéines responsables de la variation de caractères de qualité du fruit. Pour cela, trois études indépendantes ont conduit à (1) la découverte de nouveaux marqueurs SNP, (2) leur utilisation en génétique d’association et (3) l’analyse de la diversité du protéome en relation avec des caractères physiologiques du fruit.Dans la première étude, nous avons comparé deux plateformes de reséquençage pour reséquencer des zones ciblées couvrant environ 0.2% du génome de deux accessions contrastées. Plus de 3000 SNP sont été identifiés. Nous avons ensuite validé 64 SNPs en développant des marqueurs CAPS. Nous avons ainsi montré l’intérêt des techniques de reséquençage pour la découverte de SNP chez la tomate et produit des marqueurs simples qui peuvent être utiles pour caractériser de nouvelles ressources.Nous avons ensuite développé un ensemble de 192 SNPs et génotypé une collection de 188 accessions comportant des accessions cultivées, des types “cerise” et des formes sauvages apparentées et recherché des associations avec 10 caractères de qualité du fruit. Une quarantaine d’associations a été détectée dans des régions où des QTL avaient été préalablement identifiés. D’autres associations ont été identifiées dans de nouvelles régions. Nous avons ainsi confirmé le potentiel de la génétique d’association pour la découverte de QTL chez la tomate. Finalement une approche combinant l’analyse du protéome, du métabolome et de traits phénotypiques a été mise en oeuvre pour étudier la variabilité naturelle de la qualité du fruit de huit lignées contrastées et de quatre de leurs hybrides, à deux stades de développement (expansion cellulaire et orange-rouge). Nous avons identifié 424 spots protéiques variables en combinant électrophorèse bidimensionnelle et nano LC MS/MS et construit une carte de référence du protéome de fruit de tomate. En parallèle, nous avons mesuré la variation de teneurs en 34 métabolites, les activités de 26 enzymes et cinq caractères phénotypiques. La variabilité génétique et les modes d’hérédité ont été décrits. L’intégration des données a été réalisée par construction de réseaux de corrélations et régression sPLS. Plusieurs associations ont été détectées intra et inter niveau d’expression, permettant une meilleure compréhension de la variation de la qualité des fruits de tomate / Fruit quality in tomato is highly dependent on genetic variation. Following domestication and modernbreeding, molecular diversity of tomato has been strongly reduced, limiting the possibility to improvetraits of interest. New molecular markers such as single nucleotide polymorphisms (SNP) constituteprecious tools to saturate tomato genetic maps and identify quantitative trait loci (QTL) andassociations in a poorly polymorphic species like tomato. The objectives of this study were tocharacterize tomato genetic diversity at the molecular levels and to try to identify QTLs, genes andproteins responsible for fruit quality traits in tomato. For this purpose, three independent studies wereconducted leading to the discovery of new SNP markers, their use for association study and finally theanalysis of proteome diversity in relation to physiological phenotypes. We first used two nextgenrationsequencing platforms (GA2 Illumina and 454 Roche) to re-sequence targeted sequencescovering about 0.2% of the tomato genome from two contrasted accessions. More than 3000 SNPswere identified between the two accessions. We then validated 64 SNPs by developing CAPS markers.We thus showed the value of NGS for the discovery of SNPs in tomato and we produced low costCAPS markers which could be used to characterize other tomato collections. A SNPlexTM arraycarrying 192 SNPs was then developed and used to genotype a broad collection of 188 accessionsincluding cultivated, cherry type and wild tomato species and to associate these polymorphisms to tenfruit quality traits using association mapping approach. A total of 40 associations were detected andco-localized with previously mapped QTLs. Some other associations were identified in new regions.We showed the potential of using association genetics in tomato. Finally, a new analytical approachcombining proteome, metabolome and phenotypic profiling were applied to study natural geneticvariation of fruit quality traits in eight diverse accessions and their four corresponding F1s at cellexpansion and orange-red stages. We identified 424 variable spots by combining 2-DE and nano LCMS/MS and built the first comprehensive proteome reference map of the tomato fruit pericarp at twodevelopmental stages from the 12 genotypes. In parallel, we measured the variation of 34 metabolites,26 enzyme activities and five phenotypic traits. A large range of variability and several inheritancemodes were described in the four groups of traits. Data integration was achieved through sPLS andcorrelation networks. Many significant associations were detected within level and between levels ofexpression. This systems biology approach provides better understanding of networks of elements(proteins, enzymes, metabolites and phenotypic traits) in tomato fruits

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5’ AATTAGGTTCTTGAAGCCCATCT 3’; R = 5’ TTCCGCATCAGCCAATAGTGT 3’). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

