Memoria para optar al título de Química Farmacéutica / La Leucemia Linfoblástica Aguda (LLA) es la neoplasia más común en niños, siendo la 6-mercaptopurina (6-MP) una droga que cumple un rol fundamental para el tratamiento de esta neoplasia. Sin embargo, se han asociado al uso de esta droga una serie de efectos adversos. La presencia de polimorfismos presentes en genes que codifican enzimas involucradas en su metabolización, aparece como una de las principales causantes de los efectos adversos a 6-MP. Uno de los polimorfismos involucrados en el metabolismo de la 6-MP, corresponde a aquellos presentes en el gen TPMT*1 que codifica la enzima Tiopuril S-metiltransferasa (TPMT). Se han asociado a diversos polimorfismos en este gen, la presencia de concentraciones plasmáticas tóxicas de nucleótidos de tioguanina (TGNs), un metabolito de la 6-MP, aumentando el riesgo de desarrollar eventos adversos durante la terapia, lo que conduce al abandono o suspensión de la terapia, obligando a controlar o reducir las dosis recibidas de 6-MP en pacientes que presentan algún polimorfismo en el gen TPMT*1. El conocimiento de la prevalencia de este polimorfismo y su efecto en el tratamiento de la LLA ha permitido el desarrollo de una farmacogenética efectiva, mejorando sustancialmente la calidad de vida de los pacientes durante el tratamiento. Estudios previos de nuestro grupo permitieron encontrar la presencia de polimorfismos en el gen TPMT en un 8% de una población de 103 niños chilenos con LLA. En este trabajo se analizó la relación existente entre la presencia de polimorfismo en el gen TPMT*1 con los efectos adversos y la disminución de la dosis de 6-MP durante el periodo de mantención en el tratamiento de la LLA. El análisis de 35 pacientes con LLA atendidos en el Hospital Dr. Luis Calvo Mackenna muestra que se administra una dosis significativamente menor de 6-MP durante el periodo de mantención en los niños con LLA que presentan un alelo polimórfico del gen TPMT*1. Los resultados obtenidos apoyan el uso de una farmacogenética efectiva para el tratamiento de la LLA en nuestro país. / Acute lymphoblastic leukemia (ALL) is the most common malignancy in children. The drug 6-mercaptopurine (6-MP) plays a fundamental role in the treatment of this malignancy. However, a number of side effects have been associated with the use of this drug. The presence of polymorphisms in genes encoding enzymes involved in its metabolism, appears as a major cause of adverse effects of 6-MP. Several of the polymorphisms involved in the metabolism of 6-MP corresponds to those present in the gene encoding the TPMT*1 enzyme, Tiopuril S-methyltransferase (TPMT). Some of these have been associated with the presence of toxic plasma concentrations of thioguanine nucleotides (TGNs), metabolites of 6-MP. These metabolites increase the risk of adverse events during therapy, leading to the abandonment or suspension of therapy, and demand an increased control of 6-MP doses in patients with a polymorphism of this gene. Knowledge of the prevalence of this polymorphism and its effect on the treatment of ALL has allowed the development of an effective pharmacogenetic approach, substantially improving the quality of life of patients during treatment. Previous studies from our group found polymorphisms in the TPMT gene in 8% of a population of 103 Chilean children with ALL. In this work we analyzed the relationship between the presence of one polymorphism of the TPMT*1gene with the side effects and the decrease of the 6-MP dose during the treatment of ALL and the decrease of the 6-MP dose during maintenance treatment of ALL. The analysis of 35 patients with ALL treated at the Hospital Dr. Luis Calvo Mackenna shows that there is a significant decrease in the dose of 6-MP during maintenance in children with ALL with a polymorphic allele of the TPMT*1gene. The results support the use of an effective pharmacogenetics strategy for the treatment of ALL in our country.

