[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,&sup15N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.

Objetivo: O objetivo do presente estudo foi descrever a relação entre as concentrações plasmáticas totais e livres tumorais do etoposídeo (ETO) e a inibição do crescimento do tumor observada em ratos Wistar portadores de tumor Walker- 256 (W256) utilizando a modelagem farmacocinética/farmacodinâmica (PK/PD). Métodos: Os procedimentos com animais foram aprovados no CEUA/UFRGS sob o número 22302. Os experimentos de farmacocinética foram realizados para determinar concentrações plasmáticas e livres em duas regiões do tumor sólido W256 através de microdiálise. Após a administração do ETO nas doses de 10 ou 20 mg/kg i.v. bolus em ratos Wistar portadores de tumor W256, amostras de sangue e microdialisado de tecido do centro e periferia do tumor foram coletadas simultaneamente, até 7 h pós-dose, para determinar o fator de penetração no tumor. Um método analítico por CLAE-UV foi desenvolvido e validado para quantificação do etoposídeo nas amostras de plasma e dialisado. Os experimentos de farmacodinâmica foram conduzidos em ratos portadores de tumor W256 que receberam ETO 5 e 10 mg/kg i.v. bolus uma vez ao dia por 8 e 4 dias, respectivamente. O volume dos tumores foram monitorados diariamente durante 30 dias. Análise não-compartimental dos dados de PK foi realizada no WinNonlin®. A modelagem dos dados PK e PK/PD foi realizada no Monolix®, utilizando abordagem populacional. Os dados PK/PD foram analisados usando o modelo Simeoni TGI modificado através da introdução de uma função Emax para descrever a relação nãolinear entre a concentração plasmática e tumoral e o efeito. Resultados e Discussão: O método por CLAE-UV foi desenvolvido e validado para quantificar as amostras de ETO em plasma e tecido. A penetração do ETO no tumor foi maior na periferia (61 ± 15 % e 61 ± 29 %) do que no centro do tumor (34 ± 6 % e 28 ± 11 %) após administração das doses 10 e 20 mg/kg, respectivamente (ANOVA, α = 0.05). Um modelo de 4 compartimentos compreendendo uma distribuição saturável (cinética de Michaelis-Menten) nos compartimentos tumorais a partir do compartimento central modelou simultaneamente os perfis de concentração-tempo do ETO em plasma e em ambas regiões do tumor. O modelo populacional PK/PD Simeoni TGI–Emax foi capaz de descrever o efeito antitumoral dependente do regime de administração do ETO utilizando concentrações totais plasmáticas ou livres no tumor, resultando em um maior k2max (potência máxima) para as concentrações livres (25,8 mL.μg-1.dia-1 - intratumoral vs. 12,6 mL.μg-1.dia-1 - plasma total). Conclusões: Os resultados mostram que a utilização das concentrações livres do fármaco no tumor para a modelagem PK/PD pode fornecer um melhor entendimento da relação farmacocinética e farmacodinâmica e melhoram a capacidade de previsão do modelo, considerando que a eficácia dos fármacos antineoplásicos no tratamento de tumores sólidos é dependente da capacidade do fármaco em se distribuir no tecido tumoral. / Objective: The aim of this study was to describe the relationship between total plasma and free interstitial tumor etoposide (ETO) concentrations and the drug tumor growth inhibition observed in a Walker-256 (W256) tumor-bearing Wistar rat model using the pharmacokinetic/pharmacodynamic (PK/PD) modeling. Methods: The experiments with animals were approved by CEUA/UFRGS (protocol number 22302). Pharmacokinetic experiments were conducted to determine total plasma and free intratumoral concentrations in two regions of W256 solid tumor by microdialysis. After administration of ETO 10 or 20 mg/kg i.v. bolus to W256 tumorbearing Wistar rats, blood and tissue microdialysate samples from tumor center and periphery were simultaneously collected up to 7h to determine the tumor penetration factor. An analytical HPLC-UV method was developed and validated for quantification of ETO in plasma