A produção de hortaliças em substratos é uma técnica de cultivo que pode aumentar a produtividade, economizar recursos e facilitar o manejo nutricional das plantas. Contudo, para que isso seja possível, deve-se conhecer os fatores que afetam o crescimento das plantas cultivadas nesse sistema. O objetivo deste trabalho foi avaliar os efeitos de diferentes doses de nitrogênio da solução nutritiva (SN) (60, 80 100, 120 e 140% da dose padrão) em dois tipos de substratos (S1: fibra de coco e S2: a base de casca de pinus) no cultivo de minitomate Sweet Grape. Foram avaliadas ao longo do ciclo de cultivo o pH, a condutividade elétrica (CE) e o teor de nitrato (NO3-drenado) e potássio (K+drenado) na solução drenada dos vasos, o índice SPAD e o teor de nitrato (NO3- pecíolo) e potássio (K+ pecíolo) da seiva do pecíolo das folhas e o teor de nitrogênio da massa seca das folhas (Nfolha). Foram determinados o número de cacho por planta (NCPP) e o comprimento médio das hastes (CMH). Os frutos colhidos foram classificados, contados e pesados para a obtenção da massa média dos frutos grandes (MMFG), médios (MMFM) e pequenos (MMFP), massa total de frutos por planta (MTFPP), massa total de frutos grandes (MTFG), médios (MTFM), pequenos (MTFP) e rachados (MTFRA), número total de frutos por planta (NTFPP), número total de frutos grandes (NTFG), médios (NTFM), pequenos (NTFP) e rachados (NTFRA). Amostras de frutos foram coletadas em três períodos e avaliadas quanto ao teor de sólidos solúveis (TSS), acidez titulável (AT) e concentração de ácido ascórbico (AA). Os valores de pHdrenado diminuíram com o aumento das doses de N da solução nutritiva. Os efeitos do N no pHdrenado se intensificaram ao longo do ciclo de cultivo em razão do acúmulo de sais no meio radicular, principalmente no S1. A CEdrenada aumentou com dose de N e foi maior no S2. O aumento da dose de N elevou os teores de NO3-drenado em ambos os substratos. O K+drenado foi superior na dose de 140% de N no S1. Os valores de índice SPAD e Nfolha aumentaram com a elevação das doses de N da solução nutritiva e reduziram ao longo do ciclo de cultivo. O NO3-pecíolo elevou com o aumento da dose de N da SN. A MMFG foi superior com a adição de 140% de N em relação à dose de 60%. O aumento da dose de N elevou o NTFG, NTFM, NTFP, NTRA e NTFPP. O maior NTFG foi obtido no S2 enquanto que o maior NTFPP, NTFP e NTFRA ocorreu no S1. A MTFG, MTFM, MTFP, MTFRA e MTFPP aumentaram com o aumento da dose de N. Os valores mais elevados de MTFG e MTFP foram obtidos na dose de 140% de N, 331,05 e 1.249,82 g planta-1, respectivamente. A maior MTFM foi obtida na dose de 120% de N, não diferindo, porém, das doses de 100 e 140% de N. O TSS, a AT e o AA dos frutos não foram influenciados pelas doses de N e tipos de substrato. / Vegetables production in soilless media is a technique that can increase yield, saving resources and facilitate the nutritional management of plants. However, for that to be possible, its necessary to know how the factors affect the plants growth in this system. The aim of this study was to evaluate the effects of different nitrogen rates of nutrient solution (NS) (60, 80 100, 120 and 140% of the standard) in two type of soilless media (S1: coconut fiber and S2: pine bark as base) for the mini tomato Sweet Grape growth. Were evaluated during the growing season pH, electrical conductivity (EC) and the nitrate content (NO3-drained) and potassium (K+ drained) in the solution drained from the vessels, SPAD index and the nitrate (NO3-pecíolo) and potassium (K+ petiole) content on petiole sap from the leaves and the nitrogen content in leaf dry mater (Nleaf). Were determined the number of fruit per plant (NFPP) and the average length of stems (ALS). The harvested fruits were sorted, counted and weighed to obtain the average mass of large fruits (AMLF), medium fruits (AMMF) and small fruits (AMSF), total weight of fruits per plant (TWFPP), total weight of large fruits (TWLF) medium fruits (TWMF), small fruits (TWSF) and cracked fruits (TWCF), total number of fruits per plant (TNFPP), total number of large fruits (TNLF), medium fruits (TNMF), small frutis (TNSF) and cracked fruits (TNCF). Fruit samples were collected in three periods and evaluated for soluble solids (SS), titratable acidity (TA) and concentration of ascorbic acid (AA). The pHdrained values decreased with increasing N levels in nutrient solution. The effects of N on pHdrained intensified throughout the growing season due to the accumulation of salts in the root medium, especially in S1. The CEdrained increased with N rate and was higher in S2. The increase in N rate increased the levels of NO3-drained on both substrates. The K+ drained was higher at 140% N dose in S1. SPAD index and Nleaf values increased with higher N rates in nutrient solution and reduced throughout the growing season. The NO3 - petiole increased with increasing dose of N in NS. The MMFG was higher with the addition of 140% N in relation to the dose of 60%. The increase in N rate increased the TNLF, TNMF, TNSF, TNCF and TNFPP. The biggest TNLF was obtained in S2 while the largest TNFPP, TNSF and TNCF occurred in S1. The TWLF, TWMF, TWSF, TWCF and TWFPP increased with increasing N levels in NS. The highest values of TWLF and TWSF were obtained at 140% N level, 331.05 and 1249.82 g plant-1, respectively. The biggest TWMF was obtained at 120% N level in NS, however, not differing of the 100 and 140% N levels. The SS, TA and AA fruits were not influenced by N and substrate types.

