Obesity affects about 520 million people world-wide and more recently studies have shown that fat cells produce proteins called adipokines which have various influences on the human metabolism and has helped to change the perspectives of researchers on the concept of the adipose tissue being just a store of energy. As a result of this, adipokines have been reported to represent a connection between obesity and cardiovascular diseases (CVD) and diabetes mellitus. The concentrations and the bases of the effects of the adipokines in beta cell failure of diabetes mellitus and endothelial cell dysfunction of cardiovascular diseases are still not fully understood. The effect of leptin and adiponectin, which are two adipokines with opposing effects, has been explored in this study. In the present study, therefore, the concentrations of leptin and adiponectin with significant effect on beta cell and endothelial cell function and the basis of these functions were explored. Also, attempts were made in the present study to correlate the concentrations of leptin and adiponectin with possible clinical pointers to complications. In order to achieve this, beta cells (BTC) were grown, made into pseudo-islets (which are said to produce more insulin) and treated with various concentrations of leptin and adiponectin and cells assayed for insulin and amylin (to investigate the role of amylin in insulin secretion). Also the cells were collected and mRNA extracted from these cells, reverse transcription PCR carried out to find out the role of protein phosphatase 1 (PP-1) in the effect of leptin on insulin secretion. PP-1 is a substrate that increases insulin secretion by allowing calcium influx into the cell and is said to be blocked by leptin). Leptin at 500ng/ml was found to significantly (p<0.05) inhibit the secretion of insulin and the expression of PP1 gene, thus supporting this as a basis for the effect of leptin on insulin secretion. Adiponectin however increased insulin secretion significantly but was not as consistent in its effect as leptin was in inhibiting insulin secretion. In order to explore the role of adipokines in cardiovascular diseases, EAHY human endothelial cells were cultured and treated with various concentrations of adiponectin and leptin both individually and in combinations and cells collected and mRNA extracted in order to carry out a reverse transcription PCR for the expression of angiogenic (TIMP2, TIMP3 and MMP2) genes and atherosclerotic (LPA and LPL) genes. Leptin (1nM) was shown to increase the expression of atherosclerotic and angiogenic genes while adiponectin (100nM) inhibited the expression of the atherosclerotic and angiogenic genes. A combination of leptin and adiponectin caused a reduction in the stimulatory effect of leptin on the expression of atherosclerotic and angiogenic genes. This shows that leptin may predispose to CVD while adiponectin reduces the risk of CVD. The clinical part of this study involved recruiting 150 patients with diabetes after the ethical approval for the clinical study was granted. The data collected from the patients included their age, sex, race, and physical parameters like the body mass index (BMI). Also blood samples were collected to measure the clinical indicators for CVD and renal function such as cholesterol, HDL levels, eGFR, albumin levels and their retinopathy status checked as these are the common complications seen in diabetic patients. The blood samples were also assayed in the laboratory for leptin and adiponectin levels and the leptin, adiponectin and the leptin/adiponectin ratio (LAR) were then correlated with the laboratory determinants of CVD, renal and retinopathy risks. It was found that the LAR and the leptin levels correlates significantly with the BMI, while the leptin levels were significantly correlated with the risk of nephropathy in diabetic patients while adiponectin levels correlated significantly with a reduced risk for developing CVD. The role of the enzymes in the leptin and adiponectin signaling pathway was also explored and it was discovered that ERK, P38 and AMPK all had roles in the effect of leptin and adiponectin on the expression of atherosclerotic and angiogenic genes. These data indicate that leptin and adiponectin play significant roles in the beta cell and endothelial cell function and are links between obesity and CVD and diabetes mellitus.

