Orientador: Antonio Carlos Maringoni / Banca: Antonio Carlos Maringoni / Banca: Roberto Lyra Villas Boas / Banca: Julio Rodrigues Neto / Banca: Silvania Furlan de Oliveira / Banca: Ivan Paulo Bedendo / Resumo: Este trabalho visou avaliar a ocorrência da bactéria Curtobacterium flaccumfaciens pv. flaccumfaciens em lavouras de feijoeiro localizadas em alguns municípios do Estado de Santa Catarina nas safras 2002/03 e 2003/04; a reação de genótipos de feijoeiro à murcha-de-curtobacterium; e o efeito de doses de nitrogênio (N) e potássio (K) sobre a severidade da doença, peso da matéria seca e o conteúdo de diversos nutrientes na parte aérea das cultivares IAC Carioca Pyatã, IPR 88 - Uirapuru e SCS 202 - Guará. Foram coletadas plantas com sintoma de murcha em lavouras de feijoeiro em 12 municípios. Posteriormente, procedeu-se ao isolamento, à purificação e à caracterização da bactéria e aos testes de patogenicidade. Aos 10 dias após a semeadura, plântulas de 24 genótipos de feijoeiro, conduzidas em casa-de-vegetação, foram inoculadas com o isolado FJ 36. A severidade da murcha-de-curtobacterium foi avaliada, a cada cinco dias, até aos 25 dias após a inoculação. Tanto no experimento que avaliou o efeito do N (uréia) quanto do K (cloreto de potássio) na severidade da doença, empregou-se a dose recomendada pela análise de solo e variações de 25 e 50 % abaixo e acima da mesma. Foi coletada a parte aérea das plantas antes e após as adubações, aos 25 DAS, para se aferir o peso da matéria seca e o conteúdo de N, fósforo (P), K, cálcio (Ca) e magnésio (Mg). Constatou-se que C. f. pv. flaccumfaciens esteve presente em plantas cultivadas nos municípios de Campos Novos, Faxinal dos Guedes, Guatambu, Ipuaçu, Ponte Serrada e Tigrinhos. Dos genótipos avaliados, somente as cultivares IAC Carioca Akytã, IAC Carioca Aruã e IAC Carioca Pyatã, considerados como padrões de resistência à doença, apresentaram-se com as menores notas de severidade média e valores de área abaixo da curva do progresso da murcha-de-curtobacterium (AACPMC)... (Resumo completo, clicar acesso eletrônico abaixo). / Abstract: This work aimed evaluate the occurrence of the bacteria Curtobacterium flaccumfaciens pv. flaccumfaciens in common bean fields of Santa Catarina State, during the harvest of 2002/03 and 2003/04; the reaction of bean genotypes to the bacterial wilt; and the effect of nitrogen (N) and potassium (K) levels on the severity of the disease, the weight of the dry mass and the content of nutrients I nthe aerial part of the cultivars IAC Carioca Pyatã, IPR 88 - Uirapuru and SCS 202 - Guará cultivars. Plants with symptoms of wilt were collected in bean fields of 12 cities. It was made the isolation, purification and cultural characterization of the bacteria and the procedures to fulfill the Kochþs postulates. The inoculation with the strain FJ 36 was done in the 10th day after the sow of 24 common bean genotypes, under greenhouse conditions. The bacterial wilt severity was evaluated, in each five days, until the 25th day after inoculation. It was adopted as treatments the recommended level of N (urea) and K (potassium chloride), by the soil analysis, as well levels 25% and 50% under and below it. The aerial part of the plants was collected before and after the fertilizations, to determine the weight of the dry mass and the content of N, phosphorus (P), K, calcium (Ca) and magnesium (Mg). Curtobacterium flaccumfaciens pv. flaccumfaciens was detected in plants cultivated in Campos Novos, Faxinal dos Guedes, Guatambu, Ipuaçu, Ponte Serrada and Tigrinhos. Regarding the evaluated genotypes, only the cultivars IAC Carioca Akytã, IAC Carioca Aruã e IAC Carioca Pyatã, considered as patterns of resistance, had the lower values of average severity and area under the bacterial wilt progress curve (AUBWPC). However, although to have been considered susceptible, the cultivars SCS 202 - Guará and IPR Graúna showed relatively low values of AUBWPC... (Complete abstract, click electronic address below). / Doutor

Submitted by (lucia.rodrigues@ufrpe.br) on 2016-10-19T14:01:53Z No. of bitstreams: 1 Liliana Andrea dos Santos.pdf: 813903 bytes, checksum: 14125d7515e4b40b82521f950f227906 (MD5) / Made available in DSpace on 2016-10-19T14:01:53Z (GMT). No. of bitstreams: 1 Liliana Andrea dos Santos.pdf: 813903 bytes, checksum: 14125d7515e4b40b82521f950f227906 (MD5) Previous issue date: 2015-07-31 / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - CAPES / The composting process is a microbial biotransformation used as an alternative for the adequate destination of the crop residues. It is a simple, economic and efficient technique for the treatment and stabilization of these residues and minimizes the environmental impacts in soil, air and water besides eliminates plant and human pathogens. The goals of this work were to investigate the survival of a mutant of phytobacteria Ralstonia pseudosolanacearum (CRMRS74Rif) in tomato crop residues during composting process and analyze the quality of the organic compound in relation to physical, chemical and microbiological variables. Three composting piles were made of tomato and napier grass crop residues plus ovine manure. Then, nine mesh bags with 10 g of infected tomato plants were placed in each pile, three at each