Muitas plantas apresentam crescimento indeterminado e são capazes de produzir novos órgãos e tecidos ao longo de todo seu ciclo de vida. Essa capacidade é devida parcialmente à expressão altamente regulada de genes específicos, tais como os genes SQUAMOSA Promoter-Binding Protein-Like (SPLs). SPLs codificam fatores de transcrição específicos de plantas que desempenham papéis importantes em diferentes aspectos do desenvolvimento, tais como mudança de fase juvenil-adulto, definição da arquitetura da planta e amadurecimento do fruto. A maioria dos genes SPLs são pós-transcricionalmente regulados pelo microRNA (miRNA) miR156. Apesar de alguns aspectos regulados pelas SPLs serem bem estudados, suas funções moleculares durante o desenvolvimento do fruto são pouco compreendidas. Neste trabalho, nós geramos 22 eventos transgênicos de Solanum lycopersicum cv. Micro-Tom (MT) superexpressando o precursor AtMIR156b. Plantas transgênicas exibiram morfologia foliar e floral anormal além de alteração na arquitetura vegetal. Interessantemente, a maioria dos eventos apresentou frutos de crescimento indeterminado, os quais não apresentam sementes sendo caracterizados pelo crescimento de frutos secundários além da presença de estruturas vegetativas e meristemas florais ectópicos. Fazendo uso da técnica de RT-qPCR, nós encontramos uma robusta correlação entre expressão do miR156 e o fenótipo dos frutos, sugerindo que esta rota regula o desenvolvimento e determinação do fruto de tomateiro. O mutante de tomateiro Mouse ears (Me) apresenta um fraco nível de indeterminação no fruto, sendo que os níveis do transcrito miR156 maduro são maiores no fruto mutante quando comparado aos controles MT, mas significativamente menores que nos frutos transgênicos. Oito SPLs de tomateiro foram silenciadas em diferentes níveis em frutos de diferentes eventos transgênicos e no mutante Me. O fator de transcrição do tipo MADS-box MACROCALYX (MC), o qual é ortólogo ao gene APETALA1 (AP1) de arabidopsis (alvo direto in vivo da proteína SPL3), afeta a determinação da inflorescência e o desenvolvimento das sépalas. A expressão de MC foi severamente reduzida nos frutos dos eventos transgênicos, mas não no mutante Me. Este dado sugere que a desregulação da expressão de MC deve ser responsável pelo forte fenótipo de indeterminação do fruto observados nos eventos transgênicos. Tomados em conjunto, nossos dados sugerem uma nova função para a via genética mir156/SPL na regulação do desenvolvimento e determinação de frutos carnosos, provavelmente através da regulação da expressão de MC. / Many plants have indeterminate growth and are capable of producing new organs and tissues throughout their life. This capability is partially due to the highly regulated expression of specific genes such as SQUAMOSA Promoter-Binding Protein-Like (SPL) genes. SPLs encode plant-specific transcription factors that play important roles in development, such as phase transition, plant architecture, and fruit ripening. Most SPL genes are post-transcriptionally regulated by the microRNA (miRNA) miR156. Although some developmental aspects regulated by SPLs have been well studied, their molecular roles during fruit development are poorly understood. In this work, we generated 22 transgenic events of Solanum lycopersicum cv. Micro-Tom (MT) overexpressing AtMIR156b precursor. Transgenic plants exhibit abnormal leaf and flower morphology and altered vegetative architecture. Interestingly, most events display navel-like fruits that are seedless and characterized by the growth of secondary fruits and present leaf-like structures as well as ectopic flowering meristems. By using RT-qPCR, we found a robust correlation between miR156/SPL expression and the fruit phenotype, suggesting that this pathway regulates tomato fruit development and determinacy. The tomato mutant Mouse ears (Me) displays a weak level of fruit indeterminacy. Levels of mature miR156 transcripts are higher in fruits from the mutant as comparing to MT fruits, but significantly lower than in transgenic fruits. Eight tomato SPLs were downregulated at variable levels in fruits from distinct transgenic events and Me plants. The MADS-type of transcription factor Macrocalyx (MC) gene is an orthologue of Arabidopsis AP1 (a direct in vivo target of SPL3) and affects tomato inflorescence determinacy and sepal development. MC was severely downregulated in fruits from transgenics but not in fruits from Me mutant. This data suggests that the MC misregulation may lead to the strong fruit indeterminacy phenotype observed in the transgenic events. Taken together, our data suggest a new function for miR156/SPL pathway in regulating fruit development and determinacy likely through the regulation of MC expression.