published_or_final_version / abstract / Anatomy / Doctoral / Doctor of Philosophy

Leptin is an adipokine that acts centrally to regulate feeding behaviour, energy expenditure and autonomic function via activation of its receptor (ObRb) in nuclei in the central nervous system (CNS). This thesis investigates the involvement of two sensory circumventricular organs (CVOs), the subfornical organ (SFO) and area postrema (AP), in mediating the central effects of leptin using a variety of experimental approaches. We first show that acute electrical stimulation of the SFO elicits feeding in satiated rats, supporting a role for this specialized CNS structure in the control of food intake. We then demonstrate, using RT-PCR, the presence of ObRb mRNA in SFO and, using whole cell current clamp electrophysiology, reveal that leptin influences the excitability of individual SFO neurons, causing both excitatory and inhibitory responses. Furthermore, we find that leptin activates the same SFO neurons activated by amylin. Given the association between obesity and hypertension and the well-established role of the SFO in cardiovascular regulation, we show that leptin microinjection into the SFO decreases blood pressure in young rats, effects that are abolished in leptin-resistant, diet induced obese rats, suggesting that leptin-insensitivity in the SFO of obese, leptin-resistant, individuals may contribute to obesity-related hypertension. Our studies also show that the medullary AP expresses ObRb and that leptin influences the excitability of AP neurons. Furthermore, we show that leptin and amylin act on the same subpopulation of neurons in the AP. Finally, our preliminary AP/SFO lesion studies reveal that animals with these lesions exhibit a profound decrease in body weight and food intake and no longer exhibit decreases in body weight in response to peripheral leptin administration. In summary, the data presented in this thesis suggest the SFO and AP to be important in body weight homeostasis and in mediating the central effects of leptin. In addition, these areas appear to be important in the integration of multiple signals derived from peripheral sources. Furthermore, the fact that the SFO appears to be involved in leptin effects on both energy balance and cardiovascular regulation attest to the integrative nature of the SFO in the control of diverse physiological functions. / Thesis (Ph.D, Physiology) -- Queen's University, 2012-10-15 14:57:15.387

Motivation: Abdominal obesity (hereafter referred to as "obesity") is becoming the biggest "global epidemic" of our modern times. It is associated with a range of diseases, including cardiovascular diseases and hypertension. Recent research showed that an increase in sympathetic activity is of central importance in the pathogenesis of obesity-related diseases. Increased leptin levels and impaired baroreflex sensitivity have both been independently associated with abdominal obesity and increased sympathetic activity. A perception of poorer health may also contribute to the physiological characteristics of obesity-related diseases. A lack of data regarding sympathetic activity, leptin levels, baroreflex sensitivity and perception of health in Africans, serves as a motivation for conducting this study. Objective: To investigate the contributions of leptin levels, baroreflex sensitivity and perception of health data to increased sympathetic activity in lean and obese African women from South Africa. Methodology: The manuscript presented in Chapter 2 made use of the data obtained in the POWIRS (Profiles of Obese Women with the Insulin Resistance Syndrome) study. A group of 102 urbanized African women, living in the North-West Province of South Africa, was recruited according to body mass indexes. Only 85 subjects were included for analysis due to incomplete datasets. For this study, subjects were divided into lean and obese groups according to their waist circumferences. Anthropometric measurements were done according to standardized methods. Resting cardiovascular measurements were obtained from Finometer observations. Resting, fasting levels of leptin were calculated after radioimmunoassay analyses. Subjective perception of health was determined by means of the 28-item General Health Questionnaire. Comparisons between the groups were done using analysis of covariance (ANCOVA) whilst adjusting for cardiovascular risk factors (age. smoking, alcohol consumption and physical activity). Correlation coefficients were determined to indicate any associations between leptin, baroreflex sensitivity and perception of health with sympathetic activity (represented by heart rate) and other cardiovascular variables. The study was approved by the Ethics committee of the North-West University and all the subjects gave informed consent in writing. The reader is referred to the Methods section in Chapter 2 for a more detailed description of the subjects, study design and analytical procedures used in this dissertation. Results and conclusion: Results from this study indicate that obese African women, compared to lean African women, were older, reported higher physical activity, and exhibited higher diastolic and mean blood pressure, heart rate, cardiac output, arterial compliance, leptin and hypertension prevalence rate values. In lean African women social dysfunction was positively associated with diastolic and mean blood pressure and arterial resistance, and negatively with arterial compliance. In obese African women baroreflex sensitivity was negatively associated with diastolic blood pressure, which could be an indication of impaired baroreflex sensitivity. In this obese group a perception of social dysfunction was associated with decreased heart rate. Although leptin and heart rate were significantly higher in the obese Africans, no significant correlations existed between these variables to reflect leptin's enhancement of sympathetic activity. However, leptin correlated weakly but positively with cardiac output (p = 0.054, r = 0.32). In conclusion, baroreflex sensitivity (although similar between groups) and leptin seem to contribute to blood pressure and thus hypertension in obese African women, possibly through increased sympathetic activity and volume loading. A perception of poorer health, especially a perception of social dysfunction, could possibly contribute to this image. / Thesis (M.Sc. (Physiology))--North-West University, Potchefstroom Campus, 2007.