depth of 20, 40 and 60 cm. Piles were turned over after 10, 20 and 30 days when evaluations of bacterial survival were made. At the end of the composting process, we quantified microbial population, antagonism against R. pseudosolanacearum, total phenolic content and compost quality. At the first evaluation (10 days) CRMRS74Rif were not recovered in culture medium, indicating that it was already eliminated of the infected material. Total bacteria were present in high populations in the compound, ranging from 7.0 x 1012 to 2.0 x 1016 CFU/g of compound, and the fluorescent Pseudomonas were the most frequent. Sixty-two isolates showed antagonistic activity against R. pseudosolanacearum CRMRS74Rif, detected by the inhibition halo formation. However, only 32 isolates maintained the antagonism in a second in vitro assay. The fungal population ranged from 3.2 x 102 to 1.2 x 103 CFU/g of compound. Based on morphological structures 40 isolates were identified at genus level: Aspergillus spp., Cladosporium spp., Curvularia spp., Fusarium spp., Paecilomyces spp., Trichoderma spp., and the Oomycete Pythium sp. Among these isolates, nine produced toxic metabolites and inhibited the pathogen growth with halos ranging from 15 to 23 mm. The total population of actinomycetes in compound ranged from 3.8 to 9.5 x 104 CFU/g of compound and based on cultural characteristics 33 isolates were selected for the antagonistic tests. Among them, four produced toxic metabolites against R. pseudosolanacearum CRMRS74Rif with halos ranging from 23 to 33 mm. Total phenolic content found in composting pile averaged 0.0065%. The high temperatures generated in the piles during the termophylic phase (media 50oC), the presence of antagonistic microbial populations and the phenolic compounds might be the cause of the quick elimination of R. pseudosolanacearum from the compound. The results of the physico-chemical and microbiological analysis attended the established limits of the current Brazilian legislation for using and comercialization of an organic compound, indicating that the obtained product has good quality. / A compostagem é um processo microbiano de biotransformação, considerada uma alternativa para a destinação adequada dos resíduos culturais, sendo uma técnica simples, viável economicamente e eficiente no tratamento e estabilização dos resíduos, minimizando os impactos ambientais no solo, no ar e na água, além de eliminar micro-organismos patogênicos aos vegetais e aos seres humanos. Os objetivos da pesquisa foram investigar a sobrevivência de um mutante da fitobactéria Ralstonia pseudosolanacearum (CRMRS74Rif) em restos culturais de tomateiro durante a compostagem e verificar a qualidade do composto orgânico em relação a variáveis físicas, químicas e microbiológicas. Três pilhas de compostagem foram constituídas de restos culturais de tomateiro e capim elefante, e esterco de ovino. Nove bolsas contendo 10 g de tecidos de tomateiro infectado foram depositadas em cada pilha, três em cada profundidade (20, 40 e 60 cm). Os revolvimentos das pilhas foram feitos aos 10, 20 e 30 dias de compostagem, quando então foram realizadas as avaliações da sobrevivência da fitobactéria. Ao final do processo (30 dias) foram quantificados os micro-organismos presente no composto e o antagonismo a R. pseudosolanacearum, os compostos fenólicos totais e variáveis da qualidade do composto. Na primeira avaliação realizada aos 10 dias o mutante não foi recuperado em meio de cultura, indicando que já havia sido eliminado do material infectado. As bactérias totais foram quantificadas em elevadas populações no composto, variando de 7,0 x 1012 a 2,0 x 1016 UFC/g de composto, com predominância de Pseudomonas do grupo fluorescente. Sessenta e dois isolados apresentaram atividade antagônica a R. pseudosolanacearum CRMRS74Rif, detectada através da formação de halo de inibição do crescimento bacteriano. No entanto, apenas 32 isolados mantiveram o antagonismo em novo teste realizado in vitro. A população de fungos variou de 3,2 x 102 a 1,2 x 103 UFC/g de composto. Com base nas estruturas morfológicas, foram identificados 40 isolados ao nível de gênero: Aspergillus spp., Cladosporium spp., Curvularia spp., Fusarium spp., Paecilomyces spp. e Trichoderma spp., e também o Oomiceto Pythium sp., e destes, nove produziram metabólitos tóxicos e inibiram o crescimento bacteriano, com halos variando de 15 a 23 mm. A população total de actinomicetos no composto variou de 3,8 a 9,5 x 104 UFC/g de composto, e com base em características culturais foram selecionados 33 isolados para teste de antagonismo, dois quais, quatro produziram metabólitos tóxicos contra R. pseudosolanacearum CRMRS74Rif, com halos variando de 23 a 33 mm. Compostos fenólicos totais foram encontrados nas pilhas de compostagem em uma concentração média de 0,0065%. As altas temperaturas geradas nas pilhas durante a fase termofílica (em média 50oC), a presença de micro-organismos antagonistas e compostos fenólicos foram responsáveis pela rápida eliminação de R. pseudosolanacearum do composto. Os resultados das análises físico-químicas e microbiológicas atenderam aos limites estabelecidos pela legislação vigente para uso e comercialização de composto orgânico, indicando que o composto obtido é de boa qualidade.