and microdialysate samples. The pharmacodynamic experiments were conducted in W256 tumor-bearing rats that received ETO 5 or 10 mg/kg i.v. bolus every day for 8 and 4 days, respectively. Tumor volumes were monitored daily for 30 days. Non-compartmental analysis of PK data was performed in WinNonlin®. The PK and PK/PD modeling by population approach were performed using Monolix®. PK/PD data were analyzed using a modification of Simeoni TGI model by introducing an Emax function to describe the nonlinear relationship between tumor and plasma concentrations and effect. Results and Discussion: The HLPCUV method was developed and validated to determine plasma and tissue samples of ETO. ETO tumor penetration was higher in the tumor periphery (61 ± 15 % and 61 ± 29 %) than center (34 ± 6 % and 28 ± 11 %) following 10 and 20 mg/kg doses, respectively (ANOVA, α = 0.05). A 4-compartment structural model comprising a saturable distribution (Michaelis-Menten kinetics) into the tumor compartments from the central compartment simultaneously described the ETO concentration–time profiles in plasma and both tumor regions. The PK/PD population Simeoni TGI–Emax model was capable of describing the schedule-dependent antitumor effects of ETO using total plasma or free tumor concentrations obtained in a W256-tumor bearing Wistar rat model, resulting in higher k2max (maximal potency) for free concentrations (25.8 mL.μg-1.day-1 - intratumoral vs. 12.6 mL.μg-1.day-1 total plasma). Conclusions: The results showed that the use of free intratumoral drug concentrations in the PK/PD modeling can provide a better understanding of the pharmacokinetics and pharmacodynamics relationship and improve the forecasting ability of the models considering that the efficacy of antineoplastic drugs in the treatment of solid tumors is dependent on the drug ability to distribute into the tumor.

La résistance aux agents chimiothérapeutiques (Multidrug Resistance ou MDR) est caractérisée par la surexpression de différentes protéines membranaires de type ABC, parmi lesquelles, MRP1 et ABCG2 sont largement impliquées. Ces transporteurs diminuent les concentrations intracellulaires des agents chimiothérapeutiques en augmentant leur efflux de la cellule cancéreuse. Dans le but de contrecarrer cette chimiorésistance, nous avons conçu, synthétisé et étudié des activateurs de MRP1 et des inhibiteurs d'ABCG2. Les activateurs de MRP1 sont des dérivés de flavonoïdes et de vérapamil. Ces activateurs sont capables d'induire un efflux rapide et massif de glutathion cellulaire via MRP1 qui entraîne l'apoptose des cellules cancéreuses. Nous avons également conçu et synthétisé de nouveaux composés, dérivés de chromone, inhibiteurs sélectifs d'ABCG2, afin de restaurer la sensibilité des cellules cancéreuses aux agents chimiothérapeutiques. Mots clés : MRP1, ABCG2, flavonoïdes, analogues de vérapamil, chromones, inhibiteurs, activateurs / Resistance to chemotherapeutic agents (Multidrug Resistance or MDR) is characterized by the overexpression of membrane ABC proteins, such as MRP1 and ABCG2. These transporters decrease intracellular concentrations of chemotherapeutic agents by increasing their efflux from the cancer cell. In order to find effective modulators of drug resistance, we have designed, synthesized and investigated MRP1 activators and ABCG2 inhibitors. We designed and synthesized new derivatives of flavonoids and verapamil as activators of MRP1. These activators are capable of inducing a rapid and massive efflux of intracellular glutathione via MRP1 and causing cells death by apoptosis. We have also designed and synthesized new compounds, derivatives of chromone, as selective inhibitors of ABCG2, to restore sensitivity of cancer cells to chemotherapeutic agents. The biological evaluation of investigated compounds enabled us to identify new activators of MRP1 as well as potent and selective inhibitors of ABCG2. Keywords: MRP1, ABCG2, flavonoids, verapamil analogs, chromone, inhibitors, activators