Résumé: Le surpoids et l’obésité dans la population pédiatrique sont des préoccupations grandissantes à l’échelle mondiale. Actuellement, au Canada, près de 21 % des jeunes Canadiens âgés de 2 à 5 ans présentent un surpoids et malheureusement, 6 % d’entre eux souffrent d’obésité. De plus, 80 % de ces enfants risquent d’être obèses à l’âge adulte, ce qui mène à plusieurs impacts sur la santé. Afin de prévenir l’obésité infantile, il est important d’identifier des facteurs de risques, notamment ceux se produisant tôt dans la vie. Plusieurs études ont démontré l’importance de l’environnement fœtal dans l’établissement de la santé métabolique à long terme. Le poids à la naissance a souvent été utilisé comme marqueur de l’exposition prénatale. Cependant, le poids à la naissance n’est qu’un marqueur grossier. L’adiposité à la naissance a été identifiée comme un facteur de risque plus important puisqu’elle permet de prédire de l’adiposité durant l’enfance. Les deux déterminants maternels majeurs de la croissance fœtale sont le statut pondéral et la glycémie maternelle. Récemment, une adipokine a été suggérée comme un déterminant potentiel dans la programmation fœtale de l’obésité. La leptine, qui est produite par les adipocytes, joue un rôle important dans la balance énergétique, mais elle semble aussi importante dans le développement de l’obésité postnatale. Durant la grossesse, le placenta produit une large quantité de leptine et la majorité est sécrétée du côté maternel. Appuyés par le fait que la leptine maternelle circulante est le reflet de la sécrétion placentaire de leptine, nous avons émis l’hypothèse que la leptine maternelle serait associée à l’adiposité du nouveau-né, et ce, indépendamment de la glycémie maternelle. Nous avons étudié la leptine durant l’hyperglycémie provoquée par voie orale (HGPO) chez les femmes enceintes au 2e trimestre. Nous avons montré, chez les femmes en surpoids ou obèse, qu’une plus haute leptine maternelle était lié à une adiposité néonatale augmentée à la naissance. D’un autre côté, chez les femmes minces, une glycémie élevée était liée à une adiposité néonatale augmentée. Ces associations sont indépendantes de la parité, du statut tabagique, du gain de poids durant la grossesse, des triglycérides maternels, du mode d’accouchement, du sexe du nouveau-né et de l’âge gestationnel à la naissance. Ces résultats suggèrent une régulation différentielle entre ces deux marqueurs métaboliques maternels et l’adiposité néonatale, selon le statut pondéral pré-grossesse. / Abstract: Worldwide, overweight and obesity in the pediatric population is a growing concern. Almost 21% of Canadian children aged 2 to 5 years are overweight and unfortunately, 6% of them are obese. Among those children, 80% will remain obese in adulthood leading to several health impacts. To prevent childhood obesity, we need to identify risk factors especially those occurring early in life. A particular importance was given to the fetal environment in establishing long-term metabolic health. Therefore, birth weight was often used as a marker of prenatal exposure. However, birth weight is a fairl y crude marker, and neonatal adiposity was previously identified as a stronger predictor of childhood adiposity. Two of the most important maternal determinants of fetal growth are maternal weight status and glycaemia during pregnancy. Recently, an adipoki ne have been suggested as a potential contributor to prenatal programming of obesity. Leptin is produced by adipocytes and plays an important role in energy balance and maybe on programming of postnatal obesity. During pregnancy, the placenta produces large amounts of leptin and 80% is secreted to the maternal side. Support ed by the fact that circulating maternal leptin levels reflects the placenta leptin production, our hypothesis was that maternal leptin levels are associated with neonatal adiposity, inde pendently of maternal glycaemia. We investigated levels of leptin over the course of an oral glucose tolerance test (OGTT) in pregnant women at 2nd trimester. We showed that higher maternal leptinemia is associated with greater adiposity in newborns of mot hers who were overweight/obese when entering pregnancy. While in lean women, higher glycaemia is associated with greater adiposity in newborns. These associations are independent of parity, maternal smoking status, maternal gestational weight gain, maternal triglyceride levels, delivery mode, neonate sex and gestational age at delivery. Those results suggest a differential regulation two important maternal metabolic marker and neonatal adiposity, according to maternal weight status.