Submitted by Mario BC (mario@bc.ufrpe.br) on 2016-11-29T13:11:30Z No. of bitstreams: 1 Meridiana Araujo Goncalves Lima.pdf: 1167108 bytes, checksum: 93203a05064b2dbacc9e7b72b0813a60 (MD5) / Made available in DSpace on 2016-11-29T13:11:31Z (GMT). No. of bitstreams: 1 Meridiana Araujo Goncalves Lima.pdf: 1167108 bytes, checksum: 93203a05064b2dbacc9e7b72b0813a60 (MD5) Previous issue date: 2016-02-29 / Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - CAPES / Bacterial wilt caused by Ralstonia solanacearum (Rs) is one of the most important tomato diseases in Brazil. The effectiveness of ginger and melaleuca at 1%, rosemary at 0.50% and bergamot, lemongrass, clove, citronella, eucalyptus, sweet orange, palmrose and sage at 0.14% (v/v) essential oils was evaluated in vitro and via biofumigation of the soil infested with Rs. It was analyzed the in vitro growth; the population of Rs in soil before and seven days after biofumigation; and the components of resistance to disease and the growth of tomato plants cv. TY 2006, 15 days after transplanting. The clove oil was fractioned and its major chemical component was compared with the essencial oil in relation to the variables already cited. The in vitro growth of Rs was reduced by 100% with rosemary, lemongrass, citronella, clove, eucalyptus and palmrose oils. The population of Rs in soil was reduced by rosemary, clove, lemongrass, ginger, melaleuca and palmrose oils, with emphases for clove oil, which reduced Rs populations by 42.3%. The biofumigation with clove oil reduced the disease incidence, bacterial wilt index (BWI), and area under the disease curve progress (AUDPC) by 90.2, 97 and 98.8%, respectively and elevated the latent period by 10 days compared as the control with tween 20. The eugenol was the major constituent (87%) of the clove oil showing the same reduction effects of the components of disease resistance. The clove oil and the eugenol acetate did not reduce the height, and the fresh and dry biomass of plants. In asecond experiment, it was also evaluated the effect of silicon (Si) supplementation on the production of tomato transplants cultivars (cvs.) Santa Clara, TY 2006 and Yoshimatsu 4-11. The transplants were produced in substrate without Si (-Si) or with 3 g of calcium silicate de calcium/kg of substrate (+Si) and transplanted to Rs infected soil. After 15 days of growing it was evaluated the resistance components; the plant growth by measuring height, and the fresh and dry biomass of plants; the chlorophyll index; the Si content in plant tissues; the Rs population in stem base; and the enzymatic activity of phenylalanine amonia-lyases (PAL), β-1,3 glucanases (GLU) and peroxidases (POX). The Si supplementation on cvs. Santa Clara and TY 2006 reduced severity (33.2 and 42%), AUDPC (23.1 and 19.2%) and BWI (21.7 and 10%), respectively. The Si supplementation in the substrate did not affect plant growth, the chlorophyll index; the Si content in plant tissues and the Rs population in stem. Higher activities of PAL and GLU were evidenced on +Si plants. Therefore, the soil biofumigation with clove oil at 0.14% and the production of tomato transplants in substrate with Si have the potential to be integrated in the bacterial wilt management. / A murcha bacteriana causada por Ralstonia solanacearum (Rs) é uma das doenças economicamente mais importantes em tomateiro. Os óleos essenciais de gengibre e melaleuca a 1%, alecrim a 0,50% e bergamota, capim limão, cravo, citronela, eucalipto, laranja doce palmarosa e sálvia a 0,14% (v/v) foram testados in vitro e pela biofumigação do solo infestado com Rs. Foram avaliados o crescimento in vitro, a população de Rs no solo antes e sete dias depois da biofumigação, os componentes de resistência à doença e o crescimento das plantas em tomateiros da cv. TY 2006, aos 15 dias após o transplantio. O óleo de cravo foi fracionado e seu constituinte químico majoritário foi comparado com o óleo essencial quanto a redução da doença e demais variáveis citadas anteriormente. No ensaio in vitro, os óleos de alecrim, capim limão, citronela, cravo, eucalipto e palmarosa inibiram completamente o crescimento de Rs. A população de Rs no solo foi reduzida pelos óleos de alecrim, cravo, capim limão, gengibre, melaleuca e palmarosa, destacando-se o cravo com redução de 42,3%. A biofumigação com o óleo de cravo reduziu a incidência, o índice de murcha bacteriana (IMB) e a área abaixo da curva de progresso da doença (AACPD) em 90,2; 97 e 98,8%, respectivamente e elevou o período de latência - PL50 em 10 dias com relação a testemunha com Tween 20. Este óleo apresentou o eugenol como constituinte majoritário (87%), com os mesmos efeitos na redução dos componentes de resistência da doença. O óleo de cravo e o acetato de eugenol não reduziram a altura, biomassa fresca e seca das plantas. Em um segundo experimento, foi avaliado o efeito da suplementação do silício (Si) na produção de mudas de tomateiro das cultivares (cvs.) Santa Clara, TY 2006 e Yoshimatsu 4-11. As mudas foram produzidas em substrato sem silício (-Si) ou com 3 g de silicato de cálcio/kg de substrato (+Si) e transplantadas para solo com Rs. Aos 15 dias de cultivo, foram avaliados os componentes de resistência à doença; o crescimento das plantas, medindo-se a altura e o peso da biomassa fresca e seca, o índice reativo de clorofila; o conteúdo de Si na planta; a população de Rs no caule; e as atividades enzimáticas de fenilalanina amônia-liases (FAL), β-1,3 glucanases (GLU) e peroxidases (POX). A suplementação com Si nas cvs. Santa Clara e TY 2006 promoveu redução da doença avaliada pela severidade (33,2 e 42%), AACPD (23,1 e 19,2%) e IMB (21,7 e 10%), respectivamente. A suplementação com Si no substrato não afetou de forma significativa o crescimento das plantas, o índice reativo de clorofila, o acúmulo de Si nos tecidos das plantas e a população de Rs nos tecidos do caule. Foi evidenciada maior atividade enzimática de FAL e GLU nas plantas tratadas (+Si). Desta forma, a biofumigação do solo com o óleo de cravo a 0,14 % e a produção de mudas em substrato tratado com Si têm potencial como medidas a serem utilizadas no manejo da murcha bacteriana em tomateiro.