Resumo não disponível

O gênero Phytomonas compreende parasitas cosmopolitas de plantas transmitidos por hemípteros. Não há estudos recentes sobre a taxonomia de Phytomonas e apenas duas espécies foram filogeneticamente validadas: P. serpens e P. françai. Até o momento 6 - 11 grupos (A-K) constituem esse gênero, dependendo do marcador molecular. O principal objetivo deste estudo foi caracterizar uma grande amostragem de isolados de Phytomonas de plantas e hemípteros com inferências filogenéticas de sequências de SSUrDNA, gGAPDH e ITSrDNA. Foi confirmado a subdivisão em 7 clados: Grupo A - 59 isolados de látex e insetos (Coreidae) de diferentes países. Grupo B - 7 isolados de látex e insetos (Scutelleridae e Pentatomidae) do Brasil e Suriname. Grupo C - 4 isolados de látex da Espanha. Grupo D - 11 isolados de Euphorbiaceae e Coreidae de diferentes países. Grupo E - 16 isolados de Solanaceae e Pentatomidae do Brasil. Grupo F - restrito a P. françai do Brasil. Grupo H - isolados de floema da América do Sul. Os resultados permitiram identificar candidatos a novas espécies de Phytomonas. / The Phytomonas genus is comprised by cosmopolitan plant´s parasites and is transmitted by Hemiptera. There are no recent studies based on the taxonomy of Phytomonas and only two species were phylogenetically validated: P. serpens and P. françai. To date this genus is constitute by 6 - 11 groups (A-K), depending on the molecular marker. The aim of this study was to characterize large samples of Phytomonas isolated from plants and Hemiptera throught phylogenetic inferences sequences SSUrDNA, gGAPDH and ITSrDNA. 7 Subclades was confirmed: Group A - 59 isolates of latex and insects (Coreidae) from different countries. Group B - 7 isolates of latex and insects (Scutelleridae and Pentatomidae) from Brazil and Suriname. Group C - 4 isolates of Spain latex. Group D - 11 isolates of Euphorbiaceae and Coreidae from different countries. Group E - 16 isolates of Solanaceae and Pentatomidae from Brazil. Group F - restricted to Brazilian P. françai isolates. Group H - Isolates of phloem from South America. Our results shown possible candidates for new species of Phytomonas.

Determinamos o comportamento destes mediadores em pacientes com insuficiência aórtica crônica importante ( IAo ). Materal e métodos:Analisamos 89 portadores de Insuficiência Aórtica crônica importante, média etária de 33,6±11,5 anos, 84,6% sexo masculino, 60% assintomáticos, todos de etiologia reumática . Os pacientes foram submetidos a avaliação clínica e ecocardiográfica. Os valores médios foram: diâmetro diastólico (DD ) do ventrículo esquerdo ( VE ) de 71,9±8,3mm e o diâmetro sistólico ( DS ) do VE de 50,4±9,3mm, e a fração de ejeção ( FE ) do VE de 0,64±0,11. Realizamos a dosagem de Fator de Necrose Tumoral ( TNF ), seus receptores solúveis tipo I e II ( sTNFRI e sTNFR II ) , Interleucina-6 ( IL-6 ), seu receptor ( IL-6R), interleucina 1-beta ( IL-1beta ) , seu antagonista ( IL1-RA ) e endotelina-1 ( ET-1 ). Comparamos com níveis séricos de controles saudáveis. Conjuntamenete analisamos o polimorfismo genético do gene do TNF, localizado a -308 pares de bases do sítio de iniciação. Resultados: Os níveis séricos de TNF forma significativamente maiores em pacientes com IAo do que em controles normais ( 92,65±110,24 pg/ml contra 1,67±1,21 em controles normais, p < 0,001 ). Tiveram comportamentos similares os níveis séricos de sTNFRI ( 894,75±348,87pg/ml vs 521,42±395.13pg/ml em controles, p=0,007 ) e IL-6 ( 7,17±7,78pg/ml vs 0,81±0,38pg/ml, p=0,0001 ). Observamos correlação significativa entre níveis de sTNFRII e DDVE ( r=-0,329, p=0,038 ) e DSVE ( r=-0,352, p=0,027). Não observamos relação de níveis séricos de citocinas com sintomas. As outras citocinas não guardaram relação com parâmetros de gometria e função ventricular. A presença do alelo 2 do polimorfismo genético do TNF associou-se a paciente assintomáticos com IAo. Conclusão: Demonstramos níveis elevados de citocinas proinflamatórias em pacientes com IAo em relação a controles normais. Os níveis de sTNFRII diminuem com o aumento dos diâmetros ventriculares. A presença do alelo 2 do polimorfismo -308 do TNF associa-se a pacientes assintomáticos com IAo / Background - Proinflamatory cytokines are implied in the phisiopatology of heart failure secoundary to ischaemic or idiophatic dilated cardiomiopathy, but there are few studies regarding these mediators in valular heart disease. We determined the behaivour of proinflamatory cytokines and their antagonists in patients with chronic severe aortic regurgitation ( IAo ) Methods - We analised 89 patients with IAo mean age 33.6±11.5 years, 84.6% male, 60% asymptomatic, all of rheumatic etiology. Patients were evaluated clinnicaly and by echocardiography. Mean values were : left ventricular ( LV ) diastolic diameter ( DD ) 71.9±8.3mm, LV systolic diameter ( SD ) 50.4±9.3mm and ejection fraction 0.64±0.11. We made the plasma dosages of tumor necrosis factor-alpha ( TNF ), its soluble receptors type I and II ( sTNFRI and sTNFR II ) , Interleukin 6 ( IL-6 ) and its receptor ( IL-6R ), Interleukin 1-beta ( IL-1beta ) , its antagonist ( IL1-RA ) and endothelin-1 ( ET-1 ). Plasma levels were compared to healthy controls. We also analysed the TNF gene polimorphism, located at - 308 base pairs from the initation site. Results - Plasma TNF levels were significantly increased in IAo patients in telation to normal controls (92.65±110.24 pg/ml vs 1.67±1.21 pg/ml in