Le système endocannabinoïde est un acteur majeur de la régulation de la balance énergétique. Cependant, son rôle au niveau de l’hypothalamus, une région critique dans la régulation de la balance énergétique, reste méconnu. L’objectif général de ce travail de thèse a été de disséquer le rôle du récepteur aux cannabinoïdes de type 1 (CB1) exprimé par des populations neuronales hypothalamiques spécifiques dans la régulation de la balance énergétique et l’homéostasie du glucose en caractérisant trois nouvelles lignées de souris possédant une mutation conditionnelle de CB1. En régime standard, la délétion de CB1 dans l’hypothalamus induit une augmentation de la dépense énergétique et une baisse de prise de poids corporel sans modifier la prise alimentaire alors que la délétion de CB1 dans le noyau ventromédian de l’hypothalamus (VMN-CB1-KO) entraîne une baisse significative de masse grasse, une augmentation de l’oxydation des acides gras in vivo, une augmentation de l’activité du système nerveux sympathique (SNS) et un métabolisme du glucose périphérique amélioré. Enfin, la délétion de CB1 dans le noyau paraventriculaire de l’hypothalamus (PVN-CB1-KO) induit une baisse de poids sans modifier la prise alimentaire ni la composition corporelle. Lors de l’exposition à un régime riche en graisses, les souris VMN-CB1-KO prennent plus de poids et de masse grasse que les WT, tandis que les souris PVN-CB1-KO sont partiellement protégées de l’obésité alimentaire grâce à une dépense énergétique accrue.Ces résultats suggèrent que CB1 exprimé par différentes populations hypothalamiques joue un rôle différent dans la régulation de la balance énergétique, qui dépend aussi du régime alimentaire. / The endocannabinoid system is a major player in energy balance regulation. However, a complete understanding of its role within the hypothalamus, a region critically involved in energy balance regulation, is still missing. The general aim of this PhD work was to dissect the specific role of the cannabinoid type 1 receptor (CB1) expressed on different hypothalamic neuronal populations in energy balance regulation and glucose homeostasis by characterizing three new mouse mutant lines with a conditional deletion of CB1. On standard diet, CB1 deletion within the hypothalamus induced an increase in energy expenditure and a decrease in body weight gain without modifying food intake, while CB1 deletion within the ventromedial nucleus of the hypothalamus (VMN-CB1-KO) decreased fat mass, increased fatty acid oxidation in vivo and sympathetic nervous system (SNS) activity, and improved peripheral glucose metabolism. CB1 deletion within the paraventricular nucleus of the hypothalamus (PVN-CB1-KO) decreased body weight gain without affecting food intake or body composition. When exposed to a high-fat diet, VMN-CB1-KO mice gained significantly more weight and fat mass than their WT, while PVN-CB1-KO mice were partly protected from diet-induced obesity thanks to increased energy expenditure. These results overall suggest that CB1 expressed on different hypothalamic neuronal populations have distinct roles in energy balance regulation, which in turn also depend on the diet consumed.