A doença da bananeira \'mal-do-Panamá\', causada pelo fungo Fusarium oxysporum f. sp. cubense (Foc) é uma das doenças mais destrutivas da bananeira e é considerada uma das seis doenças economicamente mais importante da história da humanidade. Algumas cultivares resistentes, como a \'BRS Platina\', foram lançadas pela Embrapa, porém para a sustentabilidade da resistência é necessário entender os mecanismos moleculares envolvidos na resposta de resistência e defesa. O objetivo deste estudo foi caracterizar o processo de infecção pelo Foc raça 1 em três cultivares contrastantes para a resistência e analisar o padrão transcricional no início da interação. A análise histopatológica indicou que o Foc raça 1 penetra pela raízes laterais e principal, colonizando os espaços inter e intracelular do córtex nas três cultivares. Foram visualizadas, hifas \'globosas\' na cultivar suscetível \'Maçã\' com a formação de estruturas de resistência, como clamidósporos. Na cultivar resistente \'BRS Platina\', foi observado por microscopia óptica no período inicial da interação (24 horas após inoculação) a indução de respostas de defesa da planta, como formação de zona de cicatrização, e aos 15 dias após inoculação, formação de tilose, presença de cristais de oxalato de cálcio e deposição de calose. Foi utilizada a tecnologia Illumina para sequenciamento massal de RNA e abordagens de bioinformática para identificar genes diferencialmente expressos (DE) relacionados com a resposta de defesa de bananeira em interações compatíveis e incompatíveis. O sequenciamento paired-end gerou um total de 113.632.486 fragmentos (reads) com alta qualidade. Do total de reads alinhados no genoma referência (\'DH-Pahang\'), 55.555.480 alinharam-se com genes conhecidos e anotados no genoma referência, sendo utilizados para a análise DE inoculado x não inoculado, permitindo detectar 2.307 genes para as três cultivares. Os genes anotados de cada cultivar foram comparados, sendo identificados quatro genes comuns para as três cultivares, dez compartilhados entre \'Maçã\' e \'Prata-anã\', 21 compartilhados entre \'BRS Platina\' e \'Maçã\', 114 compartilhados entre \'BRS Platina\' e \'Prata-anã\', além de 75 serem exclusivos de \'Maçã\', 599 de \'BRS Platina\' e 1484 de \'Prata-anã\'. O mecanismo de resistência/defesa ao Foc em \'BRS Platina\', ocorre em nível de percepção precoce na presença do patógeno desencadeando resposta de defesa inexistente em \'Maçã\', e com cinética distinta da cultivar com resposta intermediária (\'Prata-anã\'). Dessa forma, os resultados permitiram propor um modelo da resposta de defesa/resistência ao Foc raça 1 em bananeira, baseando-se no nível de indução de genes que codificam para proteínas de reconhecimento do patógeno (receptor like kinase), fatores de transcrição (WRKY e MYB); reforço e síntese de parede celular, degradação da parede celular do fungo (quitinase e glucanases), heat shocks, enzimas antioxidantes e na resposta visualizada pela histologia na cultivar \'BRS Platina\'. Sendo assim, este trabalho fornece novas perspectivas para estudos de análise funcional, identificação e anotação de novos genes relacionados a resposta de defesa e resistência ao Foc raça 1. / The banana Panama disease, caused by fungus Fusarium oxysporum f. sp. cubense (Foc), is one of the most destructive disease of the industry, and it is considered one of the six most economically important of all times. A few cultivars, such as \'BRS Platina\', were released, but it is still necessary to understand molecular mechanisms involved in defense response and resistance. The objective of this study was to characterize the infection process by Foc in three banana cultivars contrasting for resistance to Foc and to analyze the transcriptional profile at the beginning of interaction. In this way, Foc race 1 penetrated the main and lateral roots, colonizing inter- and intracellular spaces of the root cortex in the three cultivars. Hyphae were globose in the susceptible cultivar \'Maçã\' with the formation of resilience structure, such as chlamydospores. In the resistant cultivar \'BRS Platina\', during the initial period of interaction (24 hours after inoculation), induced of plant defense responses, such as a healing zone, tylosis formation, presence of calcium oxalate and callose deposition. The Illumina technology were applied to sequence RNA, followed by bioinformatic tools to identify genes differentially expressed (DE) related to resistance and defense response in the compatible and incompatible interactions. Pair-end sequencing generated a total