controls, p < 0.001 ). Similar behaivour was observed with IL-6 (7.17±7.78pg/ml in IAo patients vs 0,81±0,38pg/ml in controls , p=0.0001 ) and sTNFRI (894.75±348.87pg/ml vs 521.42±395.13pg/ml in controls, p=0,007 ). We observed and significant relation between sTNFRII levels and LVDD ( r=-0,329, p=0,038 ) e LVSD ( r=-0,352, p=0,027). Levels of cytokines were similar in asymptomatic and sympromatic patients and the other cytokines had no relation to ventricular diameters or function. Presence of the alele 2 of the -308 TNF polimorphism was associated to asymptomatic patients. Conclusion - We showed increased plasma levels of proinflamatory cytokines in patients with IAo in relation to normal controls. There was an decrease of sTNFRII levels with increase in ventricular diameters. The presence of the alele 2 of the -308 TNF polimorphism was associated to asymtomatic patients

A hérnia inguinal é uma doença multifatorial que emerge do orifício de Fruchaud, fechado somente pela fáscia transversal. Nos últimos tempos tem sido demonstrado que desordens dos elementos do tecido conjuntivo, como fibras colágenas e elásticas, estão relacionados com a gênese da hérnia inguinal. Estudos prévios demonstraram alterações estruturais e quantitativas das fibras elásticas com o envelhecimento da fáscia transversal, relacionado ao aparecimento de hérnia inguinal a partir da quinta década da vida. Estudos recentes demonstraram associação entre uma mutação pontual do éxon 20 do gene da elastina, componente amorfo das fibras elásticas, e hérnia inguinal em indivíduos do sexo masculino. A fibrilina-1 é o principal componente microfibrilar das fibras elásticas e está relacionada ao surgimento de síndromes genéticas, como Marfan, Ehlers-Danlos e Williams, que também apresentam indivíduos portadores de hérnias. Nesse sentido, o objetivo do presente estudo foi investigar a presença de polimorfismos no gene da fibrilina-1 (FBN1) em indivíduos portadores de hérnia inguinal. Estudou-se o ácido desoxirribonucléico (DNA) genômico de 60 pacientes com hérnia inguinal e 60 controles. Os exons 4, 13, 24, 25, 26, 27, 31 32, 39, 41, 59 e 65 foram amplificados pela Reação em Cadeia da Polimerase e, posteriormente, foram avaliados os polimorfismos em gel de poliacrilamida. Todos os exons estudados apresentaram alguns indivíduos com padrão de bandeamento diverso. O produto de amplificação destes exons foi então avaliado através de seqüenciamento e confrontado com a base de dados do National Human Genome Research Institute. Alterações de inserção e/ou deleção consistentes foram observadas no éxon 27: 1) inserção de uma base entre os codons 1119 e 1120 (GAT -> AGA); 2) inserção de uma base entre os codons 1116 e 1117 (TGT -> CTG): 3) inserção de uma base no códon 1148 (CCC -> CGC); e no éxon 31: inserção de uma base entre os codons 1282 e 1283 (GAG -> CGA). Não houve significância estatística que indique associação entre o gene FBN1 e hérnia inguinal. Entretanto, como o gene da fibrilina-1 é bastante grande (350 kD, dividido em 65 exons) e, em outras doenças como a Síndrome de Marfan mais de 500 mutações já foram descritas, sem haver exons que possuam uma maior responsabilidade pela Síndrome, é possível que outros exons possam estar relacionados com o acometimento da hérnia inguinal. / The inguinal hernia is a multifactorial disease that emerge from the Fruchaud orifice, closed only by the transversalis fascia. Lately it has been showed that disorders on the connective tissue elements, as the collagen and elastic fibers, are related to the inguinal hernia genesis. Previous studies have showed structural and quantitative changes of the elastic fibers at the transversalis fascia with aging, that may be related to inguinal hernia at the fifth decade of life. Recent studies have demonstrated an association among a punctual mutation on exon 20 of the elastin gene, amorfous component of the elastic fibers, and male individuals with inguinal hernia. The fibrillin-1 is the main microfibrillar component of the elastic fibers and is associated to genetic syndromes as Marfan, Ehlers-Danlos and Williams, that also present inidividuals with hernias. Thus, the objective of this study was to investigate the presence of polymorphisms on the fibrillin-1 gene (FBN1) on individuals who developed inguinal hernia. The desoxirribonucleic acid (DNA) of 60 individuals with inguinal hernia and 60 controls have been studied. The exons 4, 13, 24, 25, 26, 27, 31, 32, 39, 41, 59 and 65 were amplyfied by the Polymerase Chain Reaction and later evaluated the polymorphisms on polyacrilamide gel. The amplification product of these exons were evaluated by DNA sequencing and compared to the National Human Genome Research Institute database. Consistent mutations were observed at exon 27: 1) insertion of a base between codons 1119 and 1120 (GAT -> AGA); 2) insertion of a base between codons 1116 and 1117 (TGT -> CTG); 3) insertion of a base on codon 1148 (CCC -> CGC); and at exon 31: insertion of a base between codons 1282 and 1283 (GAG -> CGA). There was no statistic significance that could indicate the association between FBN1 gene and inguinal hernia. However, FBN1 is a large gene (350 kD, shared in 65 exons) and in other disorders as Marfan Syndrome, more than 500 mutations have already been described, without the existence of prevalent exons that have major responsability about the Syndrome, it is possible that other exons could be related to the happening of inguinal hernia.