Par sa fréquence et sa gravité, le CCR représente un réel problème de santé publique. Avec 37000 nouveaux cas par an et 15% des décès, il constitue la 2ème cause de mortalité par cancer en France. Malgré d'importants progrès thérapeutiques durant cette dernière décennie, il rest un cancer de mauvais pronostic. Des facteurs génétiques et environnementaux ont été impliqués dans la genèse de ce cancer. La caractérisation moléculaire du CCR a permis d'identifier les tumeurs par instabiblité génique, appelées MSI (Microsatelite Instability) possédant des anomalies de réparation d'appariement d'ADN (MMR mismatch repair). Celles-ci sont fréquemment retrouvées (80%) dans les CCRs familiaux et rarement (15%) dans les cancers sporadiques. Les tumeurs avec phénotype MSI sont de bon pronostic. Le rôle possible de l'alimentation et particulièrement celui du fuel énergétique sur la survenue d'anomalies d'appariement d'ADN a été suggéré. De nombreuses hormones et en particulier la leptine ont été rapportées comme facteur de promotion tumorale. De plus, la leptine possède de nombreuses propriétés immunrégulatrices. Son effet sur l'immunité colique tiendrait autant à sa capacité à initier la production de cytokines à partir des cellules épithéliales digestives qu'à sa capacité à contrôler la prolifération des lymphocytes. Nous avons formulé l'hypothèse que la leptine pouvait réguler des fonctions immunes dans le microenvironnement tumoral. L'ensemble de ces données souligne l'importance de l'étude chez l'homme. L'analyse des données prospectives de 171 patients avec CCR permet de noter une surexpression du récepteur de la leptine dans un sous groupe de tumeurs. Les relations entre le récpteur de la leptine et la réponse immunitaire ont été analysées dans le microenvironnement tumoral humain, par des modèles cellulaires in vitro et animaux in vivo. Nous avons découvert que l'effet pro immunitaire de leptine dépendait du niveau d'expression de sonrécepteur et du degré d'instabilité microsatellitaire dans la cellule tumorale. L'expression du récepteur de la leptine pourrait être considérée comme un marqueur pronostique dans le CCR humain / Cancer of the colon and rectum (CRC) is a real challenge in Western countries because of the prevalence, cost and bad prognosis. With they 37,000 new cases each year and 15% of mortality it is currently the 2nd cause of cancer death in France. Despite significant advances in diagnosis and treatment over the past decade, it remains with bad prognosis. Genetic and environmental factors were involved in the genesis of this cancer. Molecular characterization of CRC leaded to the identification of gene instability (MSI) in tumors with mismatch repair (MMR) abnormalities. This is found frequently (80%) the CRC hereditary no polyposis colon cancer family (HNPCC) and rarely (15%) in sporadic cancers. Those tumors with MSI phenotype are considered to be of good prognosis. The possible role of food and particulary energy balance on the occurrence of MMR abnormalities has been suggested. Several hormones including leptin have been reported to promote tumour growth. In addition, leptin may regulate immune response tin GIT. Its pro immunogenic effect results from cytokines production by gastrointestinal epithelial cells as well as its ability to control the proliferation of lymphocytes. We hypothesised that leptin might regulate anti tumour immune response. The analysis of prospective data from 171 patients with CRC showed that overexpression of leptin receptor in subset of tumours. Relationships between leptin recptor and tumour immune response have been studied in the tumour microenvironment in human tissues, and in culture cells in vitro as well as in animal models in vivo. Results showed intensity of immune response was depended on the level of leptin receptor expression and MSI in colon tumour cells. Thus leptin receptor expression may be considered as a prognostic marker in colon and rectal cancer in human

A promoção a amamentação representa uma importante estratégia de saúde pública no manejo do sobrepeso e obesidade mundial. É possível que os hormônios reguladores do metabolismo energético, como a adiponectina, leptina e melatonina do colostro humano, possa beneficiar o sistema imunológico do lactente e minimizar os impactos ocasionados pelo excesso de peso materno pré-gestacional. Dado que, esses hormônios também possuem ação imunomoduladora. Assim, mudanças nas concentrações desses hormônios, podem comprometer a atividade funcional das células mononucleares (MN) do colostro humano e contribuir para o aumento de infecções neonatais. Por isto, o objetivo desta pesquisa foi analisar a atividade funcional dos fagócitos MN do colostro de mulheres com excesso de peso pré-gestacional, na ausência e presença de