of 113,632,486 reads with high quality. From the total of aligned reads to the banana reference genome (\'DH-Pahang\'), 55,555,480 aligned with gene models annotated in the reference genome. The aligned contigs were analysed for DE, comparing inoculated x non-inoculated, enabling the detection of 2307 genes for the three cultivars. Each annotated gene from each cultivar was compared: four common genes to the three cultiars; 10 genes were shared between \'Maçã\' and \'Prata-anã\'; 21 shared between \'BRS Platina\' and \'Maçã\'; 114 shared between \'BRS Platina\' and \'Prata-anã\', plus 75 exclusive to \'Maçã\'; 599 exclusive to \'BRS Platina\' and 1,484 to \'Prata-anã\'. The mechanism of resistance/defense in \'BRS Platina\', level of perception occurs early in the presence of the pathogen defense response triggering nonexistent in \'Maçã\' and with kinetics distinct cultivar with intermediate response (\'Prata-anã\'). Thus, the results have provided a model of defense response/resistance to Foc race 1 in banana, based on the level of gene induction that encode recognition proteins (Receptor-like Kinase, RLK), transcription factors (WRKY and MYB), cell wall synthesis and reinforcement, degradation of fungal cell wall (chitinases and glucanases), heat shocks , proteins;anto-oxidative enzymes and visualized by histologcal in response cultivar \'BRS Platina\'. The present work offer new perspectives to functional analyses, identification and annotation of new genes related to resistance and defense response to Foc race 1.

D.Phil. / The fungus, Verticillium dahliae, is the causative agent of Verticillium wilt, which results in significant cotton (Gossypium hirsutum) crop losses worldwide. This study contributes to the elucidation of cotton defence responses against V. dahliae. The identification, cloning and characterization of three genes that were differentially expressed in response to elicitation with a cell wall-derived (CWD) V. dahliae elicitor are described. It was hypothesized that the molecular architectures of the three characterized genes are supportive of a role in cotton defence against V. dahliae. As one of these genes was present as two homoeologous copies, this study also reports on the molecular characterization of both homoeologs, thus providing further insight into the processes of genomic evolution between homoeologous loci in allotetraploid cotton. The three genes were initially represented as expressed sequence tags (ESTs), obtained from a previous differential display reverse transcription polymerase chain reaction (DDRT-PCR) study by Zwiegelaar (2003), as part of an MSc project. These ESTs, designated C1B10, C4B5 and C4B4, were differentially induced upon elicitation with a CWD V. dahliae elicitor (Zwiegelaar, 2003). In the present study, the genes represented by the three ESTs were identified and characterized by genome walking and 5‘/3‘ rapid amplification of cDNA ends (RACE). Additionally, PCR and reverse-transcription PCR (RT-PCR) were utilized, where necessary, to obtain internal sequences, not covered by the genome walking and RACE reactions. Through the use of these molecular techniques, the full transcript and genomic sequences of each of the three genes was obtained, including their promoters. The promoter of each gene was analyzed for cis-elements driving gene transcription, through bioinformatic analysis. Furthermore, the copy number of each gene was determined through Southern blot analysis. The genes were translated to reveal their encoded protein sequences. The amino acid sequences were submitted to a basic local alignment (BLAST) search of the NCBI database to identify, and align them with, homologous proteins from other plant species (and those from G. hirsutum, if any). An in silico analysis of the encoded protein of each gene was also performed. This examination included domain architecture, post-translational modification, subcellular location and tertiary structure predictions. This study also involved the isolation of the elicitor from the cell walls of V. dahliae fungal cultures. The potency of the freshly-isolated elicitor was investigated with a triphenyltetrazolium chloride (TTC) viability assay on cotton cell suspensions. Its potential to induce PR-proteins was also explored but these results were inconclusive. In addition, expression studies were performed with real-time PCR (q-PCR), to confirm the up- or down-regulation of each gene upon elicitation of cotton cell suspensions with the CWD V. dahliae elicitor, and to investigate the time frame/kinetics of induction. The gene corresponding to the C1B10 EST was designated GhLIPN as this study revealed that it encodes a lipin protein. Lipins are novel proteins with phosphatidate phosphatase 1 (PAP1) activity, exclusive to eukaryotes. They play a fundamental role in the lipid metabolism of organisms ranging in complexity from yeast to animals and plants. In plants, this role includes lipid membrane remodelling during phosphate (Pi) deficiency. During the study of the GhLIPN gene, it was discovered that it occurred as two distinct homoeologous copies from the A- and D-co-resident genomes of allopolyploid G. hirsutum. The GhLIPN homoeologs were named GhLIPN I and N for Insert present and No insert, respectively, based on the presence or absence of a 13 base pair (bp) insertion/deletion (indel) site in intron 6.

