Die vorliegende Arbeit beschäftigen sich mit Azobenzol-Photoschaltern zur Steuerung (makro)molekularer Prozesse. Aufgrund ihrer lichtinduzierten geometrischen Strukturänderung hat diese Substanzklasse als Steuereinheit Einzug in mehrere Bereiche der Lebens- und Materialwissenschaften gehalten. Vorteile wie die hohe Stabilität, gute Ansprechbarkeit und etablierte Synthesemethoden werden von einer großen Vielfalt an Derivaten vervollständigt. Als eines der populärsten photochromen Systeme bieten Azobenzole eine zuverlässige Grundlage für die Entwicklung neuer molekularer Maschinen. Der erste Teil dieser Arbeit hat die Vergrößerung der geometrischen Änderung des Schaltvorgangs zum Ziel. Dafür werden Azobenzole in starre Makromoleküle und makromolekulare Aggregate eingebaut, die der Bewegung der kleinen Wiederholungseinheiten aufgrund der gewählten Architektur folgen und somit idealerweise die Umwandlung der aufgenommenen Energie in mechanische Arbeit erhöhen. Dabei werden die Grundlagen der Photochromie, der Azobenzol-Photochemie sowie allgemeine Strategien zur Steigerung geometrischer Änderungen in molekularen Systemen vorgestellt. Des Weiteren wird das Design, die Synthese und die Charakterisierung eines durch Licht ansprechbaren Polymeraggregats beschrieben. Der zweite Teil dieser Arbeit beschäftigt sich mit der reversiblen Bildung von ionischen Substanzen. Geladene Spezies sind von großer Wichtigkeit für die Aufrechterhaltung verschiedener Körperfunktionen in Lebewesen, können jedoch auch Adsorptions- und bakterizide Eigenschaften auf Oberflächen regulieren. Basierend auf dem Modell des Spiropyrans wird der theoretische Hintergrund für die Herstellung eines Azobenzol-Äquivalents vorgestellt. Daten aus DFT-Rechnungen werden in Modellverbindungen umgewandelt, die mittels NMR-Analyse untersucht werden. Abschließend wird eine vielversprechende Zielstruktur eines durch Licht steuerbaren dynamisch kovalenten Zwitterions vorgestellt. / The present thesis employs azobenzene photoswitches to control (macro)molecular processes. As a light-responsive molecule undergoing a large geometrical change upon E/Z photoisomerization, azobenzenes have found their way into multiples areas of life and material sciences. Advantages such as high stability, good addressability, and well-established synthesis methods are accompanied by a large variety of derivatives. Being one of the most popular photochromic compounds, azobenzenes provide a reliable basis for the development of new responsive systems. The first part of this work is aimed at the amplification of the switching dimensions by incorporating azobenzene into rigid macromolecules and macromolecular aggregates. Based on the polymer architecture, the motion of the small responsive repeating units is transferred to the entire macromolecule, which ideally helps to increase the conversion of consumed energy into mechanical work. Following a small overview about the basics of photochromism and azobenzene photochemistry, general strategies to increase geometrical changes in molecular systems are presented. Furthermore, the design and synthesis as well as the characterization of a light-responsive polymer aggregate that exhibits a large geometrical change upon isomerization is described. The second part of this work deals with the reversible formation of ions. Besides their great importance for vital functions in living organisms, adsorption characteristics as well as bactericidal properties can be regulated by ionic modifications on surfaces. Based on the model of spiropyran, the theoretical background for the preparation of an azobenzene equivalent is presented. The computational data is converted into model compounds that were investigated by means of NMR analysis. Based on these combined theoretical and experimental data, a promising target structure for a light-responsive dynamic covalent zwitterion is described.