adiponectina, leptina e melatonina. As amostras de colostro foram coletadas de 109 doadoras saudáveis e foram divididas em dois grupos: grupo controle e grupo com excesso de peso. O colostro foi centrifugado para obtenção do botão celular e sobrenadante. O sobrenadante foi utilizado para dosagem de melatonina, quantificada por ELISA. As células MN foram utilizadas no ensaio de fagocitose, por citometria de fluxo, e a produção de espécies reativas de oxigênio (EROS), cálcio intracelular e apoptose foram realizadas por fluorimetria. Foram consideradas diferenças significativas quando p<0,05. O colostro de mulheres com excesso de peso pré-gestacional apresentou uma maior concentração de melatonina (p<0,05). Os fagócitos MN do grupo excesso de peso teve um menor índice de fagocitose (p<0,05). No entanto, os estímulos foram capazes de restaurar a atividade fagocítica para este grupo (p<0,05). A adiponectina+leptina foi o estímulo que desenvolveu uma resposta mais efetiva, com restauração dos níveis de EROS, manutenção do cálcio intracelular e elevação do índice de apoptose para o grupo com excesso de peso (p<0,05). Os dados em conjunto reforçam a hipótese de que amamentação é benéfica para a saúde da criança. A manutenção dos níveis endógenos de adiponectina, leptina e melatonina pode aumentar a proteção e diminuir os índices de infecção neonatais, em filhos de mulheres com excesso de peso. Assim, políticas públicas que apoiam o controle de peso pré-gestacional devem ser encorajadas / Breastfeeding promotion represents an important public health iniciative in worldwide overweight and obesity management strategies. It is possible that the hormones regulating energy metabolism, such as adiponectin, leptin and melatonin of human colostrum can benefit the infant\'s immune system and minimize the impacts caused by pre-gestational maternal overweight. As these hormones also have immunomodulatory action, changes in their concentrations can affect the functional activity of mononuclear cells of human colostrum and contribute to the increase of neonatal infections. Therefore, the aim of this study is to analyze the functional activity of colostrum mononuclear phagocytes in women with pregestational overweight, with absence or presence of adiponectin, leptin and melatonin. Colostrum samples collected from 109 healthy donors were divided into two groups: the control group and the high body mass index (BMI) group. Colostrum samples were centrifuged to obtain the cell button and supernatant. The supernatant was used for melatonin dosing performed by ELISA, mononuclear cells used to phagocytosis assay, by flow cytometry and production of reactive species of oxygen, intracellular calcium and apoptosis assays were performed by fluorimetry using plate reader. Statistically significant differences were considered when p <0.05. Colostrum of pre-gestational high BMI group had higher concentration of melatonin (p <0.05). Mononuclear phagocytes of high BMI group had a lower index of phagocytosis (p <0.05). However, the stimuli restored the phagocytic activity for high BMI group (p <0.05). Adiponectin+leptin was the stimulus that developed a more effective response, with restoration of reactive oxygen species levels, maintenance of intracellular calcium and elevation of apoptosis index (p < 0.05) in the high BMI group. These data reinforce that breastfeeding is beneficial to child\'s health and maintaining endogenous levels of adiponectin, leptin and melatonin may increase protection and decrease neonatal infection rates in children of women with high BMI. Thus, public policies that support pre-gestational weight control should be encouraged.

O hormônio do crescimento (GH) age sobre tecidos periféricos e está relacionado com várias funções do organismo como, o controle do metabolismo, crescimento somático e processos celulares. Existem evidências que o GH pode exercer efeitos sobre o sistema nervoso central (SNC). Neurônios que co-expressam o neuropeptideo Y (NPY) e a proteína relacionada agouti (AgRP) estão localizados na parte ventromedial do núcleo arqueado do hipotálamo (ARH). Com intuito de estudar a ação do GH especificamente em neurônios NPY/AgRP, iremos utilizar o sistema Cre-LoxP que permite a manipulação gênica de maneira tecido-específica. Sendo assim, inativamos o receptor de GH em neurônios NPY/AgRP em animais fêmeas (GHR/AgRP KO). Como já é bem sabido, essa população de neurônios é conhecida como um potente estimulador do apetite, objetivamos verificar se a falta do receptor de GH (GHR), pode impactar fatores metabólicos. Na validação do modelo observamos que os neurônios NPY/AgRP são responsivos ao GH. As fêmeas GHR/AgRP KO não apresentam diferença no peso corporal. Além disso, não foram observadas diferenças na avaliação metabólica, como, tolerância