Made available in DSpace on 2016-04-28T14:59:00Z (GMT). No. of bitstreams: 1 2008 - Debora Alves Gonzaga da Silva1.pdf: 485199 bytes, checksum: 8ad8d9c6be0e3c6fca263c141e2866c3 (MD5) Previous issue date: 2008-09-26 / Coordena??o de Aperfei?oamento de Pessoal de N?vel Superior / In the objective of advancing the epidemiologic study of the bacterial stain of the tomato, the mechanisms of transmission of Xanthomonas vesicatoria from the plant to the seed and from the seed to the plant have been evaluated. The morphology of seeds and of parts of the seedlings or saplings (tegument, radicles, hypocotyl and cotyledon leaves, and definitive leaves) have also been studied by means of electronic scanning microscopy techniques. The transmission of X. vesicatoria from the plant to the seed has been evaluated upon direct and indirect isolation of parts of ripe fruit (flesh, placenta, placental liquid, water from the first washing of the seeds, entire seeds and ground seeds) in a culture of Agar Nutrient (AN). The fruit were obtained in experimental parcels, conducted at the Horticultural sector of UFRRJ, and inoculated with the phytobacteria through different methods (atomization and injection) combined with different regions of inoculation (flower cluster, flesh, and placenta), during the plant s developing phases (flower, unripened fruit, firm ripe and ripe fruit). The transmission of the phytobacteria from the seeds to the seedlings and saplings was assessed by means of isolating in an AN medium parts of the seedling or sapling (root, tegument, radicles, hypocotyl and cotyledon leaves, and definitive leaves), germinated in different substrata ( germitest paper, sand, and commercialized substrate for saplings). The morphology of seeds and parts of the seedlings was characterized through observations in electron microscope scanning by using samples of fresh seeds (extracted from inoculated fruit), of parts of seedlings or saplings (tegument, radicles, hypocotyl and cotyledon leaves, and definitive leaves) and of seeds inoculated by vacuum procedure at 7, 14, and 21 days after sowing. The treatments applied to the unripened fruit (inoculation by atomization, injection in the placenta and injection in the flesh) were more efficient in the process of transmitting the phytobacteria than the treatment applied to the firm ripe and ripe fruit. It was also observed that the X vesicatoria colonizes the tegument and every part of the seedlings and saplings during the process of germination and emergence. The seed tegument was characterized by an entanglement of trichomes, with a base in the shape of ring and cavity, which may serve as sheltering sites for pathogens, including the X vesicatoria. The process of colonization of tomato seeds by X vesicatoria characterizes itself by the formation of biofilms and fibrils. The presence of stomata colonized by X vesicatoria has been observed in radicles, of seven day old seedlings, and in primary roots originated from the radicles of 20 day old saplings. Few cells of X vesicatoria have been observed on the hypocotyl. The presence of endophytic bacteria forming aggregates with characteristics of an aggressive growth identified as Acinetobacter sp. was detected in many samples of seeds. These same bacteria were detected in many tests of germination and isolation, interfering negatively in the development and recuperation of X vesicatoria in the in vitro tests. / Com o objetivo de se avan?ar no estudo epidemiol?gico da mancha-bacteriana do tomateiro, foram avaliados os mecanismos de transmiss?o de Xanthomonas vesicatoria da planta para a semente e da semente para a planta. Foram feitos, ainda, estudos da morfologia da semente e partes da pl?ntula ou muda (tegumento, rad?cula, hipoc?tilo e folhas cotiledonares e definitivas), atrav?s de t?cnicas de microscopia eletr?nica de varredura. A transmiss?o de X. vesicatoria da planta para a semente foi avaliada a partir de isolamentos diretos e indiretos de partes de frutos maduros (mesocarpo, placenta, l?quido placent?rio, ?gua proveniente