The aldehyde dehydrogenase (ALDH) superfamily is gaining momentum in regard to stem cell and cancer research. However, their regulation and expression in the cancer microenvironment is poorly understood. The aim of this work was to understand the role of selected ALDH isoforms (1A1, 1A2, 1A3, 1B1, 2, 3A1 and 7A1) in colorectal cancer (CRC) and explore the impact of hypoxia on their expression. CRC cell lines (HT29, DLD-1, SW480 and HCT116) were grown under normoxic or hypoxic conditions (0.1% O2) and HT29 and DLD-1 in spinner flasks to generate multicellular spheroids (MCS). Hypoxia was demonstrated to have an impact on the ALDH expression, which appeared cell-specific. Notably, ALDH7A1 was induced upon exposure to hypoxia in both HT29 and DLD-1 cells, shown to be expressed in the hypoxic region of the MCS variants and in 5/5 CRC xenografts (HT29, DLD-1, HCT116, SW620, and COLO205). ALDH7A1 siRNA knockdown studies in DLD-1 cells resulted in significant reduction of viable cells and significant increase in ROS levels, suggesting ALDH7A1 to possess antioxidant properties. These findings were further supported using isogenic H1299/RFP and H1299/ALDH7A1 lung cancer cell lines. ALDH7A1, however, was found not to be involved in inhibiting the pharmacological effect or causing resistance to different cytotoxic and molecularly targeted anticancer drugs. To unravel the functional role of ALDH7A1, 9 compounds obtained from a virtual screening of 24,000 compounds from the Maybridge collection of compounds were used to probe ALDH7A1 functional activity. One compound, HAN00316, was found to inhibit the antioxidant properties of ALDH7A1 and thus could be a good starting point for further chemical tool development. Although this study underpins a potential important role of ALDH7A1 in hypoxic CRC, further work is required to fully validate its potential as a biomarker and/or pharmacological target.

Seventeen novel osmium cymene complexes with O,O′- and P,P′-chelating ligands as well as N- and P-monodentate ligands are reported. The osmium cymene complexes were synthesised and characterised by spectroscopic techniques (NMR, IR and Raman), elemental analysis, thermal analysis, conductivity studies and X-ray crystallography. The molecular structures of complexes 1(b), 2, 4, 6, 7(a)-(d) and 11 in this study are reported. The cymene rings of these complexes show different conformations due to loss of planarity influenced by the ancillary ligands as a result of ML back bonding. Osmium cymene complexes of the type [Os(η6-p-cymene)BrL2]+ (where L2 = chelating P,P′ ligand) and binuclear [{Os(η6-p-cymene)Br2}2 L2] (where L2 = bridging P,P′ ligand) were evaluated for anticancer activity against renal, melanoma, breast and HeLa cancer cells. The chelated-diphosphine osmium cymene complexes exhibited significant anticancer activities relative to the bridged-diphosphine osmium analogues. A series of O,O′-chelated osmium complexes exhibited moderate and poor anticancer activities. / Chemistry / M. Sc. (Chemistry)

Made available in DSpace on 2015-08-19T13:52:56Z (GMT). No. of bitstreams: 2 1.pdf: 1168426 bytes, checksum: a22061c806f5a4d1b7ff70ad14ba1834 (MD5) license.txt: 1748 bytes, checksum: 8a4605be74aa9ea9d79846c1fba20a33 (MD5) Previous issue date: 2013 / Fundação Oswaldo Cruz. Instituto de Tecnologia em Fármacos/Farmanguinhos. Rio de Janeiro, RJ, Brasil. / O câncer é um distúrbio celular marcado por alterações no processo de duplicaçãodo DNA, resultando em proliferação celular alterada, de forma desordenada.Qualquer que seja a causa do câncer este é basicamente uma doença celular caracterizada por um desvio dos mecanismos de controle das células. O câncer é um importante problema de saúde pública em países em desenvolvimento e desenvolvidos, sendo responsável por mais de seis milhões de mortes a cada ano, o que respresenta cerca de 12% de todas as