Für Dihydropyrene ist die 6 pi Elektrozyklisierung für gewöhnlich schnell, wohingegen die Cycloreversion durch eine Aktivierungsbarriere im angeregten Zustand ineffizient wird. Die Substitution mit Donor- und Akzeptorgruppen erzeugt ein „push-pull“ System, welches eine bathochrome Verschiebung der Absorption in den tief roten Bereich (730 nm onset) zur Folge hat. Das „push-pull” System polarisiert den Dihydropyrenkern, was ein Absenken der Aktivierungsbarriere im angeregten Zustand zur Folge hat und in einer erhöhten Quantenausbeute resultiert. Es wird weiter gezeigt, wie dies in nicht-permanenter Art und Weise durch Katalyse vollzogen werden kann, indem eine protonierte Spezies mit einer geringeren Aktivierungsbarriere im angeregten Zustand gebildet wird. Da Dihydropyrene im sichtbaren Bereich absorbieren und im Allgemeinen als T-Typ negativ photochrom betrachtet werden, ist ein Schalten ohne die Verwendung von UV Licht möglich. Für die Substanzklasse der Azobenzole wird ein neuer aromatischer Substituent anstelle eines der Phenylreste untersucht. Die Bandenseparation von bis zu 80 nm erlaubt hohe photostationäre Zustände von ≈ 90 % für beide Richtungen. Die hohen Extinktionskoeffizienten von ≈ 20000 L mol 1cm 1 für das E Isomer, führen zu einer gesteigerten Absorption im Vergleich zu herkömmlichen Azobenzolen. Weiterhin kann die Löslichkeit der Verbindungen, durch die Wahl des Gegenions moduliert werden, was es ermöglicht in Tetrahydrofuran, Acetonitril, Wasser, sowie einer ionischen Flüssigkeit zu schalten. Mit höherer Polarität des Lösungsmittels wird die Absorptionsbande des E Isomers zu längeren Wellenlängen hin verschoben und die thermischen Rückreaktion beschleunigt. Die thermische Halbwertzeit der Rückreaktion kann zwischen 3 min und 13 h bei 25 °C eingestellt werden. Ebenso wurde auch das Schaltverhalten einer Azoniumspezies untersucht und eine erstaunlich lange thermische Halbwertzeit von > 2 min beobachtet. / For the dihydropyrene system 6 pi electrocyclization is usually fast, while the cycloreversion is inefficient, due to an activation barrier in the excited state. It is shown, how substitution with donor and acceptor moieties creates a push-pull system, causing a bathochromic shift of the absorption spectrum to the far red (730 nm onset). The push-pull system induces a dipole in the dihydropyrene, which lowers its excited state activation barrier and therefore increases the quantum yield of the cycloreversion. Further it is shown, how this can be performed in a catalytic fashion, where protonation leads to a species with a lower barrier in the excited state. As dihydropyrenes absorb in the visible and are considered as T-type negative photochromic, they can be switched without the use of UV-light. In case of the azobenzene class, a new aromatic substitute for one of the benzene rings is investigated and shows superior switching properties. Band separation of up to 80 nm is shown, along with high photostationary states ≈ 90% favoring each of the two switching directions. Interestingly, the extinction coefficient especially of the E isomer increases to ≈ 20000 L mol-1cm-1, dramatically enhancing the absorptivity compared to normal azobenzenes. Furthermore, the solubility can be tuned by proper choice of the cation, which is used to investigate solvent effects in nonpolar, polar, and protic (water) solvents as well as in an ionic liquid. With increasing polarity, the absorbance of the E isomer is shifted to longer wavelengths, which is accompanied by a reduced thermal half-life. The half-life of the thermal reverse reaction can be tuned from 3 min to 13 h at ambient temperature. As one of the derivatives is easily protonated, switching of the corresponding azonium species has also been investigated and an astoundingly long thermal half-life of > 2 min at room temperature has been observed.

Des azobenzènes photochromiques ont été intégrés à des macrocycles synthétiques pour moduler photochimiquement la chélation de différents ions qui jouent un rôle essentiel dans les processus biologiques. La photocommutation de ces récepteurs a été étudiée (rendements quantiques, réversibilité, état photostationnaire) et les constantes de stabilité ont été déterminées. Le développement d’un récepteur biocompatible du Ca2+ (BAPTA) a permis de moduler la concentration de Ca2+ dans une solution aqueuse avec la lumière. Les molécules entrelacées sont également un sujet majeur dans le domaine de la chimie supramoléculaire. Une méthode de macrocyclisation photochimique, basée sur la dimérisation de l’anthracène, a été appliquée à des assemblages supramoléculaires dans le but de modifier leur topologie et de développer une nouvelle stratégie de photocaténation. En parallèle, un rotaxane a été réalisé en ajoutant des groupements encombrants sur les anthracènes par une réaction de Diels-Alder. / As the availability of ions plays a key role in biological processes, photochromic azobenzene macrocycles were synthetized to photochemically modulate chelation of different ions in various media. The photoswitching of these receptors was evaluated (quantum yields, reversibility, photostationary state) as well as binding constants. Integrating a biocompatible Ca2+ receptor (BAPTA) with azobenzene enabled the modulation of calcium concentration in aqueous solution and to reversibly switch the fluorescence emission of a molecular probe based on photoinduced electron transfer. Interlocked molecules are also a major topic in the field of supramolecular chemistry. A Photochemical macrocyclization method, based on the dimerization of anthracene, was applied to supramolecular assemblies in order to change their topology and develop a new strategy of photocatenation. In parallel, a rotaxane was achieved by adding bulky groups on anthracenes by a Diels-Alder reaction.