Os microrganismos endofíticos são aqueles, cultiváveis ou não, que habitam o interior da planta hospedeira sem causar danos aparentes ou estruturas externas visíveis. Essa interação planta-microrganismo é intrínseca a determinadas espécies de plantas e/ou bactérias. Nas últimas décadas os estudos de microrganismos endofíticos têm sido realizados em diversas plantas hospedeiras, sendo esses estudos direcionados, principalmente, para a diversidade e características benéficas induzidas, como o controle biológico de doenças. As doenças com sintomas de murcha e cancro são consideradas emergentes no setor florestal. O Brasil está entre os maiores produtores mundiais de Eucalyptus e a expansão do setor, juntamente com o cultivo clonal, tem acarretado o aumento da incidência de patógenos. O surgimento de novas doenças exige estudos relacionados tanto a interação do agente patogênico com hospedeiro quanto de todos os componentes do patossistema. Neste contexto, os microrganismos endofíticos e do rizoplano têm sido descritos como potenciais controladores biológicos de doenças. Dessa forma, o presente trabalho teve por objetivos avaliar a interação da comunidade bacteriana associada a Eucalyptus sp. com fungos causadores de murcha e cancro. Foi também estudada a diversidade e colonização desses endófitos em sementes e o efeito da germinação nessa interação. Adicionalmente, foi realizada uma busca por bactérias associadas a Eucalypus sp. com capacidade de controlar fungos causadores de murcha e cancro. Foi observado que a densidade bacteriana endofítica não difere entre as espécies de Eucalyptus citriodora, E. urophylla e E. globulus x E. grandis avaliadas e que esta comunidade cultivada é composta por bactérias pertencentes às classes Actinobacteria, Proteobacteria e Firmicutes. Com uso de diferentes ferramentas de estudo foi observado que a quantidade de bactérias endofíticas nas sementes aumenta proporcionalmente ao tempo de germinação. Foi observado também que os sintomas de murcha e cancro causados, principalmente, por Ceratocystis fimbriata podem ser causados por outros fungos patogênicos. Foram identificados 41 isolados bacterianos endofíticos e do rizoplano com capacidade de controlar fungos patogênicos causadores de murcha e cancro em Eucalyptus sp. Adicionalmente ao potencial para uso no controle biológico do cancro e da murcha de Eucalyptus, as bactérias de sementes aqui relatadas, podem ter papel importante de proteção das plantas no campo. Futuros estudos devem ser direcionados para identificação de genes associados a essa inibição, bem com análise dos fatores responsáveis por este controle biológico no campo. / The endophytic microorganisms are those, cultivated or not, that inhabit the interior of the plant host without causing apparent damages or visible external structures. This interaction plant-microorganism is specific to certain species of plants and/or bacteria. In the last few years studies of endophytic microorganisms have been carried out for several plant hosts, which are focused mainly to diversity and biotechnological potential, such as biological control of disease. Brazil is one of the largest world Eucalyptus producers and the increasing of the Eucalyptus production associated to clonally reproduction has allowed an increasing incidence of some pathogens. These new disease demands on studies related to causal agent and biotic and abiotic factors associated to the diseases. The canker of Eucalyptus is considered an emerging disease by several reforestation companies. In that way, the rhizoplane and endophytic microorganisms has been described as potential diseases biological control agents. In this context, the aims of the present work were to assess the bacterial community associated to Eucalyptus sp. plants and seeds, besides the interaction with the wilt and canker pathogenic fungi. We also assessed the diversity and colonization effect of seed germination on bacterial community. Additionally, was carried out a screening of the Eucalypus sp. associated bacteria against pathogenic fungi that cause wilt and canker. We observed that endophytic bacterial density doesn\'t differ among the species of Eucalyptus citriodora, E. urophylla and E. globulus x E. grandis and that this cultivated community is composed by follow bacterial classes Actinobacteria, Proteobacteria and Firmicutes. Using different study approaches was observed that the amount of endophytic bacteria in the seeds increases proportionally at the germination time. We also observed that the symptoms of wilt and canker caused, mainly, by Ceratocystis fimbriata may be caused by other pathogenic fungi too. Additionally, were identified 41 endophytic and rhizoplane bacterial isolates able to control pathogenic fungi that cause Eucalyptus wilt and canker. Besides to the wilt and canker biological control potential of that bacteria, the seed endophyte identified in the present work can have important function on plant protection in the field. New studies should be addressed for identification of genes related to antagonism, besides of factors responsible for biological control occurrence in the field.