à glicose, sensibilidade à insulina ou na resposta à leptina. Assim como não observamos diferenças significativa no gasto energético. Quando desafiadas à restrição alimentar, as fêmeas GHR/AgRP KO apresentam maior dificuldade de sustentar a glicemia e perdem mais peso que as fêmeas controles. Por outro lado, a resposta contra regulatória à hipoglicemia é similar entre os animais GHR/AgRP KO e os controles. Ainda, quando expostas ao estresse por contenção, as fêmeas GHR/AgRP KO apresentaram consumo alimentar similar aos animais do grupo controle. Um segundo grupo foi gerado com o intuito de analisarmos o equilíbrio energético e homeostase da glicose durante a gestação e lactação. Os grupos responderam de forma similar tanto ao que se refere ao equilíbrio energético, quanto em relação a glicemia. Por fim, após os aspectos relacionados ao metabolismo energético, utilizando a técnica de ensaio de flexão de três pontos, que analisa parâmetros relacionados ao metabolismo ósseo, observamos que o grupo controle e GHR/AgRP KO não apresentaram diferenças significantes nos parâmetros ósseos analisados. Nossos resultados sugerem que o GH exerce efeito sobre o metabolismo via neurônios NPY/AgRP apenas durante situações de estresse crônico como por exemplo, em situação de privação alimentar. / Growth hormone (GH) acts on peripheral tissues and is related to various functions of the organism such as metabolism control, somatic growth and cellular processes. There is evidence that GH may exert effects on the central nervous system (CNS). Neurons co-expressing the neuropeptide Y (NPY) and related protein agouti (AgRP) are located in the ventromedial part of the arcuate nucleus of the hypothalamus (ARH). In order to study the action of GH specifically on NPY/AgRP neurons, we will use the Cre-LoxP system that allows a genetic manipulation in a tissue-specific manner. Thus, we inactivate the GH receptor in NPY/AgRP neurons in female animals (GHR/AgRP KO). It is well established that this population of neurons is known as a potent stimulator of appetite, so we aim to verify if the lack of the GH receptor (GHR) can impact metabolic factors. In the validation of the model we observed that NPY/AgRP neurons are responsive to GH. GHR/AgRP KO females shown no difference in body weight. In addition, no differences were observed in metabolic evaluation, such as glucose tolerance, insulin sensitivity or leptin response. As well as we didn\'t observe significant differences in energy expenditure. When challenged with dietary restriction, GHR/AgRP KO females presented greater difficulty in sustaining glycemia and lost more weight than control females. On the other hand, the counter-regulatory response to hypoglycemia is similar between the GHR/AgRP KO and control animals. Also, when exposed to containment stress, the GHR/AgRP KO females presented similar food consumption to the control animals. A second group was generated with the purpose of analyzing the energy balance and glucose homeostasis during pregnancy and lactation. The groups responded similarly to both energy balance and glycemia. Finally, after the aspects related to energy metabolism, using the three-point flexural test technique, which analyzes parameters related to bone metabolism, we observed that the control and GHR/AgRP KO groups didn\'t present significant differences in the analyzed bone parameters. Our results suggest that GH exerts an effect on the metabolism via NPY/AgRP neurons only during situations of chronic stress such as food deprivation.

No experimento 1, avaliou-se os efeitos da leptina exógena na concentração sérica de leptina e na expressão do gene LEP no tecido adiposo de novilhas zebuínas pré-púberes. Amostras de tecido adiposo (mesentérico, perirenal e subcutâneo) e de sangue foram obtidas de 36 novilhas, distribuídas nos tratamentos: A) dieta de alta energia; B) dieta de baixa energia; BL) dieta de baixa energia + 4,8 g/kg PV de oLeptin subcutânea, duas vezes ao dia, por 56 dias. A concentração de leptina foi determinada com kit comercial ELISA (Cusabio) específico. Amostras de sangue de quatro novilhas por grupo foram coletadas em seis pontos no tempo, sendo um antes e um após o tratamento hormonal. Dois dias após a obtenção da puberdade, oito novilhas por grupo foram abatidas para coleta de tecido. A expressão gênica foi quantificada nos depósitos de gordura por PCR em tempo real. A oLeptina aumentou transitoriamente a concentração de leptina do grupo BL, com pico (11,1 ± 1,4 ng/mL) após 7 dias do início do tratamento. A leptina sérica do grupo A aumentou linearmente no tempo, enquanto no grupo B, manteve-se constante (4,0 ± 2,0 ng/mL). A dieta A aumentou a expressão de leptina no tecido adiposo em 2,4 vezes; e a administração de oLeptina diminuiu a expressão do gene