Durch die Funktionalisierung von Silica- und Gold-Nanopartikeln mit einem neu entwickelten photoschaltbaren Polymer wurden gezielt selbst¬organisierte Architekturen aus Polymer-Nanokompositen aufgebaut. Silica-Oberflächen wurden mit Transferagenzien für eine oberflächeninitiierte reversible Additions–Fragmentierungs-Ketten-transferpolymerisation (engl. reversible addition–fragmentation chain transfer (RAFT-) Polymerisation) modifiziert und systematisch untersucht. Dazu wurden Mono-, Di- und Trialkoxysilylether als Ankergruppen in die chemische Struktur der RAFT-Agenzien integriert. Die Analyse von funktionalisierten planaren Substraten durch Rasterkraftmikroskopie hat gezeigt, dass di- und trifunktionelle Ankergruppen als vernetzte Aggregate auf der Oberfläche gebunden werden, wenn die Immobilisierung in Toluol durchgeführt wird. Als Ursache dafür wurde durch dynamische Lichtstreuung (DLS) eine, im Vergleich zur Reaktion mit der Oberfläche, beschleunigte Aggregation der Ankergruppen identifiziert. Die Vernetzung konnte durch die Verwendung von 1,2-Dimethoxyethan als Lösungsmittel unterbunden werden, wodurch besser definierte Oberflächenstrukturen erhalten wurden. Diese wurden ebenfalls durch Monoalkoxysilylether erreicht, die unabhängig vom Lösungsmittel keine Möglichkeit zur Vernetzung bieten. Die Charakterisierung funktionalisierter sphärischer Silica-Nanopartikel mittels Transmissionselektronen¬mikroskopie (TEM) bestätigten diese Ergebnisse. Dadurch wurde gezeigt, dass vernetzte Ankergruppen zu der Aggregation von Silica-Nanopartikeln führen. An den funktionalisierten Partikeln wurden RAFT-Polymerisationen durchgeführt, deren Produkte durch Gel-permeations¬chromatographie und Thermogravimetrie analysiert wurden. Dabei wurde gezeigt, dass die Beladungsdichte des Polymers nicht ausschließlich mit der Konzentration der RAFT-Agenzien auf der Oberfläche steigt, sondern vor allem mit deren Erreichbarkeit für Makroradikale. Zudem wurde festgestellt, dass der Anteil niedermolekularer Nebenprodukte unabhängig vom Aggregationgrad der verwendeten Ankergruppen ist. Nach diesen Prinzipien maßgeschneiderte Silica- und Gold-Nanopartikel wurden in einer Blockcopolymermatrix dispergiert und mittels TEM analysiert. Durch Mikrophasenseparation der Matrix konnten erstmals RAFT-Polymer-funktionalisierte Nanopartikel gezielt und selektiv in eine Phase integriert werden. Zusätzlich wurde beobachtet, dass selektiv Silica-Partikel mit kleinen Durchmessern aus der eingesetzten Größenverteilung eingebaut wurden. Neben dem Design von Nanopartikeln wurde ein photoschaltbares Polymer (PAzoPMA) für die Anwendung in Polymer-Nanokompositen entwickelt. Durch die reversible Licht-induzierte transcis-Isomer¬isierung der schaltbaren Azobenzol-Einheiten des Polymers, nimmt sowohl die molekulare Größe ab als auch das Dipolmoment deutlich zu. Diese Änderungen konnten durch Wasser-Kontaktwinkel-Analysen, DLS und Ionenmobilitäts-Massenspektrometrie charakterisiert werden. Durch die Funktionalisierung von Silica- bzw. Gold-Partikeln mit diesem Polymer wurden photoschaltbare Nanokomposite synthetisiert, indem PAzoPMA über RAFT-Agenzien an die Oberfläche gebunden wurde. Die Bestrahlung einer Dispersion dieser Hybridpartikel mit ultraviolettem Licht induzierte die transcis-Isomerisierung, die eine Selbstorganisation der Primärpartikel zur Folge hatte. Insbesondere funktionalisierte Gold-Nanopartikel aggregierten zu definierten, sphärischen Überstrukturen, was durch DLS und optische Absorptions-spektroskopie belegt wurde. Durch letztere konnte außerdem gezeigt werden, dass der geschaltete Zustand länger stabil ist als bei bisher literaturbekannten Systemen mit Kleinmolekülen als Photoschalter. Eine weitere Stärke des entwickelten Systems wird mittels TEM-Analyse verdeutlicht. Die über die molare Masse des PAzoPMAs in der Partikelhülle einstellbaren Abstände der Primärpartikel, innerhalb dieser Überstrukturen, verdeutlichen das große Potential des Systems.