A murcha bacteriana, causada por Ralstonia solanacearum, afeta principalmente as solanáceas, destacando-se as culturas da batata, berinjela, jiló, pimentão e tomate. No presente trabalho foi conduzida a caracterização molecular de isolados de R. solanacearum e sua possível relação com características relacionadas à morfologia, bioquímica, patogenicidade, agressividade e distribuição geográfica. Foram utilizados 51 isolados pertencentes à biovar 2, sendo 9 provenientes de berinjela e 42 de batata, coletados em diversas regiões brasileiras. A análise molecular permitiu separar os isolados em quatro grupos distintos de padrões de bandas para os iniciadores BOX e ERIC, e em cinco para o iniciador REP. Não foi encontrada relação dos grupos de isolados caracterizados molecularmente com tamanho de colônias, ocorrência de mutantes, produção de melanina, capacidade de colonização do sistema radicular e resistência a antibióticos/fungicidas. A identificação de isolados de batata, como biovar 2-A, e de berinjela, como biovar 2-T, com base em teste bioquímico do uso de trealose, foi confirmadas pela análise molecular. Não houve variação de agressividade entre os isolados inoculados em batata e berinjela, exceção feita ao isolado avirulento CNPH-65. Portanto, isolados das biovares 2-A e 2-T podem infectar estas duas hospedeiras com a mesma intensidade sob altas temperaturas. Para todos os isolados, o desenvolvimento da população bacteriana foi significativamente maior no sistema radicular de plantas das cultivares suscetíveis, tanto para batata como para berinjela. No entanto, dentro de cada cultivar, os isolados se comportaram de maneira semelhante, não sendo possível fazer distinção entre os mesmos. A tentativa de se associar grupos de isolados caracterizados molecularmente com os locais de origem revelou alguns aspectos interessantes. O grupo I agregou somente isolados do Paraná. No grupo II ficaram isolados da Bahia, Distrito Federal e do Paraná. No Grupo III, foram reunidos todos os isolados de berinjela e um único de batata, sendo todos procedentes do Distrito Federal. O grupo IV, de forma semelhante ao grupo II, reuniu isolados de locais diversos como Paraná, Goiás, Rio Grande do Sul e Distrito Federal. Portanto, nos grupos I e III parece haver uma tendência de relação entre grupamento molecular e local de origem, enquanto que para os grupos II e IV, isolados de características genéticas similares são provenientes de locais distintos, apontando considerável diversidade genética do patógeno. / The bacterial wilt disease caused by Ralstonia solonacearum affects mainly the solanaceous species, specially potato, eggplant, peppers, tomato and brazilian gilo (Solanum gilo). This work reports the molecular characterization of R. solanacearum biovar 2 isolates and the possible relationship of this molecular data with other characteristics related to morphology, biochemistry, pathogenicity, aggressiveness and geographical distribution. Fifty-one biovar 2 isolates were studied, 9 isolated from eggplant and 42 from potato, all of them collected from different regions of Brazil. According to the molecular analysis, the isolates were clustered in four different groups, with distinct band patterns to the primers BOX and ERIC, and five groups to the primers REP. There was no relationship between the groups clustered through molecular analyses and phenotypic characteristics, such as colony size, presence of mutants, melanin presence, capability of root system colonization and antibiotic/fungicide resistance. The identification of potato isolates as the biovar 2-A, and the eggplant isolates as biovar 2-T, based on biochemical tests using trealose were confirmed with the molecular analyses. There was no variation of aggressiveness in the isolates inoculated on potato an eggplant, except the avirulent isolate CNPH-65. Consequently, isolates of biovars 2-A and 2-T are able to infect both hosts with the same aggressiveness under high temperatures. The population of all isolates developed in significant levels at the root system of susceptible cultivars of both hosts, potato and eggplant. However, considering each cultivar tested, there was no difference between isolates. Interesting results were observed when the isolates clustered based on molecular data were associated with the geographical region of their collection. The group I clustered only the isolates collected in Paraná. The group II clustered the isolates collected in Bahia, Federal District and some in Paraná. The group III clustered all isolates from eggplant and only one of potato, all of them collected in the Federal District. The group IV, as the group II, clustered isolates from different regions, like Paraná, Goiás, Rio Grande do Sul and Federal District. These results suggest a relationship between the isolates clustered through molecular analysis in the groups II and III and their geographical region of collection. The isolates clustered in the same way, with similar genetic background in the groups II and IV, were however collected in different regions, showing the great genetic variation of this pathogen.