causas de morte em todo o mundo.Embora as maiores taxas de incidência de câncer sejam encontradas em países desenvolvidos, dos dez milhões de casos novos anuais de câncer, cinco milhões e meio são diagnosticados nos países em desenvolvimento. No Brasil as estimativas apontam que em 2011 ocorreram 489.270 novos casos de câncer. Os tipos mais incidentes, à exceção do câncer de pele não melanoma, foram os cânceres de próstata e de pulmão no sexo masculino e os cânceres de mama e do colo do útero no sexo feminino. Neste cenário, este trabalho tem como objetivo fazer um levantamento geral dos gastos públicos com medicamentos antineoplásicos, a fim de se avaliar a necessidade de fabricação nacional por um laboratório oficial dos medicamentos em questão, visando a redução dos gastos públicos, ampliação da assistência farmacêutica, elucidação dos medicamentos estratégicos, evitando assim o desabastecimento e identificação dos principais fármacos/medicamentos para serem incorporados a produção pública. Após levantamento mercadológico e avaliação das necessidades do SUS, foram selecionados quatorze medicamentos antineoplásicos para produção nacional por um laboratório oficial, são eles: hidroxiuréia, capecitabina, citrato de tamoxifeno, acetato de megestrol, clorambucila, ciclofosfamida, tioguanina, mesilato de imatinibe, mercaptopurina, anastrozol, cloridrato de erlotinibe, bicalutamida, melfalana e metotrexato. Através de levantamento mercadológico e das necessidades do SUS no fornecimento de medicamentos antineoplásicos, sugere-se que a fabricação nacional por um laboratório oficial de tais medicamentos, poderia suprir as necessidades do SUS, evitando assim o desabastecimento do mercado público nacional de medicamentos antineoplásicos, garantindo o acesso de tais medicamentos à população, além da consolidação dessas classes terapêuticas nos laboratórios oficiais. / Cancer is a disorder characterized by cellular changes in the process of DNA replication, resulting in altered cell proliferation, in a disorderly way. Whatever the cause of this cancer cell is primarily a disease characterized by a deviation of the control mechanisms of cells. Cancer is a major public health problem in developed and developing countries, accounting for more than six million deaths each year, which respresents about 12% of all causes of death worldwide. Although the highest incidence rates of cancer were found in developed countries, the ten million new cases of cancer annually, five and a half million a re diagnosed in developing countries. In Brazil, estimates that in 2011occured 489,270 new cases of cancer. The most incidents, with the exception of nonmelanoma skin cancer, was prostate cancers and lung cancer in males and breast and cervical cancer in females. In this scenario, this paper aims to make a general survey of public spending with anticancer drugs, in order to evaluate the need for national manufacturing by an official laboratory of the drugs in question, in order to reduce public spending, expansion of pharmaceutical care, elucidation of strategic drugs, avoiding the shortage and identification of drugs for incorporation in public production. After marketing survey and needs assessment of SUS, fourteen anticancer drugs were selected for national production by an official laboratory, they are: hydroxyurea, capecitabine, tamoxifen citrate, megestrol acetate, chlorambucil, cyclophosphamide, thioguanine, imatinib mesylate, mercaptopurine, anastrozole, erlotinib hydrochloride, bicalutamide, melphalan and methotrexate. Through marketing survey, as well as a needs assessment of SUS in delivering anticancer drugs, suggests that the national manufacturing by an official laboratory of such drugs could supply the needs of SUS, avoiding the shortage of public market of anticancer drugs, ensuring access to such medicines to the population, and the consolidation of these therapeutic classes in official laboratories.