Abstract Template assisted deposition was used to produce various nanomaterials including simple nanowires, nanorods, multi-segmented metal nanowires, core-shell nanowires, alloy and polymer wires and tubes. Anodized aluminum oxide (AAO) membranes were used as templates for the growth of the various structures using an electrochemical deposition method and also by wetting the porous templates. In the electrochemical deposition method, the pore size of the templates affects the rate of synthesis and the structures of the nanomaterials while in the wetting method, the viscosity and reaction time in the polymer solution influence the structures of the nanomaterials. A conventional two-step anodization procedure was used to synthesize thick AAO templates with porous hexagonal channels at a constant applied voltage and temperature. A maximum thickness of over 180 µm oxide layer could be fabricated using mild anodization at 60 V and 80 V. Compared to conventional mild anodization, these conditions facilitated faster growth of oxide layers with regular pore arrangement. Polyethylene glycol (PEG) containing ferromagnetic nanowires were synthesized using template assisted electrochemical deposition method. During the synthesis, simultaneous deposition of polymer and metal ions resulted nanowires coated with a uniform layer of PEG without interfering with the structure and magnetic properties of the nanowires. PEG-coated Ni nanowires were embedded in polyethylene diacrylate (PEGDA) matrix after the removal of the AAO templates. Comparison of results with and without a magnetic field during embedding showed that the presence of magnetic field supported embedding of nanowire arrays in polymer. Influence of using AAO templates with several pore diameters for the synthesis of bimetallic nanowires were studied by growing Ni-Fe and Ni-Co bi-metallic nanowires. At a constant applied current by using templates with a pore diameters of 60 nm alloy formed while with a pore diameter of 130 nm core-shell nanowires formed. Polyvinylidene fluoride (PVDF) films and nanotubes were synthesized using a solution recrystallization method that favored the formation of piezoelectric β phase thin films. Variation in the concentration of polymer in the mixture solution allowed synthesis of different types of structures such as PVDF composites, nanorods and nanocrystals with tunable morphologies. Keywords: One-dimensional structures, electrodeposition, porous alumina, ferromagnetic nanostructures, magnetic core-shell nanowires, alloys, polymer composite, stimuli-active, PEGDA, azobenzene, and PVDF.

No description available.

Photokontrolle von Eigenschaften einzelner Moleküle und größerer Molekülvereinigungen ist ein faszinierendes Feld aktueller chemischer Forschung. Das schlichte Potential der genauen Adressierbarkeit von chemischer Reaktivität sowie die Möglichkeit durch Ausnutzen des katalytischen Zyklus einen Lichtstimulus in ein verstärktes chemisches Signal zu übersetzen, machen die Photokontrolle über katalytische Aktivität zu einem besonders attraktiven Ziel. Daher wurde im Rahmen dieser Dissertation ein allgemeines Konzept zur Realisierung von photoschaltbaren Katalysatoren entwickelt, das auf der reversiblen sterischen Abschirmung eines katalytisch aktiven Zentrums durch eine photochrome Abschirmungsgruppe beruht. Durch Vorgabe des Schaltzustandes des Photochromes kann die Aktivität des Katalysators bestimmt werden. Das Konzept wurde durch die Entwicklung von konformativ eingeschränkten, photoschaltbaren Piperidinbasen umgesetzt, die synthetisch leicht durch einen in hohem Maße modularen Zugang erhalten werden konnten. Die Piperidinbasen erlaubten die Photokontrolle der Katalysatoraktivität in der Nitroaldol-Reaktion (Henry-Reaktion). Durch die Optimierung der Substituenten konnten bemerkenswerte katalytische AN/AUS-Verhältnisse erreicht werden. Die Reaktivitätsunterschiede konnten mit Änderungen der Basizität in Abhängigkeit vom Schaltzustand korreliert werden. Systematische NMR-spektroskopische und theoretische Untersuchungen der strukturellen Dynamik des Katalysators in Lösung ermöglichten die Formulierung von detaillierten Struktur-Reaktivitäts-Beziehungen. Eine Erweiterung des Konzepts auf intrinsisch reaktivere Katalysatoren sollte zu einer verbesserten Anwendbarkeit beitragen. Daher wurde das Konzept der reversiblen sterischen Abschirmung auf katalytisch aktive N-heterozyklische Carbene übertragen. Eine erfolgreiche Synthese wurde durch ungünstige sterische Wechselwirkungen zwischen den abschirmenden Gruppen an den Stickstoffatomen des Carbens verhindert. / Photocontrol over properties of single molecules and assemblies thereof is an appealing area of current chemical research. The mere potential to selectively address chemical reactivity as well as the possibility to transform an incoming light stimulus into an amplified chemical signal by exploiting the associated catalytic cycle renders photocontrol of catalytic activity a particularly attractive goal. In this dissertation, a general concept for the realization of photoswitchable catalysts was developed, based on reversible steric shielding of a catalyst’s active site by a photochromic blocking group. Dictating the photochrome’s switching state enables gated access to the active site, thereby photocontrolling the catalyst’s chemical reactivity. The concept was realized by designing conformationally restricted, photoswitchable piperidine bases, which were easily synthesized exploiting a highly modular approach. Indeed, the developed piperidine bases allowed to photocontrol the catalysts’ activities in the nitroaldol reaction (Henry reaction) and by tuning of the substituents significant catalytic ON/OFF-ratios were achieved. The reactivity differences could be correlated with changes of basicity depending on the photochrome’s switching state. Systematic NMR-spectroscopic and computational studies of the catalysts’ structural dynamics in solution enabled the formulation of detailed structure-reactivity relationships. Strategies for the implementation of the concept of reversible steric shielding into the N-heterocyclic carbene (NHC) motif were devised to exploit the high reactivity of NHCs in numerous catalytic processes, which is expected to greatly enhance the utility of the concept. However, profound steric shielding of the active site to suppress unwanted OFF-state reactivity prevented the synthetic realization of the concept due to unfavorable steric interactions upon formation of the heterocyclic carbene from suitable precursors.