da primeira lavagem das sementes, sementes inteiras e sementes trituradas) em meio de cultura Nutriente Agar (NA). Os frutos foram obtidos em parcelas experimentais, conduzidas no setor de Horticultura da UFRRJ, e inoculados com a fitobact?ria por diferentes m?todos (atomiza??o e inje??o) combinados com diferentes regi?es de inocula??o (cacho floral, mesocarpo e placenta), durante as fases de desenvolvimento da planta (flor, frutos verdes, frutos de vez e frutos maduros). A transmiss?o da fitobact?ria das sementes para as pl?ntulas e mudas foi avaliada por isolamentos em meio NA a partir de partes da pl?ntula ou muda (raiz, tegumento, hipoc?tilo, folhas cotiledonares e folhas definitivas), germinadas em diferentes substratos (papel germitest, areia e substrato comercial para mudas). A morfologia das sementes e partes das pl?ntulas foi caracterizada por meio de observa??es em microsc?pio eletr?nico de varredura utilizando-se amostras de sementes frescas (extra?das de frutos inoculados), de partes de pl?ntulas ou mudas (raiz, hipoc?tilo, folha cotiledonar e folha definitiva) e de sementes inoculadas pelo procedimento a v?cuo aos 7, 14 e 21 dias ap?s a semeadura. Os tratamentos aplicados aos frutos verdes (inocula??o por atomiza??o, inje??o na placenta e inje??o no mesocarpo) foram mais eficientes no processo de transmiss?o da fitobact?ria que os tratamentos aplicados aos frutos de vez e maduros. Observou-se, ainda, que X. vesicatoria coloniza o tegumento e todas as partes das pl?ntulas e mudas durante o processo de germina??o e emerg?ncia. O tegumento da semente foi caracterizado por um emaranhado de tricomas, com a base em forma de anel e cavidade, que podem servir como s?tios protetores para pat?genos inclusive X. vesicatoria. O processo de coloniza??o das sementes de tomate por X. vesicatoria se caracteriza pela forma??o de biofilmes e fibrilas. Foram observados em rad?culas, de pl?ntulas com sete dias de idade, e em ra?zes prim?rias, oriundas das rad?culas de mudas com 20 dias de idade, a presen?a de est?matos colonizados por X. vesicatoria. Sobre o hipoc?tilo, foram observadas poucas c?lulas de X. vesicatoria. Em v?rias amostras de sementes foi detectada a presen?a de bact?rias endof?ticas, que formavam agregados com caracter?sticas de crescimento agressivo, identificadas como Acinetobacter sp. Esta mesma bact?ria foi detectada em v?rios testes de germina??o e isolamento interferindo negativamente no desenvolvimento e recupera??o de X. vesicatoria nos testes in vitro.

Made available in DSpace on 2017-07-10T17:37:33Z (GMT). No. of bitstreams: 1 Marcia Vargas Toledo.pdf: 728769 bytes, checksum: 73f1b1501ca618c192074d64a04203ae (MD5) Previous issue date: 2009-06-29 / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior / The tomato (Lycopersicon esculentum Mill) is the second most consumed vegetable in Brazil. The early blight disease, caused by the fungus Alternaria solani is one of the most important disease of this culture. The control is usually done with fungicides that can cause the production of fruits contaminated with pesticide. The use of homeopathy has been a practice for disease control, and an alternative to reduce these chemical drugs. The objective of this study was to evaluate the fungitoxic activity against A. solani, the disease control of early blight and the effect on plant growth of tomato.of homeopathic drugs Propolis, Isotherapic of A. solani and Isotherapic of ash in at dinamizations 6, 12, 30 and 60CH, and Sulphur, Silicea terra, Staphysagria, Phosphorus, Ferrum sulphuricum and Kali iodatum at dinamizations 6, 12, 30 and 100CH. In vitro assays was investigate the antimicrobial activity of the treatments on mycelial growth, sporulation and germination of spores of A. solani. The results indicated that Sulphur 100CH and Staphysagria 100CH reduced the mycelial growth compared with the control treatment wint distilled water and water-etanol solution. Propolis, 6, 30 and 60CH and Ferrum sulphuricum 6 and 30CH inhibited the sporulation, Isotherapic of A. solani in 