O nascimento de gêmeos na espécie humana é rodeado por muitos mistérios e, há bastante tempo, desperta a curiosidade tanto leiga quanto científica. Os estudos com gêmeos vêm contribuindo para o entendimento de diversas áreas da biologia humana; porém, aspectos epidemiológicos e etiológicos relacionados aos nascimentos gemelares em si permanecem pouco elucidados. Para além de mera curiosidade, pesquisas nessa área podem ajudar a compreender mecanismos relacionados à reprodução em geral, além de serem importantes em um contexto de saúde pública, já que a gestação gemelar representa riscos adicionais à mãe e à prole. Em países industrializados observa-se um aumento acentuado nas taxas gemelares (TGs) que parece estar relacionado ao aumento da idade materna na primeira gravidez e tecnologias de Reprodução Medicamente Assistida (RMA). No Brasil, os aspectos geográficos e sociodemográficos dos nascimentos gemelares ainda não foram profundamente estudados. Assim, este estudo objetivou responder a três questões principais relacionadas aos nascimentos de gêmeos: “Quantos?” “Onde? e “Como?”, isto é, considerando aspectos epidemiológicos e etiológicos. Para o estudo epidemiológico, desenhamos um estudo de base de dados populacional e investigamos as TGs em duas dimensões: espacial e temporal. Para isso, utilizamos dados provenientes do Sistema de Informações sobre Nascidos Vivos (SINASC) e analisamos mais de 41 milhões de nascimentos que ocorreram em todos os 5.565 municípios brasileiros entre 2001 e 2014. Encontramos uma TG nacional média de 9,41 por 1.000 nascimentos e o modelo de análise de séries temporais revelou tendência de aumento global ao longo do período estudo, mas com notáveis diferenças regionais. De fato, resultados da “Análise de Cluster e Outlier” (Anselin Local Moran’s I) revelaram concentração de municípios com altas TGs em uma área que vai do sul do Nordeste brasileiro até o Rio Grande do Sul (Global Moran Index = 0.062, P < 0.001). Além disso, encontramos correlação positiva entre o Índice de Desenvolvimento Humano (IDH) local e as TGs em diferentes cenários, sugerindo que o IDH pode ser um importante indicador de RMA no Brasil. Nossas análises também revelaram aumento de 26.42% na TG entre as mulheres com mais de 44 anos durante o período estudado. A tendência de aumento temporal encontrada para algumas regiões do país está de acordo com o que é observado em outros países industrializados, enquanto que a análise geográfica revelou duas situações bem distintas dentro do Brasil. Por sua vez, os 9 estudos acerca da etiologia dos nascimentos de gêmeos foram concentrados em investigar polimorfismos de nucleotídeo único (SNPs) em mães de Cândido Godói (CG), uma pequena cidade do Sul do Brasil conhecida como a “Cidade dos Gêmeos”. Este título é devido à alta TG observada no município e à recorrência do traço nas famílias locais, com forte descendência europeia. Nós desenhamos um estudo caso-controle e genotipamos sete SNPs relacionados à foliculogênese (rs6166:C>T em FSHR, rs11031006:G>A próximo a FSHB, e rs17293443:T>C in SMAD3) ou a gestações de sucesso (rs1801131:T>G e rs1801133:G>A em MTHFR, rs2010963:C>G em VEGFA, e rs1800629:G>A em TNF) em 44 mães de gêmeos (casos) e 102 mães de filhos únicos (controles), todas residentes de CG. Para todos os SNPs, a distribuição das frequências alélicas e genotípicas foi similar entre casos e controles. Diferentes combinações de alelos de risco e análises haplotípicas também foram homogeneamente distribuídas entre ambos os grupos. Assim, estes resultados sugerem uma ausência de associação entre os nascimentos gemelares em CG e sete SNPs relacionados à foliculogênese ou a gestações de sucesso, mas é possível que outras variantes genéticas ligadas a ambos os processos possam estar envolvidas neste fenômeno que possui uma base genética subjacente. / The birth of twins in human species is surrounded by many mysteries and it has long aroused both lay and scientific curiosity. Studies with twins have contributed to the understanding of several areas of human biology; however, the epidemiological and etiological aspects related to twin births by themselves remain unclear. Beyond mere curiosity, research in this field may help us to understand the mechanisms related to reproduction in general, and it is