LEP em cerca de 2,5 vezes, comparando com o grupo controle. A redução na expressão do gene LEP explica a redução na leptina sérica do grupo BL após 30 dias de tratamento hormonal. O objetivo do experimento 2 foi clonar a região codificadora da leptina bovina, transformar leveduras Pichia pastoris KM71H e expressar a proteína no meio de cultura. O gene da leptina foi amplificado em reação de PCR, a partir de amostra de tecido adiposo subcutâneo de novilha do grupo A. Os primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (senso) e 5\' - ATTGTCGACGCACCCGGGACTGAGGT - 3\' (antisenso), contendo sítios EcoRI e SalI, foram desenhados com base na sequência do mRNA da leptina bovina (NM 173928.2), substituindo a sequência sinal de secreção nativa pela sequência do Fator do Saccharomyces cereviasiae. O inserto foi clonado nos vetores de expressão pPICZ&alpha;A e pGAPZ&alpha;A (Invitrogen), sendo as leveduras transformadas por eletroporação. Clones com múltiplas cópias do gene foram selecionados em meio YPD + 500 &#956;g/mL de zeocina, e 22 colônias recombinantes foram selecionadas para análise de expressão em pequena escala. Colônias pPICbLep foram inicialmente cultivadas em meio de crescimento (BMGY), sendo transferidas para meio de indução (BMMY), contendo metanol. A indução durou 144 horas. Alíquotas de 200 &#956;l de sobrenadante foram coletadas diariamente, para análise da presença da bLeptina por SDS-PAGE. As colônias pGAPbLep foram cultivadas em meio YPD por 96 h, com coleta de sobrenadante a cada 24 h. As leveduras foram transformadas com sucesso, com os plasmídeos pPICbLep e pGAPbLep, entretanto, apenas as colônias pGAPbLep expressaram uma proteína de 35 kDa, o dobro do tamanho esperado para a bLeptina (17 kDa), provavelmente por ocorrência de dimerização. Mais estudos são necessários sobre os processos de produção de leptina recombinante bovina em Pichia pastoris. / In experiment 1, the effects of exogenous leptin were evaluated on serum leptin levels and on LEP gene expression in the adipose tissue of prepubertal zebu heifers. Adipose tissue (mesenteric, perirenal and subcutaneous) and blood samples were collected from 36 heifers, distributed among treatments: A) high energy diet; B) low energy diet; BL) low energy diet + 4,8 g/kg BW subcutaneous oLeptin, twice daily, for 56 days. Leptin concentration was determined with specific commercial ELISA kit (Cusabio). Blood from four heifer per group was sampled in six time points, one before and one after the hormonal treatment. Two days after puberty attainment , eight heifers per group were slaughter for tissue sampling. Gene expression was quantified in fat depots by real time PCR. The oLeptin increased transiently leptin concentration in group BL, with a peak (11,1 ± 1,4 ng/mL) after 7 days of treatment. Serum leptin in group A increased linearly in time, while in group B it remained constant (4,0 ± 2,0 ng/mL). Diet A enhanced leptin expression in the adipose tissue 2.4-fold, and oLeptin administration decreased de expression 2.5-fold, comparing to the control group. The decrease in LEP gene expression explains the reduction in serum leptin from group BL after 30 d of hormonal treatment. The objective with experiment 2 was to clone de codifying region of bovine leptin, transform KM71H Pichia pastoris yeasts, and express the protein in culture media. The leptin gene was amplified by PCR, from subcutaneous adipose tissue sample from a heifer in group A. Primers 5\' - ATTGAATTCGTGCCCATCTGCAAGGTC - 3\' (forward) and 5\' - ATTGTCGACGCACCCGGGACTGAGGT 3 (reverse), containing EcoRI and SalI restriction sites, were designed based in the mRNA sequence from bovine leptin (NM 173928.2), replacing the native secretion signal sequence by the -factor sequence from Saccharomyces cereviasiae. The insert was cloned in the expression vectors pPICZ&alpha;A and pGAPZ&alpha;A (Invitrogen), and yeasts were transformed by electroporation. Clones with multiple copies of the gene were selected in YPD + 500 &#956;g/mL zeocina, and 22 recombinant colonies were selected for a small-scale expression analysis. pPICbLep colonies were initially cultivated in growth media (BMGY), and then transferred to the induction media (BMMY), containing methanol. The colonies were inducted for 144 h. Supernatant aliquots (200 &#956;l) were collected daily, for bLeptin analysis in SDS-PAGE. pGAPbLep colonies were cultivated in YPD media for 96 h, collecting supernatant samples each 24 h. Yeasts were successfully transformed with the plasmids pPICbLep and pGAPbLep, however, only pGAPbLep colonies expressed a protein with 35 kDa, twice the size expected for the bovine leptin (17 kDa), probably because of dimerization. More studies are necessary about the recombinant bovine leptin production processes in Pichia pastoris.