6CH, Isotherapic of ash at 6CH, and Ferrum sulphuricum 6 and 30CH reduced the spores germination of A. solani. The data also indicated that the distilled water at 60 and 100CH reduced the mycelial growth. In the second phase, anassay was conducted in a greenhouse with Propolis, Sulphur and Ferrum sulphuricum. The work was carried out in pots, and at 19 days after transplanting of seedlings, the 6 ths. leaves were treated and 72 hours after the treatment, the 6ths. and 7ths. leaves were inoculated with A. solani. The severity were evaluated 7, 10, 14 and 16 days after inoculation and was calculated the area under the disease progress curve (AUDPC). Sulphur, 12 and 30 CH, Ferrum sulphuricum at 6, 12 and 30CH and Propolis in all dinamizations reduced the AUDPC of early blight. Sulphur 60CH and water-etanol solution 10% had systemic effect in the induction of resistance. Propolis at 30 and 60CH increased the amount of root, Ferrum sulphuricum 60CH and Sulphur in 30CH increased the root dry weight, while Propolis on 30 and 60CH, Ferrum sulphuricum in 6, 12, 30 and 60CH and Sulphur in all dinamizations increased the mass of the shoot. The results indicate that the homeopathic drugs tested have potential for control of early blight in the tomato, by direct actions on the pathogen and host. / O tomate (Lycopersicon esculentum Mill) é a segunda hortaliça mais consumida no Brasil. A doença pinta preta, causada pelo fungo Alternaria solani é uma das mais importantes. O tratamento normalmente é feito com fungicidas o que ocasiona a produção de frutos contaminados por resíduos de agrotóxicos. O uso da homeopatia tem sido uma prática relevante no controle de doenças, e uma alternativa para reduzir esses contaminantes. O objetivo deste trabalho foi avaliar a ação dos medicamentos homeopáticos Propolis, Isoterapico de A. solani e Isoterapico de cinza, nas dinamizações 6, 12, 30 e 60CH, e Sulphur, Silicea terra, Staphysagria, Phosphorus, Ferrum sulphuricum e Kali iodatum nas dinamizações 6, 12, 30 e 100CH, na atividade fungitóxica sobre A. solani, no controle da doença pinta preta, e no crescimento das plantas de tomate. Foi realizado ensaio in vitro visando investigar a atividade antimicrobiana dos tratamentos no crescimento micelial, esporulação e germinação de esporos de A. solani. Os resultados indicaram que Sulphur em 100CH e Staphysagria em 100CH reduziram o crescimento micelial comparando com os controles água destilada e solução hidroalcoólica. Na inibição da esporulação, Propolis em 6, 30 e 60CH e Ferrum sulphuricum em 6 e 30CH diferiram dos controles. Isoterapico de A. solani em 6CH, Isoterapico de cinza em 6CH e Ferrum sulphuricum em 6 e 30CH reduziram a germinação de esporos de A. solani. Os dados indicaram também que a água destilada, quando dinamizada em 60 e 100CH, reduziu o crescimento micelial. Na segunda fase, foi realizado ensaio em casa de vegetação com ambiente controlado com os medicamentos Propolis, Sulphur e Ferrum sulphuricum. O trabalho foi realizado em vasos e, aos 19 dias após o transplante das mudas, as 6ªs folhas foram tratadas e 72 horas após, as 6ªs e 7ªs folhas foram inoculadas com A. solani. Foram feitas avaliações da severidade com 7, 10, 14 e 16 dias após a inoculação e com os dados calculada a área abaixo da curva de progresso da doença (AACPD). Ao término foram avaliadas variáveis de crescimento. Sulphur em 12 e 30 CH, Ferrum sulphuricum em 6, 12 e 30CH e Propolis em todas as dinamizações reduziram a AACPD da pinta preta, Sulphur em 60CH e solução hidroalcóolica 10% apresentaram efeito sistêmico na indução de resistência. Propolis em 30 e 60CH incrementaram o volume de raiz, Ferrum sulphuricum em 60CH, Sulphur em 60CH e Propolis em 30CH incrementaram a massa seca da raiz, enquanto que Propolis em 30 e 60CH, Ferrum sulphuricum em 6, 12, 30 e 60CH e Sulphur em todas as dinamizações incrementaram a massa da parte aérea. Os resultados indicam que os medicamentos homeopáticos testados têm potencial para controle de pinta preta no tomateiro, por ação direta no patógeno e no hospedeiro.