Objetivo: O objetivo do presente estudo foi descrever a relação entre as concentrações plasmáticas totais e livres tumorais do etoposídeo (ETO) e a inibição do crescimento do tumor observada em ratos Wistar portadores de tumor Walker- 256 (W256) utilizando a modelagem farmacocinética/farmacodinâmica (PK/PD). Métodos: Os procedimentos com animais foram aprovados no CEUA/UFRGS sob o número 22302. Os experimentos de farmacocinética foram realizados para determinar concentrações plasmáticas e livres em duas regiões do tumor sólido W256 através de microdiálise. Após a administração do ETO nas doses de 10 ou 20 mg/kg i.v. bolus em ratos Wistar portadores de tumor W256, amostras de sangue e microdialisado de tecido do centro e periferia do tumor foram coletadas simultaneamente, até 7 h pós-dose, para determinar o fator de penetração no tumor. Um método analítico por CLAE-UV foi desenvolvido e validado para quantificação do etoposídeo nas amostras de plasma e dialisado. Os experimentos de farmacodinâmica foram conduzidos em ratos portadores de tumor W256 que receberam ETO 5 e 10 mg/kg i.v. bolus uma vez ao dia por 8 e 4 dias, respectivamente. O volume dos tumores foram monitorados diariamente durante 30 dias. Análise não-compartimental dos dados de PK foi realizada no WinNonlin®. A modelagem dos dados PK e PK/PD foi realizada no Monolix®, utilizando abordagem populacional. Os dados PK/PD foram analisados usando o modelo Simeoni TGI modificado através da introdução de uma função Emax para descrever a relação nãolinear entre a concentração plasmática e tumoral e o efeito. Resultados e Discussão: O método por CLAE-UV foi desenvolvido e validado para quantificar as amostras de ETO em plasma e tecido. A penetração do ETO no tumor foi maior na periferia (61 ± 15 % e 61 ± 29 %) do que no centro do tumor (34 ± 6 % e 28 ± 11 %) após administração das doses 10 e 20 mg/kg, respectivamente (ANOVA, α = 0.05). Um modelo de 4 compartimentos compreendendo uma distribuição saturável (cinética de Michaelis-Menten) nos compartimentos tumorais a partir do compartimento central modelou simultaneamente os perfis de concentração-tempo do ETO em plasma e em ambas regiões do tumor. O modelo populacional PK/PD Simeoni TGI–Emax foi capaz de descrever o efeito antitumoral dependente do regime de administração do ETO utilizando concentrações totais plasmáticas ou livres no tumor, resultando em um maior k2max (potência máxima) para as concentrações livres (25,8 mL.μg-1.dia-1 - intratumoral vs. 12,6 mL.μg-1.dia-1 - plasma total). Conclusões: Os resultados mostram que a utilização das concentrações livres do fármaco no tumor para a modelagem PK/PD pode fornecer um melhor entendimento da relação farmacocinética e farmacodinâmica e melhoram a capacidade de previsão do modelo, considerando que a eficácia dos fármacos antineoplásicos no tratamento de tumores sólidos é dependente da capacidade do fármaco em se distribuir no tecido tumoral. / Objective: The aim of this study was to describe the relationship between total plasma and free interstitial tumor etoposide (ETO) concentrations and the drug tumor growth inhibition observed in a Walker-256 (W256) tumor-bearing Wistar rat model using the pharmacokinetic/pharmacodynamic (PK/PD) modeling. Methods: The experiments with animals were approved by CEUA/UFRGS (protocol number 22302). Pharmacokinetic experiments were conducted to determine total plasma and free intratumoral concentrations in two regions of W256 solid tumor by microdialysis. After administration of ETO 10 or 20 mg/kg i.v. bolus to W256 tumorbearing Wistar rats, blood and tissue microdialysate samples from tumor center and periphery were simultaneously collected up to 7h to determine the tumor penetration factor. An analytical HPLC-UV method was developed and validated for quantification of ETO in plasma and microdialysate samples. The pharmacodynamic experiments were conducted in W256 tumor-bearing rats that received ETO 5 or 10 mg/kg i.v. bolus every day for 8 and 4 days, respectively. Tumor volumes were monitored daily for 30 days. Non-compartmental analysis of PK data was performed in WinNonlin®. The PK and PK/PD modeling by population approach were performed using Monolix®. PK/PD data were analyzed using a modification of Simeoni TGI model by introducing an Emax function to describe the nonlinear relationship between tumor and plasma concentrations and effect. Results and Discussion: The HLPCUV method was developed and validated to determine plasma and tissue samples of ETO. ETO tumor penetration was higher in the tumor periphery (61 ± 15 % and 61 ± 29 %) than center (34 ± 6 % and 28 ± 11 %) following 10 and 20 mg/kg doses, respectively (ANOVA, α = 0.05). A 4-compartment structural model comprising a saturable distribution (Michaelis-Menten kinetics) into the tumor compartments from the central compartment simultaneously described the ETO concentration–time profiles in plasma and both tumor regions. The PK/PD population Simeoni TGI–Emax model was capable of describing the schedule-dependent antitumor effects of ETO using total plasma or free tumor concentrations obtained in a W256-tumor bearing Wistar rat model, resulting in higher k2max (maximal potency) for free concentrations (25.8 mL.μg-1.day-1 - intratumoral vs. 12.6 mL.μg-1.day-1 total plasma). Conclusions: The results showed that the use of free intratumoral drug concentrations in the PK/PD modeling can provide a better understanding of the pharmacokinetics and pharmacodynamics relationship and improve the forecasting ability of the models considering that the efficacy of antineoplastic drugs in the treatment of solid tumors is dependent on the drug ability to distribute into the tumor.