important in a public health context since a twin pregnancy represents additional risks to the mother and offspring. Some countries have reported a striking increase in twinning rates (TRs), which seems to be related mainly to delayed childbearing and to Medically-Assisted Reproduction (MAR) technologies. In Brazil, the epidemiological scenario of twin births has not been studied while considering its territorial and sociodemographic magnitude. Therefore, this study aimed to answer three main questions related to twin births: "How many?", “Where” and "How?", that is, we investigated twinning in light of epidemiology and etiology. For the epidemiological study, we carried out a population-based study, investigating twin births in two dimensions: spatial and temporal. For that, we used data from Brazil’s Live Birth Information System (SINASC), and we analyzed over 41 million births that occurred in all 5,565 Brazilian municipalities between 2001 and 2014. We found an average TR of 9.41 per 1,000, and a first-order autoregressive model of time-series analysis revealed a global upward trend over time, but with important regional differences. In fact, a Cluster and Outlier Analysis (Anselin Local Moran’s I) was performed and identified clusters of high TR in an area stretching from the south of Brazil’s Northeast Region to the South Region (Global Moran Index = 0.062, P < 0.001). Furthermore, we found a positive correlation between the local Human Development Index (HDI) and TRs in different scenarios, suggesting that the HDI may be an important proxy indicator of MAR in Brazil. We also found a sharp increase (26.42%) in TR in women aged over 44 years. The upward temporal trend in TRs is in line with recent observations from other countries, whereas the spatial analysis revealed two very different realities within our country. In turn, studies on the etiology of twin births were focused on single nucleotide polymorphisms (SNPs) in mothers from Cândido Godói (CG), a small southern Brazilian city known as the "Twin’s Town”. This title is due to the high TR attributed to the municipality and to the recurrence of the twin trait through the 11 local families, who have a strong European descent. We performed a case-control study and genotyped seven SNPs related to folliculogenesis (rs6166:C>T in FSHR, rs11031006:G>A near FSHB, and rs17293443:T>C in SMAD3) and to a successful pregnancy (rs1801131:T>G and rs1801133:G>A in MTHFR, rs2010963:C>G in VEGFA, and rs1800629:G>A in TNF) in 44 mothers of twins (cases) and 102 mothers of singletons (controls), all of them from CG. For all SNPs, the distributions of the genotypic and allelic frequencies were similar between the cases and controls. Different combinations of risk alleles and haplotypic analyses were also homogeneously distributed between both groups. Thus, these results suggest a lack of association between twin births in CG and seven SNPs related to folliculogenesis or successful pregnancies, but it is possible that other genetic variants linked to both processes may be involved in this phenomenon, which has an underlying genetic basis.

Objetivo: Determinar la asociación entre la presencia de polimorfismos del gen CYP1A1 y la presencia de cáncer cervical. Material y métodos: Se realizó una investigación analítica y descriptiva. La búsqueda de información se realizó en base de datos como Lilacs, MEDLINE, entre otros, utilizando los siguientes términos MeSH: "Polymorphism, Genetic" AND "Cytochrome P450 CYP1A1"AND "Uterine Cervical Neoplasms". Se analizó los datos y resultados mediante estadística descriptiva y el riesgo de sesgo con el enfoque Cochrane. Resultados: El análisis de los artículos revisados, permite conocer, que, en cada uno de las investigaciones realizadas, se obtuvieron medidas de asociación diferentes. En India, China, México y Alemania al menos uno de los polimorfismos investigados se asocia con la presencia de cáncer cervical, mientras que en el resto de investigaciones no son concluyentes. Conclusiones: La asociación entre los polimorfismos rs1048943 y rs4646903 con el cáncer cervical, no es absoluta, depende de factores ambientales, étnicos, infección por VPH y otros. Se determinó la existencia de sesgos estadísticos debido a la falta de análisis de regresión logística multivariada.