Paralelamente ao modelo Arabidopsis thaliana, o tomateiro (Lycopersicon esculentum) tem sido crescentemente utilizados em abordagens genéticas de questões fisiológicas. Uma das principais vantagens de Arabidopsis como "planta de laboratório" tem sido seu pequeno porte e ciclo de vida curto. Contudo, a cultivar Micro-Tom (MT) de tomateiro possui tamanho muito reduzido (8 cm) e pode produzir até 5 gerações por ano. Mutantes fotomorfogenéticos em tomateiro deficientes na síntese do cromóforo do fitocromo (au), mutantes deficientes na síntese das apoproteínas PHYA e PHYB1 (fri e tri, respectivamente) e mutantes superexpressando o fitocromo (hp, atv e Ip) constituem-se em um modelo para estudos da fotomorfogênese. No que se refere à capacidade de regeneração in vitro como uma resposta fotomorfogenética, poucos trabalhos têm sido realizados. O presente trabalho teve como objetivo transferir as mutações au, fri, tri, hp, Ip e atv, bem como o locus de regeneração (Rg1) da cultivar MsK, para a cultivar Micro-Tom. As linhagens obtidas foram utilizadas para verificar o efeito da fotomorfogênese na competência para regeneração in vitro. Para tanto, foram realizados tratamentos com luz branca, vermelho (V) e vermelho-extremo (VE) em explantes radiculares, caulinares e foliares do genótipo micro-MsK em meio MS mais 5mM de BAP e tratamentos com luz branca em explantes radiculares, caulinares e foliares de micro-mutantes fotomorfogenéticos também em meio MS mais 5mM de BAP. Para todos os tratamentos utilizou-se a cultivar MT como controle. Sob V, as raízes de micro-MsK apresentaram-se diferenciadas, enquanto sob VE não ocorreu diferenciação. O maior número de gemas formadas tanto para caule quanto para folhas de micro-MsK ocorreu sob V, enquanto sob VE foi observado um decréscimo na formação de gemas. A partir destes resultados sugere-se que a forma ativa do fitocromo, induzida pelo V, interage com o Rg1 na aquisição de competência para regeneração. Nos tratamentos com luz branca, raízes de micro-MsK e de mutantes micro-hp, micro-atv e micro-Ip apresentaram-se diferenciadas, enquanto não houve diferenciação para o mutante micro-au ou para o controle MT. O número de gemas formadas alcançou maiores valores para folhas de micro-hp e micro-Ip e a para caules de micro-atv. Apenas um número muito reduzido de gemas foi formado a partir de folhas de micro-au. Com base na alta competência para regeneração de micro-MsK e de mutantes que superexpressam o fitocromo, sugere-se que o fitocromo promove, em uma via de sinalização, a indução de fatores de regeneração (Rg1). Alternativamente, o locus Rg1 poderia promover a alta capacidade regenerativa tornando os explantes mais competentes ao efeito da superexpressão do fitocromo, o qual poderia induzir outros fatores de regeneração. / Parallel to Arabidopsis thaliana model, the tomato (Lycopersicon esculentum) has been increasingly used as a genetic approach to address physiological questions. One of the main advantages of Arabidopsis as a "laboratory plant" has been its small size and short life cycle. However, the tomato cultivar Micro-Tom (MT) possesses reduced size (8 cm) and can produce up to 5 generations per year. Tomato photomorphogenic mutants deficient for the synthesis of phytochrome chromophore (au) or the apoprotein PHYA and PHYB1 (fri and tri, respectively), as well as mutants superexpressing phytochrome (hp, atv and Ip) consist on a model to study photomorphogenesis. Concerning the in vitro regeneration capacity as a photomorphogenic response, fewer works have been carried through. The current work aimed at transfering the mutations au, fri, tri, hp, Ip and atv, as well as the regeneration locus (Rg1) of cv MsK to the cv Micro-Tom (MT). The genotypes obtained were used to verify the effect of photomorphogenesis on the competence for in vitro regeneration. Root, stem and leaf explants from MT and Micro-MsK were incubated in MS plus 5mM BAP under white, red (R) and far-red (FR) light. Root, stem and leaf explants from MT and photomorphogenic micro-mutants were incubated in MS plus 5mM BAP under white light. Under R, roots of micro-MsK were presented differentiation, while under FR the differentiation did not occur. Under R, stem explants from micro-MsK formed more shoots than did leaf explants, while under FR was observed a decrease in shoot formation for all types of explants. These results suggest that the active form of phytochrome, induced by R, interacts with the Rg1 in the acquisition of competence for regeneration. In the treatments with white light, roots of micro-MsK and of mutants micro-hp, micro-atv and micro-Ip presented differentiation, while no differentiation was observed for the mutant micron-au or control MT. The number of shoots formed reached the highest values for leaf explants of micro-hp and micro-Ip and for stem explants of micron -atv. Only a low number of shoots was formed from micro-au leaf explants. On the basis of the high competence for regeneration of micro-MsK and mutants that super express phytochrome, it is suggested that the phytochrome promotes, in a signaling pathway, the induction of regeneration factors ( Rg1 ). Alternatively, the Rg1 locus may turn the explant most competent to respond to phytochrome, which could induces others regeneration factors.