Ces travaux de thèse portent sur les phénomènes d’amplification du signal de diffusion Raman par effet de surface et par effet de pointe. Des réseaux de motifs métalliques de taille nanométrique arrangés spatialement ont été fabriqués par la méthode de transfert Langmuir-Blodgett et par lithographie à faisceau d’électrons. De telles structures de géométries contrôlées déposées à la surface de lamelles de microscope ont été développées afin d’amplifier le signal Raman de molécules adsorbées par effet SERS (Surface Enhanced Raman Spectroscopy). Ces nanostructures triangulaires en or de taille proche de la longueur d’onde ont des bandes de résonance plasmon dans le domaine spectral visible. En utilisant une source de laser appropriée dans ce domaine spectral, les facteurs d’amplification Raman d’une couche mono-moléculaire d’un dérivé azobenzène sont de plusieurs ordres de grandeur, et ce pour les deux techniques de nano-lithographie employées. Afin de compléter ces premiers résultats, des réseaux de fils d’or avec de grands facteurs de forme ont été fabriqués. Ces derniers montrent des résonances plasmons multipolaires et des facteurs d’amplification de l’ordre de 105. Les techniques de microscopie en champ proche ont également été développées afin de localiser précisément l’exaltation Raman et d’accroitre la résolution spatiale de mesures Raman. Des pointes métalliques en or de taille nanométrique ont ainsi permis d’amplifier localement le signal de diffusion de molécules placées à leur proximité par effet TERS (Tip Enhanced Raman Spectroscopy). Les développements logiciels et mécaniques entre un microscope confocal Raman et un microscope à force atomique ont été implémentés afin de contrôler simultanément les deux instruments. Ce montage expérimental a été appliqué à l’étude de nanofils semi-conducteurs de nitrure de gallium permettant de suivre leur signal vibrationnel avec une résolution spatiale inférieure à 200 nm. / This thesis work focuses on Raman scattering enhancements by metallic nanostructures. In the first part of this work, arrays of metallic patterns with nanometer dimensions were fabricated by the Langmuir-Blodgett deposition technique and electron-beam lithography. Such structures made of gold were fabricated onto microscope slides with the goal to enhance the Raman signal through SERS effect (Surface Enhanced Raman Spectroscopy). These patterns formed by an assembly of triangular nanostructures with sizes of hundreds of nanometers, exhibit plasmon resonance bands in the visible spectral region. By using an appropriate excitation laser source with respect to the plasmon frequency, Raman enhancement factors of a monolayer were found to be of several order of magnitude for both Langmuir-Blodgett and electron-beam lithography platforms. To further complement these results, gold wires arrays with large aspect ratio made by electron-beam lithography showed multipolar plasmon resonances with enhancement factors up to 105. In the second part of this thesis, near-field Raman microscopy has been developed with the aim to localize precisely the Raman enhancement and improve spatial resolution of Raman measurements. Atomic force microscopy gold tips have been used to locally enhance scattering signal of molecules in close proximity to the tip opening new opportunities. This approach known as TERS (Tip Enhanced Raman Spectroscopy) is of significant interest to probe nanomaterials, nanostructures or monolayers. Software and mechanical developments have been made between a confocal Raman microscope and an atomic force microscope to control simultaneously both instruments. This experimental setup was used to characterize gallium nitride semi-conductors nanowires with spatial resolution better than 200 nm.

Die Beeinflussung optischer Eigenschaften durch Bestrahlung stellt eine Grundlage für die Herstellung anisotroper optischer Komponenten dar. In dünnen Schichten von Azobenzen-Polymeren kann optische Anisotropie durch linear polarisierte Bestrahlung induziert oder modifiziert werden. Ziel der Arbeit war es, wesentliche Struktur-Eigenschafts-Beziehungen zum Prozess der Photoorientierung zu erarbeiten, um so eine Optimierung der Materialien für verschiedene Anwendungen ermöglichen. <br><br> In isotropen Schichten flüssigkristalliner und amorpher Azobenzen-Polymeren wird das Ausmaß der induzierten optischen Anisotropie günstig durch eine Donor/Akzeptor-Substitution in 4,4'-Position beeinflusst. Die Induktionsgeschwindigkeit ist in Schichten flüssigkristalliner Polymeren deutlich geringer, jedoch lassen sich höhere Werte der Doppelbrechung und des Dichroismus erreichen. In Copolymeren bewirkt die Photoorientierung der Azobenzen-Seitengruppen eine kooperative Orientierung von formanisotropen Seitengruppen. Die Mesogenität der nicht-photochromen Seitengruppen erhöht das Ausmaß der induzierten optischen Anisotropie. Die Stabilität der induzierten Doppelbrechung und des Dichroismus wird durch diese Gruppen gesteigert. <br><br> In Schichten flüssigkristalliner Polymeren wird die induzierte optische Anisotropie beim Tempern im Bereich der Mesophasen erheblich verstärkt. Dabei reicht ein geringes Maß an induzierter Anisotropie aus, um Doppelbrechungs- und Dichroismuswerte zu erzielen, wie sie für LC-Domänen typisch sind. <br><br> In orientierten Schichten von Azobenzen-Polymeren wird das Resultat der linear polarisierten Bestrahlung durch die Stärke