Made available in DSpace on 2011-05-04T12:36:24Z (GMT). No. of bitstreams: 0 Previous issue date: 2010 / A silicose é uma pneumoconiose provocada pela inalação da poeira de sílica e consiste em uma lesão pulmonar com participação de citocinas como o Fator de Necrose Tumoral alfa (TNF-a). Há dois polimorfismos nos sítios -238 e -308 do promotor do gene da TNF-a (substituição de uma guanina por uma adenina) que têm sido investigados como possíveis fatores de susceptibilidade para a silicose. A mutação na posição -308 tem sido associada com altos níveis da citocina no sangue, enquanto que a posição -238, com formas mais graves da doença. A exposição ocupacional à sílica continua sendo um problema de Saúde Pública no Brasil. O Centro de Estudos de Saúde do Trabalhador e Ecologia Humana (CESTEH)/FIOCRUZ acompanha trabalhadores do Rio de Janeiro expostos à sílica. Este trabalho teve como objetivo a implementação de uma metodologia para determinação do polimorfismo dos sítios -308 e -238 do promotor da TNF-a para futura utilização na avaliação da exposição à sílica. A genotipagem foi feita através da técnica de PCR-RFLP (Polymerase Chain Reaction Restricition Fragment Length Polymorphism) usando NcoI para -308 e BamHI para -238. Foram realizados ensaios para a implementação da metodologia, sendo esta aplicada em uma amostra populacional de 79 trabalhadores assistidos no ambulatório do CESTEH, sendo todos do sexo masculino e maiores de 18 anos. (...) Nesse estudo, demonstrou-se que a presença do alelo mutante (A) está associada a maiores quantidades da citocina no sangue. Não foram encontradas diferenças significativas entre as médias da enzima GST e a presença ou não do alelo mutante. A presença do alelo -308A apresentou ainda um risco relativo de 3,697 para o desenvolvimento de silicose. A implementação de um método toxico genético permite a identificação de possíveis determinantes de suscetibilidade individual ao desenvolvimento da doença, aumentando o alcanço das avaliações da saúde do trabalhador. / Silicosis is a pneumoconiosis caused by inhalation of silica dust and consists of a lung injury with participation of cytokines, such as Tumor Necrosis Factor alpha (TNF- ). There are two polymorphisms at sites -238 and -308 of the gene promoter in TNF- (replacement of a guanine-adenine), which have been investigated as possible factors of susceptibility for silicosis. The mutation at positon -308 has been associated with high levels of cytokine in the blood, while at -238 with severe forms of the disease. Occupational exposure to silica remains a public health problem in Brazil. The Center for Studies on Workers' Health and Human Ecology (CESTEH) / FIOCRUZ follows Rio de Janeiro's workers exposed to silica. This study aimed to implement a methodology for determining the polymorphism of sites -308 and -238 of the promoter of TNF- for future use in the assessment of exposure to silica. Genotyping was made by PCR-RFLP (Polymerase Chain Reaction – Restricition Fragment Length Polymorphism) using NcoI for -308 and BamHI for -238. Tests were performed for implementing the methodology, which was applied in 79 employees assisted by CESTEH, all male and aged over 18. After the tests, the following conditions were fixed for both sites: 100ng of DNA, extracted from 500μL of whole blood, were used as template for PCR with 1.5 U of Taq-DNA Polymerase Recombinant and a final volume of 50μL. The primers were: 5'AGGCAATAGGTTTTGAGGGCCAT and 5'TCCTCCCTGCTCCGATTCCG as sense and antisense to -308 and 5'AAACAGACCACAGACCTGGTC and 5'CTCACACTCCCCATCCTCCCGGATC to -238. The PCR parameters for -308 site were: 35 cycles using 94ºC/40s, 58ºC/90s and 72ºC/60, generating a fragment of 107 pb. The PCR parameters for -238 site were; 35 cycles using 94ºC/40s, 58ºC/90s and 72ºC/60s, generating a fragment of 165 pb. The digestion was made with 5U of endonuclease for 1mg of DNA incubated at 37°C for 1 hour. Individuals with the mutant allele lose the site which is attacked by the restriction enzyme. Workers genotyped for the -308 site showed 16.4% (n = 13) for the GA genotype, 82.3% (n = 65) for GG and 1.3% (n = 1) for the genotype AA. The -238 site showed the frequencies of 2.3% (n = 2) for GA, 97.7% (n = 77) for GG and zero for AA. This study shows that the presence of the mutant allele (A) is associated with greater amounts of cytokine in the blood. There were no significant differences between the means of the enzyme GST and the presence of the mutant allele. The presence of the -308 mutant allele also showed a relative risk of 3,697 for the development of silicosis. The implementation of a toxicogenetic method allows the identification of possible determinants of individual susceptibility to disease development, increasing the reach of the evaluations of occupational health.