Muitas plantas apresentam crescimento indeterminado e são capazes de produzir novos órgãos e tecidos ao longo de todo seu ciclo de vida. Essa capacidade é devida parcialmente à expressão altamente regulada de genes específicos, tais como os genes SQUAMOSA Promoter-Binding Protein-Like (SPLs). SPLs codificam fatores de transcrição específicos de plantas que desempenham papéis importantes em diferentes aspectos do desenvolvimento, tais como mudança de fase juvenil-adulto, definição da arquitetura da planta e amadurecimento do fruto. A maioria dos genes SPLs são pós-transcricionalmente regulados pelo microRNA (miRNA) miR156. Apesar de alguns aspectos regulados pelas SPLs serem bem estudados, suas funções moleculares durante o desenvolvimento do fruto são pouco compreendidas. Neste trabalho, nós geramos 22 eventos transgênicos de Solanum lycopersicum cv. Micro-Tom (MT) superexpressando o precursor AtMIR156b. Plantas transgênicas exibiram morfologia foliar e floral anormal além de alteração na arquitetura vegetal. Interessantemente, a maioria dos eventos apresentou frutos de crescimento indeterminado, os quais não apresentam sementes sendo caracterizados pelo crescimento de frutos secundários além da presença de estruturas vegetativas e meristemas florais ectópicos. Fazendo uso da técnica de RT-qPCR, nós encontramos uma robusta correlação entre expressão do miR156 e o fenótipo dos frutos, sugerindo que esta rota regula o desenvolvimento e determinação do fruto de tomateiro. O mutante de tomateiro Mouse ears (Me) apresenta um fraco nível de indeterminação no fruto, sendo que os níveis do transcrito miR156 maduro são maiores no fruto mutante quando comparado aos controles MT, mas significativamente menores que nos frutos transgênicos. Oito SPLs de tomateiro foram silenciadas em diferentes níveis em frutos de diferentes eventos transgênicos e no mutante Me. O fator de transcrição do tipo MADS-box MACROCALYX (MC), o qual é ortólogo ao gene APETALA1 (AP1) de arabidopsis (alvo direto in vivo da proteína SPL3), afeta a determinação da inflorescência e o desenvolvimento das sépalas. A expressão de MC foi severamente reduzida nos frutos dos eventos transgênicos, mas não no mutante Me. Este dado sugere que a desregulação da expressão de MC deve ser responsável pelo forte fenótipo de indeterminação do fruto observados nos eventos transgênicos. Tomados em conjunto, nossos dados sugerem uma nova função para a via genética mir156/SPL na regulação do desenvolvimento e determinação de frutos carnosos, provavelmente através da regulação da expressão de MC. / Many plants have indeterminate growth and are capable of producing new organs and tissues throughout their life. This capability is partially due to the highly regulated expression of specific genes such as SQUAMOSA Promoter-Binding Protein-Like (SPL) genes. SPLs encode plant-specific transcription factors that play important roles in development, such as phase transition, plant architecture, and fruit ripening. Most SPL genes are post-transcriptionally regulated by the microRNA (miRNA) miR156. Although some developmental aspects regulated by SPLs have been well studied, their molecular roles during fruit development are poorly understood. In this work, we generated 22 transgenic events of Solanum lycopersicum cv. Micro-Tom (MT) overexpressing AtMIR156b precursor. Transgenic plants exhibit abnormal leaf and flower morphology and altered vegetative architecture. Interestingly, most events display navel-like fruits that are seedless and characterized by the growth of secondary fruits and present leaf-like structures as well as ectopic flowering meristems. By using RT-qPCR, we found a robust correlation between miR156/SPL expression and the fruit phenotype, suggesting that this pathway regulates tomato fruit development and determinacy. The tomato mutant Mouse ears (Me) displays a weak level of fruit indeterminacy. Levels of mature miR156 transcripts are higher in fruits from the mutant as comparing to MT fruits, but significantly lower than in transgenic fruits. Eight tomato SPLs were downregulated at variable levels in fruits from distinct transgenic events and Me plants. The MADS-type of transcription factor Macrocalyx (MC) gene is an orthologue of Arabidopsis AP1 (a direct in vivo target of SPL3) and affects tomato inflorescence determinacy and sepal development. MC was severely downregulated in fruits from transgenics but not in fruits from Me mutant. This data suggests that the MC misregulation may lead to the strong fruit indeterminacy phenotype observed in the transgenic events. Taken together, our data suggest a new function for miR156/SPL pathway in regulating fruit development and determinacy likely through the regulation of MC expression.