der anisotropen Wechselwirkungen in den flüssigkristallinen Domänen oder den LB-Multilayern bestimmt. Eine lichtinduzierte Reorientierung kann nur erreicht werden, wenn diese Wechselwirkungen überwunden werden können. Erfolgt eine Photoreorientierung in den orientierten Polymerschichten, werden in Copolymeren formanisotrope Seitengruppen ebenfalls kooperativ reorientiert. Eine vorgelagerte UV-Bestrahlung kann durch Erzeugung eines hohen Anteils an nicht-mesogenen Z-Isomeren die anisotropen Wechselwirkungen stark schwächen und so die Seitengruppen entkoppeln. Aus diesem Zustand erfolgt die Photoreorientierung mit einer der Photoorientierung in isotropen Schichten vergleichbaren Effizienz. <br><br> Die erarbeiteten Struktur-Eigenschafts-Beziehungen liefern einen Beitrag zur Optimierung derartiger Materialien für Anwendungen in den Bereichen optischer Funktionsschichten, holographischer Datenspeicherung oder der Generierung von Oberflächenreliefgittern. / The modification of optical characteristics by irradiation represents a basis for the creation of anisotropic optical components. In thin films of azobenzene polymers optical anisotropy can be induced or modified by linearly polarized irradiation. The goal of the work was it to compile substantial structure property relations of the photoorientation process in order to support an optimization of the materials for different applications. <br><br> In isotropic films of liquid crystalline and amorphous azobenzene polymers the extent of the induced optical anisotropy is increased by a donor/acceptor substitution in 4,4'-position. The induction speed is clearly smaller in films of liquid crystalline polymers, however higher values of birefringence and dichroism can be reached. In copolymers the photoorientation of the azobenzene side groups causes a cooperative orientation of form-anisotropic side groups. The mesogenity of the non-photochromic side groups increases the extent of the induced optical anisotropy. <br><br> The stability of the induced birefringence and dichroism is increased by these groups considerably. In films of liquid crystalline polymers the induced optical anisotropy is substantially amplified on annealing within the range of the mesophases. In this way, a small ratio of induced anisotropy is sufficient, in order to obtain birefringence and dichroism values as typical for LC domains. <br><br> In oriented films of azobenzene polymers the result of the linear polarized irradiation is determined by the strength of the anisotropic interactions in the liquid crystalline domains or the LB multilayers. A light-induced reorientation can be only achieved, if these interactions can be overcome. If a photoreorientation takes place in the oriented layers of copolymers, form-anisotropic side groups are cooperatively reoriented. An initial UV irradiation can strongly weaken the anisotropic interactions by generating of a high fraction of non-mesogenic z-isomers and decouples in this way the side groups. From this state the photoreorientation proceeds with an efficiency one comparable to the photoorientation in isotropic films. <br><br> The compiled structure property relations supplies a contribution for the optimization of such materials for applications in the fields of optical function films, holographic data storage or the generation of surface relief gratings.

The thesis entitled “Novel Distamycin Frameworks for Enhancement and Photoregulation of DNA binding and Stabilization of Higher Order DNA Structures” has been divided into 4 chapters. Chapter 1 reviews the current trends in the design of DNA binding small molecules with sequence specific and secondary structure specific DNA recognition characteristics and their role in regulation of transcription and gene modification events. Chapter 2 describes an efficient conjugation of distamycin analogue with oligonucleotide stretches to enhance the specificity and selectivity of the hybrids compared to the covalently unlinked entities. Chapter 3A and 3B present an approach to achieve photoregulation of distamycin binding on duplex DNA minor groove surface via its conjugation with various types of photoisomerizable azobenzene moieties. Chapter 4A and 4B deal with the conjugation of distamycin with higher order DNA structure recognizable small molecule, DAPER to finely tune hybrid ligand recognition at either quadruplex or duplex-quadruplex junction of DNA. Chapter 1. Design of DNA Interacting Small Molecules: Role in Transcription Regulation and Target for Anticancer Drug Discovery Regulation of transcription machinery is one of the many ways to achieve control gene expression. This has been done either at the transcription initiation stage or at the elongation stage. There are different methodologies known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by i) synthetic oligonucleotides, ii) ds-DNA specific, sequence selective minor groove binders (distamycin A), intercalators (daunomycin) (Figure 1), combilexins, and iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of duplex DNA, higher order triple helix or quadruplex structures are formed at transcription start site. In this regard triplex and quadruplex DNA specific small molecules (e.g. BQQ, Telomestatin etc.) play a significant role for inhibiting transcription machinery (Figure 1). These different types of designer DNA binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have