Made available in DSpace on 2011-05-04T12:36:31Z (GMT). No. of bitstreams: 0 Previous issue date: 2010 / A sílica é um composto natural formado pelos dois elementos mais abundantes na Terra - oxigênio e silício. A exposição a partículas de sílica cristalina induz a uma inflamação pulmonar crônica, que pode evoluir para fibrose pulmonar, acarretando na doença conhecida como silicose. O estresse oxidativo desempenha um papel importante na patogênese desta fibrose pulmonar. Sendo assim, a expressão de genes antioxidantes, como glutationa S-transferases (GSTs), são importantes componentes de proteção das células contra o estresse oxidativo e são conhecidas como genes altamente polimórficos, podendo contribuir para a susceptibilidade a silicose. O polimorfismo da GSTP1 A/G resulta na substituição do aminoácido isoleucina por valina, diminuindo, substancialmente, a atividade da enzima GSTP1. O estudo teve como objetivo a determinação do polimorfismo da enzima GSTP1 em trabalhadores expostos à sílica e associação com silicose. A população foi composta por 82 trabalhadores expostos à sílica oriundos, principalmente, da indústria naval. O polimorfismo da GSTP1 foi analisado por PCR-RFLP. Como resultado verificou-se que 31,6 por cento dos trabalhadores tinham genótipo A/A, 57,9 por cento A/G e 10,5 por cento G/G. Observou-se que a média da atividade enzimática da GST foi menor (1,58 U/mL enzima) em indivíduos com o alelo G em relação ao alelo A (1,84 U/mL de enzima). Trabalhadores expostos à sílica portadores do alelo G mostraram um maior risco de desenvolver silicose, embora os resultados não tenham sido significativos, provavelmente, em função do universo amostral. Os indivíduos portadores do alelo G tiveram níveis menores na atividade da GST, independente do genótipo das enzimas GSTM1 e GSTT1. Em conclusão, estudos adicionais devem ser realizados para determinar o polimorfismo da GSTP1 em populações expostas à sílica em comparação com populações não-expostas, pois os resultados deste trabalho sugerem a utilização da determinação do polimorfismo da GSTP1, no processo de avaliação da exposição à sílica, como uma ferramenta complementar na identificação de subgrupos mais susceptíveis ao desenvolvimento da doença silicose. / Sílica is the natural compound of the two most abundant elements on Earth - oxygen and silicon. Exposure to crystalline silica particles induces chronic lung inflammation, which may progress to lung fibrosis, a disease known as silicosis. The oxidative stress plays an important role in the pathogenesis of pulmonary fibrosis. In this respect, the expression of antioxidant genes such as glutathione S-transferases (GSTs) are important to protect cells from oxidative stress and they are known as highly polymorphic genes, that may contribute to silicosis susceptibility. The GSTP1 A G polymorphism results in amino acid substitution isoleucine for valine which substantially diminishes GSTP1 enzyme activity. The objetive of study was the determination of enzyme GSTP1 polymorphism in workers exposed to silica and association with silicosis. The population was composed of 82 workers exposed to silica coming mainly from the shipbuilding industry.GSTP1 polymorphism was analyzed by PCR-RFLP. As a result it was found that 31,6% of workers had genotype A/A, 57,9% A/G and 10.5% G/G. It was observed that the mean enzyme activity of GST was lower (1.58 U / mL enzyme) in individuals with allele G compared with allele A (1.84 U / mL enzyme). Workers exposed to silica with allele G showed a higher risk of developing silicosis, although the results had not been significant, probably because of sample size. Individuals with allele G had lower levels of GST activity, independent of the genotype of GSTM1 and GSTT1 enzymes. In conclusion, further studies to determine the polymorphism of GSTP1 should be conducted in populations exposed to silica compared with non-exposed populations, because the results in this paper suggest the use of the determination of the polymorphism of GSTP1, in the process of evaluating the exposure to silica, as a complementary tool in the identification of subgroups more likely to develop the disease silicosis. / Sílica is the natural compound of the two most abundant elements on Earth - oxygen and silicon. Exposure to crystalline silica particles induces chronic lung inflammation, which may progress to lung fibrosis, a disease known as silicosis. The oxidative stress plays an important role in the pathogenesis of pulmonary fibrosis. In this respect, the expression of antioxidant genes such as glutathione S-transferases (GSTs) are important to protect cells from oxidative stress and they are known as highly polymorphic genes, that may contribute to silicosis susceptibility. The GSTP1 A G polymorphism results in amino acid substitution isoleucine for valine which substantially diminishes GSTP1 enzyme activity. The objetive of study was the determination of enzyme GSTP1 polymorphism in workers exposed to silica and association with silicosis. The population was composed of 82 workers exposed to silica coming mainly from the shipbuilding industry.GSTP1 polymorphism was analyzed by PCR-RFLP. As a result it was found that 31,6% of workers had genotype A/A, 57,9% A/G and 10.5% G/G. It was observed that the mean enzyme activity of GST was lower (1.58 U / mL enzyme) in individuals with allele G compared with allele A (1.84 U / mL enzyme). Workers exposed to silica with allele G showed a higher risk of developing silicosis, although the results had not been significant, probably because of sample size. Individuals with allele G had lower levels of GST activity, independent of the genotype of GSTM1 and GSTT1 enzymes. In conclusion, further studies to determine the polymorphism of GSTP1 should be conducted in populations exposed to silica compared with non-exposed populations, because the results in this paper suggest the use of the determination of the polymorphism of GSTP1, in the process of evaluating the exposure to silica, as a complementary tool in the identification of subgroups more likely to develop the disease silicosis.