Les systèmes de complexes récifaux de l’archipel de la Nouvelle-Calédonie sont explorés depuis près de quarante années pour leur exceptionnelle biodiversité. En effet, de part une position sous-tropicale unique, proche de zones tectoniques actives et du sous-continent Australien, les récifs et lagons néo-calédoniens abritent une importante faune et flore marine relativement protégée des perturbations climatiques. Ces organismes marins se sont avérés être un réservoir considérable de molécules des plus originales et ayant une forte propension à présenter un intérêt thérapeutique notamment dans le cadre du traitement du cancer. L’objectif de cette thèse était de poursuivre cette quête en puisant les substances naturelles dans des macroalgues de Nouvelle-Calédonie. La modulation de la mort cellulaire programmée a notamment été ciblée. Ainsi, les travaux réalisés sur sept espèces de macroalgues rouges (Rhodophyceae) et brunes (Phaeophyceae) collectées dans le lagon Sud de la Nouvelle-Calédonie (arrêté N°197-2016/ARR/DENV) ont permis de révéler leur potentiel dans l’inhibition de la prolifération de cellules cancéreuses en culture. Une espèce de macroalgue rouge a plus particulièrement été travaillée et a conduit à la caractérisation de deux molécules bioactives, dont une n’avait pas été décrite auparavant.  L’étude de leur mécanisme d’action cellulaire a révélé que celles-ci pouvaient constituer de nouvelles pistes thérapeutiques intéressantes dans la recherche de nouveaux traitements en chimiothérapie en tant qu’agents antimitotiques inhibiteurs de kinase. Des activités biologiques très intéressantes ont également été révélées pour des fractions issues de deux espèces de macroalgues brunes démontrant une sélectivité significative pour les cellules cancéreuses. Inscrite dans la continuité de multiples bioprospections menées dans les lagons de Nouvelle-Calédonie à la recherche de produits naturels marins d’intérêt thérapeutique, cette thèse de doctorat témoigne du potentiel de plusieurs espèces de Rhodophyceae et Phaeophyceae jusqu’alors très peu explorées chimiquement. / Marine zones associated with coral reef systems of the New Caledonia archipelago have been investigated for almost forty years with respect to their plant and invertebrate biodiversity and chemodiversity. In particular, thanks to their unique subtropical position close to tectonically active zones and to the Australian subcontinent, the complex reef systems of New Caledonia’s lagoons are home to a highly diverse marine fauna that is relatively protected from climatic disturbances. This is reflected by the score of novel bioactive molecules that have been discovered and characterized, several of which have been actively investigated for their antineoplastic and antitumoral potential activities. We paid particular attention to macroalgal species that induce programmed cell death, as an approach to detecting original anticancer bioactivities. Seven species of red (Rhodophyceae) and brown (Phaeophyceae) macroalgae collected in the South lagoon of New Caledonia (decree N°197-2016/ARR/DENV) have demonstrated interesting in vitro anticancer activity. In particular, one red macroalgal species led to the characterization of two bioactive natural products, the structure of one of which has not been described to date. Biological tests have shown that these two compounds could be promising candidates as antimitotic kinase inhibitors agents for the development of targeted anticancer chemotherapies. Interesting biological activities have also been revealed from several molecular isolates from two species of brown macroalgae, showing high selectivity towards non-cancerous cells. In the continuing investigations of the therapeutic potential of natural products isolated from New Caledonian marine organisms, this doctoral thesis has highlighted the therapeutic potential of several species of Rhodophyceae and Phaeophyceae which has hitherto been largely unexplored.