side effects. So there is always a challenge remaining with these designer DNA binding molecules, to achieve maximum specific DNA binding affinity, cellular and nuclear transport activity without affecting the functions of normal cells. This could be done either modifying the drug or using two or three effective drugs together to inhibit gene expression to the maximum extent. (structural formula) Figure 1. Molecular structures of different DNA interacting small molecules. Distamycin A and daunomycin bind to ds-DNA, BQQ binds to triple helical DNA and Telomestatin stabilizes quadruplex DNA structure. Chapter 2. Efficient Conjugation and Characterization of Distamycin based Peptide with Selected Oligonucleotide Stretches A variety of groove-binding agents have been tethered to DNA sequences to improve the antisense and antigene activities and to achieve greater stabilization of the duplex and triplex structures. Unfortunately however, the methods of such tethering are often not available and sometimes not reproducible. Therefore there is a necessity to develop an efficient and general procedure for conjugation. So we have accomplished a convenient and efficient synthesis of five novel distamycin-oligodeoxyribonucleotide (ODN) conjugates where C-terminus of a distamycin derivative has been covalently attached with the 5′-end of selected ODN stretches 5′-d(GCTTTTTTCG)-3′, 5′-d(GCTATATACG)-3′and 5′-AGCGCGCGCA-3′(Figure 2). Selected sequences of ODNs containing aldehyde functionality at 5′-end were synthesized, and efficiently conjugated with reactive cysteine and oxyamine functionalities present at C-terminus of distamycin-based peptide to form five membered thiazolidine ring and oxime linkages respectively. The specificity of distamycin binding and the duplex DNA stabilizing properties resulting from the hybridization of these ODN-distamycin conjugates to sequences of appropriate ODN stretches have been examined by UV-melting temperature measurements, temperature dependent circular dichroism studies and fluorescence displacement assay using Hoechst 33258 as a minor groove competitor. These studies reinforce the fact that the specific stabilization of A-T rich duplex DNA by ODN-distamycin conjugates compared to unlinked subunits. It is evident that the distamycin conjugates are more selective in binding to ODNs containing a continuous stretch of A/T base pairs rather than the one having alternating A/T tracts. Figure 2. Chemical structures of covalent conjugates of distamycin derivative with selected ODN stretches using thiazolidine, 1 and oxime linkages, 2. Chapter 3A. Synthesis and Duplex DNA Binding Properties of Photoswitchable Dimeric Distamycins based on Bis-alkoxy substituted Azobenzenes Two azobenzene distamycin conjugates 2 and 3 (Figure 3) bearing tetra N-methylpyrrole based polyamide groups at the ortho and para position of the dialkoxy substituted azobenzene core were synthesized. The photoisomerization processes of ligands 2 and 3 were examined by irradiating them at ∼355-360 nm followed by UV-vis spectroscopy and 1H-NMR analysis. DNA binding affinity of individual conjugates and the changes in DNA binding efficiency during photoisomerization process were studied in details by circular dichroism spectroscopy, thermal denaturation and Hoechst displacement assay using poly [d(A-T)] at 150 mM NaCl. It has been found that 1 mM DMSO solution of ortho substituted ligand 3 required ∼25 min to form ∼2/8 [E]/[Z] isomeric forms while the para substituted analogue, 2 required ∼10 min to achieve ∼100% cis isomeric form at photostationary state. The conformational freedom of distamycin is restricted while tethered to azobenzene moiety and this loss of flexibility was pronounced with ortho substituted analogue 3 compared to its para substituted counterpart, 2. This was reflected from lower induced circular dichroism (ICD) intensity, lower apparent binding constant and requirement of higher ligand concentration to saturate minor groove binding by distamycin in ligand 3 compared to 2. Finally, higher ICD intensity for cis form and enhancement of ICD intensity via irradiation of DNA bound trans form indicates that photoisomerization process indeed changes the overall shape of the molecule. This in turn might help orientation of some of the amide groups in close proximity with the minor groove surface and improve ligand recognition on duplex DNA. Figure 3. Chemical structures of distamycin derivative, 1, ortho and para dialkoxy substituted azobenzene-distamycin conjugates, 2 and 3. Trans-to-cis isomerization of 3 did not significantly improve DNA binding of both distamycin arms compared to ligand 2. The unique characteristics of both isomeric forms of azobenzene-distamycin conjugates are co-operative binding nature on minor groove surface and higher duplex DNA stabilization of ∼7-11 oC more compared to that of their parent distamycin analogue, 1. However, overall difference in the DNA recognition between both isomerized forms has not been highly dramatic. Chapter 3B. Synthesis and Duplex DNA binding Properties of Photoswitchable Dimeric Distamycins based on Bis-carboxamido substituted Azobenzenes The synthesis and DNA binding properties of a dimeric distamycin-azobenzene conjugate bearing N-methyl tetrapyrrole (ligand 4) and tripyrrole (ligand 5) based polyamide groups at 4,4′position of the carboxyl substituted azobenzene core have been presented (Figure 