Plants regulate responses to their environment through complex hormone signaling; these hormones can be categorized broadly into two categories: growth and defense, though many have roles in both. Much remains to be understood about the complexity of hormone signaling in relation to environmental responses, especially species- and genotype-specific differences. Unraveling this complexity of hormone signaling will lead to the development of resilient crops that are able to respond appropriately to their environment. In this dissertation, I hypothesize novel roles for growth and defense hormones in <i>Solanum </i>spp. responses to 1) biochar, a black carbon soil amendment (Chapter 2), 2) infection with<i> Ralstonia solanacearum</i>, an economically important soilborne pathogen causing bacterial wilt (Chapter 3), and 3) endophytic colonization by the soil bacterial community (Chapter 4). In Chapter 2, I showed that biochar upregulates GA signaling and affects GA-related traits in a species- and cultivar-specific manner. Biochar amendment also downregulates defense signaling. In Chapter 3, I demonstrated a novel role for auxin in resistance against <i>R. solanacearum, </i>including differential expression of auxin signaling genes in resistant genotype H7996 compared to susceptible WV in response to <i>R. solanacearum</i> infection. In addition, I observed stronger and faster upregulation of defense hormone marker genes for SA and ET in H7996 compared to WV. In Chapter 4, I showed that SA and ET are required for normal tomato root microbial community assembly, affecting the colonization of a few key taxa in order to promote alpha diversity. H7996 and WV root communities differ in alpha diversity, and a panel of H7996 x WV RILs showed quantitative variation in alpha diversity that correlated negatively with the abundance of these key taxa. In conclusion, I elucidated novel roles for hormones in responses to the soil environment, pathogen infection, and root community colonization. These findings are important for developing resilient, sustainable crops.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5&rsquo; AATTAGGTTCTTGAAGCCCATCT 3&rsquo;; R = 5&rsquo; TTCCGCATCAGCCAATAGTGT 3&rsquo;). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.

A utilização de cultivares resistentes às viroses de plantas tornou-se estratégia relevante para o cultivo de tomateiro. Para isso fontes de resistência são incluídas em programas de melhoramento genético visando à obtenção de linhagens e/ou novas cultivares resistentes a esses patógenos. As tospoviroses são responsáveis por grandes perdas econômicas em cultivos do tomateiro em todo o mundo, visto que, elevadas taxas de infecção tem acarretado em perdas econômicas consideráveis para inúmeros países. O objetivo do trabalho visou a caracterização de linhagens de tomateiro de hábito de crescimento determinado resistentes a tospovírus, utilizando caracteres agronômicos e marcadores associados a genes de resistência à doença. Foram utilizados 16 genótipos de tomateiro de hábito de crescimento determinado, sendo doze linhagens experimentais e quatro testemunhas comerciais. Usou-se delineamento em blocos casualizados, com 16 tratamentos e 3 repetições. Avaliaram-se uniformidade de planta (UP), vigor da planta (VP), altura de planta (AP), pegamento de fruto (PGF), cobertura foliar (CF), massa média do fruto (MMF), comprimento (C), diâmetro equatorial (D), razão entre comprimento e diâmetro (R C/D), tamanho da cicatriz peduncular (CP), forma da base (FB), firmeza do fruto (FF), espessura do pericarpo (EP), número de lóculos (NL), produção total (PT), número de frutos descartados (NFD), produção descartada (PD) e produção comercial (PC). Para a análise molecular, utilizou-se o par de primers Sw-5-2 (F = 5\' AATTAGGTTCTTGAAGCCCATCT 3\'; R = 5\' TTCCGCATCAGCCAATAGTGT 3\'). Nas condições em que o presente trabalho foi conduzido e, de acordo com os resultados obtidos, concluiu-se que todas as linhagens estudadas confirmaram a presença do gene Sw-5 em análise molecular, portanto, são resistentes a tospovírus, sendo recomendadas para serem utilizadas como genitoras. / Resistance of cultivars to viruses has become a relevant strategy for tomato cultivation. Sources of resistance are included in breeding programs to obtain lines and /or resistant hybrids. The tospoviroses are responsible for large economic losses in tomato crops worldwide. The objective of this work was the characterization of tomato lines resistant to Tospovirus, using agronomic traits and molecular markers. We used sixteen tomatoes genotypes, twelve of them were experimental lines and four were commercial controls. The experiment was carried out at the research field area with random blocks design with sixteen treatments and three replications. The following agronomical traits were assessed: plant uniformity (UP), plant vigour (VP), plant height (AP), fruit setting (PGF), leaf cover (CF), average fruit weight (PMF), fruit length (C), fruit width (D), relation between length and width fruit (R C/D), size of the peduncular scar (CP), pistil scar (FB), fruit firmness (FF), fruit pericarp thickness (EP), fruit loculus number (NL), total production (PT), not marketable fruit yield (PD) and marketable yield (PC). To the molecular analysis, we used the primers pair Sw-5-2 (F = 5&rsquo; AATTAGGTTCTTGAAGCCCATCT 3&rsquo;; R = 5&rsquo; TTCCGCATCAGCCAATAGTGT 3&rsquo;). According to the results, for the conditions in which the present experiment was conducted, we concluded that all genotypes confirmed the presence of the Sw-5 gene in molecular analysis, therefore, they are resistant to tospovirus, recommended to be used as parental lines.