En nanomédecine, une nouvelle approche consiste à développer des vecteurs synthétiques pour co-délivrer au sein d’une cellule tumorale, un anticancéreux ainsi qu’un siARN, capable de supprimer l’expression d’une protéine impliquée dans les mécanismes de résistance. Les travaux décrits dans ce manuscrit ont été consacrés à la synthèse de nano-vecteurs micellaires pour la délivrance simultanée de ces deux agents thérapeutiques. Une première partie décrit la synthèse et la formulation de micelles nanométriques diacétyléniques photopolymérisables conçues pour délivrer efficacement un siARN. Les propriétés d’encapsulation et de délivrance de ces micelles ont ensuite été étudiées in vitro et in vivo pour une application en thérapie combinatoire. Enfin, une dernière partie présente la fonctionnalisation par interaction électrostatique de ces vecteurs cationiques avec des anticorps préalablement modifiés par des oligonucléotides anioniques pour réaliser un ciblage actif des cellules tumorales. / In the nanomedecine field, a new approach consists in developing synthetic vectors able to co-deliver into a cancer cell, an antitumoral drug and siRNAs that target protein(s) involved in MDR. The work described in this manuscript was dedicated to the development of micellar nanovectors for the intracellular co-delivery of these two therapeutic agents. The first part details the synthesis and the formulation of nanometric photopolymerized diacetylenic micelles adapted for the delivery and intracellular release of the siRNA. Then, the encapsulation and delivery properties of these micelles, bearing histidine polar heads have been investigated in vitro and in vivo for the application of combination therapy. Finally, the last part presents the functionalization by electrostatic interaction of these cationic vectors with antibodies, priorly modified by anionic oligonucleotides. This original and versatile system allowed achieving an active targeting of tumoral cells.

Submitted by Jean Medeiros (jeanletras@uepb.edu.br) on 2018-04-03T17:12:16Z No. of bitstreams: 1 PDF - Jamire Muriel da Silva.pdf: 79224513 bytes, checksum: ff26bbe18b441c71eeb70cb1f6f88b39 (MD5) / Approved for entry into archive by Secta BC (secta.csu.bc@uepb.edu.br) on 2018-04-10T15:03:47Z (GMT) No. of bitstreams: 1 PDF - Jamire Muriel da Silva.pdf: 79224513 bytes, checksum: ff26bbe18b441c71eeb70cb1f6f88b39 (MD5) / Made available in DSpace on 2018-04-10T15:04:05Z (GMT). No. of bitstreams: 1 PDF - Jamire Muriel da Silva.pdf: 79224513 bytes, checksum: ff26bbe18b441c71eeb70cb1f6f88b39 (MD5) Previous issue date: 2018-02-28 / A highly efficient drug that does not cause collateral damage in the treatment of varied types of cancer has been the desire of many study groups. Over the years, this has been arousing the academic interest worldwide in the search for healing or less harmful and more effective treatments. In this perspective, this work sought the development of a series of new acrylate derivatives coupled to nitrogenous nuclei with potential antitumor action, in the perspective of obtaining compounds with high potentiality and specificity. Therefore, 11 new acrylate derivatives coupled to acridine, quinolinic, indolic and pyridine nuclei have been planned and developed, 10 of which are inedited in the literature. The compounds were obtained from the condensation of different aromatic aldehydes with different reactive methylene groups through a Knovenagel type reaction in ethanolic and basic medium. Fifteen compounds were obtained, four of them intermediates (JM-01, AC-01, ACN-01 and AC-02) and 11 final compounds that presented yields of 51-86% and melting range ranging from 1 to 4 ºC, which gives a certain guarantee of the purity of the products. The structures of the obtained derivatives were elucidated by infrared-IR techniques, mass spectrometry