4). Distamycin arm has been connected to the azobenzene core via short (∼5 Å) ethylene diamine and long (∼9 Å) N-methyldiethylenetriamine linkages. These features ensure protonation of the distamycin derivative either at the C-terminus for ligand 4 or at the N-terminus for ligand 5 at physiological pH. Photoirradiation at ∼330-340 nm of 1 mM DMSO solution required ∼3.5 h for 4 and ∼1.5 h for 5 to form ∼8/2 [E]/[Z] isomeric forms at photostationary state. The kinetics of photoisomerization and DNA binding nature of both photoisomerized forms (trans and cis) have been characterized by UV-vis, NMR, CD spectroscopy, thermal denaturation studies and Hoechst displacement assay. Greater difference in DNA binding affinity between two isomeric forms of short linker based azobenzene-distamycin conjugate has been achieved. The above fact has been proved by higher apparent DNA binding constant of cis form of 5 compared to the corresponding trans form. The short linker based conjugate is more appropriate in translating configurational change from azobenzene moiety to the end of peptide backbone unlike the one with flexible and long linker. Greater change achieved upon photoisomerization of the azobenzene-distamycin conjugates in cis-form of 5 might bring both distamycin arms in closer proximity and enhanced proximal hydrogen bonding contacts between ligand and DNA bases. At the same time the short spacer and most probably the position of positive charge on the oligopeptide backbone also influenced DNA binding of both distamycin arms in azobenzene-distamycin conjugates, 5 compared to either 1 or long spacer based ligand, 4. Both azobenzene-distamycin hybrid molecules are able to stabilize duplex poly [d(A-T)] motif by ∼14-18 oC more than the parent distamycin analogue, 1. Figure 4. Chemical structures of dimeric distamycins based on bis-carboxamido azobenzenes, 4 and 5. Chapter 4A. Design and Synthesis of Novel Distamycin-DAPER Covalent Conjugates. A Comparative Study on the Interaction of Distamycin, DAPER and their Conjugates with G-Quadruplex DNA To examine the effect of distamycin on the binding of DAPER to G4-quadruplex DNA structure, three novel conjugates of distamycin and DAPER were synthesized. The conjugates are designated as short linker (SL, 2) and long, flexible spacers (ML, 3 and LL, 4) (Figure 5). The efficiency of DAPER, distamycin and different covalent DAPER-distamycin conjugates in the formation and stabilization of both parallel (ODN1, d(TTGGGGTT)) and antiparallel (ODN2, d(GGGGTTTTGGGG)) G-quadruplex structures were evaluated by native PAGE assay, thermal denaturation experiment, absorption spectroscopy and extensive circular dichroism spectroscopic study. DAPER stabilized both parallel and antiparallel quadruplex structures, whereas distamycin analogue, 1 was found to interact only with parallel quadruplex structure at high ligand concentration. The lower ICD intensity near the DAPER absorption region and requirement of higher ligand concentration to saturate ligand binding on quadruplex surface indicate weak binding nature of DAPER-distamycin covalent conjugates in stabilizing G-quadruplex than DAPER. In this context distamycin was found to interfere with favorable DAPER-G-quadruplex interaction and such steric clash between DAPER and distamycin was more prominent with short spacer based conjugates, SL than the ones possessing longer spacer (dioxyethylenic or trioxyethylenic) based ligands, ML and LL. Figure 5. Chemical structures of distamycin derivative, 1, DAPER and distamycin-DAPER covalent conjugates (2-4). Chapter 4B. Structure-specific Recognition of Duplex and Quadruplex DNA Motifs by Hybrid Ligands: Influence of the Spacer Chain Here DAPER-distamycin covalent conjugates were targeted towards mixed duplex quadruplex motif using hybrid DNA (ODN3, d(CGCTTTTTTGCGGGGTTAGGG) and ODN4, d(CGCAAAAAAGCG)) sequences. In this regard we have chosen DAPER and 1:1 physical mixture of DAPER and distamycin, as reference molecules to compare the affinity and specificity of the covalent conjugates (SL, ML, LL) in stabilizing mixed duplex-quadruplex motif compared to either duplex or quadruplex structures. Simultaneous formation and stabilization of such hybrid duplex-quadruplex motif in the presence of various covalent DAPER-distamycin conjugates were studied by extensive gel electrophoresis, CD spectroscopy, thermal denaturation and UV-vis absorption experiments in the presence of both NaCl and KCl solutions. All these studies show greater efficiency and selectivity of conjugates possessing longer spacers (ML and LL) in stabilizing both duplex and quadruplex structures with ODN3/ODN4 DNA motif compared to single stranded ODN3 sequence. Here distamycin binding to the duplex motif encourages DAPER-quadruplex interaction and stabilizes both tetrameric and one isomeric form of dimeric quadruplex structure compared to the ligand with short spacer, SL and 1:1 physical mixtures of distamycin and DAPER (Scheme 1). Conjugate SL failed to target both duplex and quadruplex entity together as short spacer length did not allow simultaneous participation of both distamycin and DAPER moiety for optimal interaction with duplex and quadruplex structures concomitantly. Scheme 1a Possible modes of interactions between different DAPER-distamycin covalent conjugates with ODN3/ODN4 DNA sequences are depicted in Scheme 1. (For structural formula pl see the pdf file)