O sistema nervoso (SN) autonômico é fundamental na regulação cardiovascular. A análise da variabilidade da freqüência cardíaca (VFC), no domínio do tempo e da freqüência, expressa a modulação autonômica cardíaca, pois reflete a atividade do SN simpático (receptores adrenérgicos) e do SN parassimpático (receptores muscarínicos) sobre Nó Sinoatrial. As variantes genéticas funcionais (polimorfismos) do receptor adrenérgico beta2 vêm sendo associadas a diferentes estados funcionais do receptor e a diversos fenótipos cardiovasculares. Investigamos em 218 de jovens normotensos (entre 18 a 30 anos) a associação dos polimorfismos do receptor adrenérgico beta2 tipo Gln27Glu (Gln/Gln, Gln/Glu e Glu/Glu) e tipo Arg16Gly (Arg/Arg, Arg/Gly e Gly/Gly) com o perfil antropométrico e com os fenótipos cardiovasculares: o balanço autonômico para o coração (análise da VFC), a noradrenalina sérica, e variáveis hemodinâmicas, que foram registradas durante o repouso (5min) e o tilt test (teste de estresse postural, 5 min). Resultados: polimorfismo beta2 tipo Gln27Glu - comparados aos portadores do genótipo Gln/Gln, os indivíduos com genótipos Glu/Glu e Gln/Glu apresentaram uma menor relação cintura/quadril (p=0,008) e uma maior atividade simpática em resposta ao tilt teste, ou seja, maior aumento do componente LF (p=0,027) e maior relação LF/HF (p=0,014); polimorfismos beta2 tipo Arg16Gly - portadores do genótipo Arg/Arg apresentaram maior queda do índice alfa durante o tilt test, comparados aos outros genótipos; associação de polimorfismos (haplótipos) - portadores do haplótipo Gln27Gln/Arg16Gly apresentaram maior incremento da FC quando comparados aos portadores dos haplótipos Gln27Gln/Gly16Gly (p=0,06). Conclusão: foi possível detectar que os polimorfismos do receptor adrenérgico beta2 tipo Gln27Glu e tipo Arg16Gly têm impacto sobre o balanço autonômico cardíaco, respectivamente, aumentando a atividade simpática para o coração e diminuindo a atividade baroreflexa durante manobra de estresse postural, em indivíduos jovens normotensos / The autonomic nervous system (NS) has a pivotal role in cardiovascular control. Time domain and spectral analyzes of heart rate variability (HRV) indicates cardiac autonomic modulation, since it reflects the sympathetic (adrenergic receptors) and parasympathetic (muscarinic receptors) nerve activity over the Sinoatrial Node. Polymorphisms of the adrenergic receptor beta2 have been associated to different functional state of receptor and cardiovascular phenotypes. We analyzed in 218 young normotensive subjects (18-30 years old) the association of polymorphisms of the adrenergic receptor type Gln27Glu (Gln/Gln, Gln/Glu e Glu/Glu) and type Arg16Gly (Arg/Arg, Arg/Gly e Gly/Gly) with anthropometric data and cardiovascular phenotypes: cardiac autonomic balance (HRV), norephinefrine levels, and hemodynamic parameters, which were registered during rest (5min) and tilt test (5 min). Results: beta2 polymorphism type Gln27Glu - compared to subjects with genotype Gln/Gln, subjects with genotype Glu/Glu e Gln/Glu showed a lower WHR (p=0,008) and a higher increase in sympathetic activity during tilt teste, i.e., a higher increase in LF component (p=0,027) and LF/HF relation (p=0,014); beta2 polymorphism type Arg16Gly - subjects with genotype Arg/Arg demonstrated a higher decrease in alpha index during tilt test, compared to other genotypes; polymorphism association (haplotype) - subjects with Gln27Gln/Arg16Gly had a higher increase in hear rate compared to subjects with haplotype Gln27Gln/Gly16Gly (p=0,06). Conclusion: it was possible to detect in young normotensive subjects that polymorphisms of the adrenergic receptor type Gln27Glu and type Arg16Gly have an impact over cardiac autonomic balance, respectively, increasing the cardiac sympathetic activity and decreasing the baroreflex sensibility during tilt test