and by 1H NMR and 13C NMR spectroscopy, showing absorption bands characteristic of the functional groupsproposed in the structures, especially the bands and signals of the common vinyl hydrogen in all compounds ranging from 5.73 to 9.30 ppm, thus proving the success of the proposed synthesis. The mass spectra corroborated with the success of the syntheses, presenting masses with expected values. The derivatives were submitted to a docking study, with scores varying from -58.8549 to -16.1303, with the best results being attributed to ICIP, ACMD, PAIP and CAIC derivatives. Interaction tests with DNA were performed by means of an evaluation of absorbance spectroscopy, observing the interaction of the compounds with the targets. In the analysis of interaction with DNA, four of them (ICIP, CAQA, CAAC and ACIP) showed interaction with DNA shifting the wavelength. Among of all derivatives, the ICIP stood out for the good results, both in the docking study, with value close to the reference drug, and with interaction with DNA, by presenting hyperchromic effect, allowing an interaction on both sides of the molecule, and also for being a inedited compound. This molecule presents itself as promising compound for the continuity of the evaluations as a drug candidate. / Um fármaco altamente eficiente e que não provoque danos colaterais no tratamento dos mais diversos tipos de câncer tem sido o desejo de muitos grupos de estudos. E isso, vem a cada ano despertando o interesse acadêmico mundial em busca da cura ou de tratamentos menos nocivos e mais eficazes. Nessa perspectiva, este trabalho buscou o desenvolvimento de uma série de novos derivados acrilatos acoplados a núcleos nitrogenados com potencial ação antitumoral, na perspectiva de obtenção de compostos com elevada potencialidade e especificidades. Para tanto, planejou-se e desenvolveu-se 11 novos derivados acrilatos acoplados a núcleos acridínicos, quinolínicos, indólicos e piridínicos dos quais 10 são inéditos na literatura. Os compostos foram obtidos a partir da condensação de diferentes aldeídos aromáticos com diferentes grupos metilenos reativos através de uma reação do tipo Knovenagel em meio etanólico e básico. Foram obtidos 15 compostos sendo quatro deles intermediários (JM-01, AC-01, ACN-01 E AC-02) e 11 compostos finais que apresentaram rendimentos de 51 a 86 %, e faixa de fusão variando de 1 a 4 ºC que dão certa garantia de pureza dos produtos. As estruturas dos derivados obtidos foram elucidadas por técnicas infravermelho-IV, espectrometria de massas e por espectroscopia de RMN de 1^H e 13^C apresentando bandas de absorção características dos grupos funcionais propostos nas estruturas, principalmente as bandas e sinais do hidrogênio vinílico comum em todos os compostos variando entre 5,73 e 9,30 ppm comprovando assim o sucesso da síntese proposta. Os espectros de massas vieram mais ainda corroborar com o sucesso das sínteses, apresentando massas com valores esperados. Os derivados foram submetidos a estudo de docking apresentando scores variando de -58,8549 a -16,1303 destacando-se com melhores resultados os derivados ICIP, ACMD, PAIP e CAIC. Os testes de interação com, DNA foram realizados através de avaliação de espectroscopia de absorbância observando a interação dos compostos com os alvos. Nas análises de interação com DNA, verificou-se que quatro delas o ICIP, CAQA, CAAC e ACIP apresentaram interação com DNA deslocando o comprimento de onda. De todos os derivados, o ICIP se destacou pelos bons resultados, tanto no estudo de docking com valor próximo ao fármaco de referência, como com interação com DNA apresentando efeito hipercrômico, possibilitando uma interação pelos dois lados da molécula, e também por ser um composto inédito. Esse composto se apresenta com promissor para a continuidade das avaliações como candidatos a fármacos.